ID: 915297502

View in Genome Browser
Species Human (GRCh38)
Location 1:154931560-154931582
Sequence CTGCACTGCATGGGAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915297502_915297510 21 Left 915297502 1:154931560-154931582 CCTGTCTTTCCCATGCAGTGCAG 0: 1
1: 0
2: 2
3: 23
4: 242
Right 915297510 1:154931604-154931626 AACAGTGCTGAACATGAGACAGG 0: 1
1: 0
2: 1
3: 15
4: 155
915297502_915297506 -9 Left 915297502 1:154931560-154931582 CCTGTCTTTCCCATGCAGTGCAG 0: 1
1: 0
2: 2
3: 23
4: 242
Right 915297506 1:154931574-154931596 GCAGTGCAGGAACACATCCCAGG 0: 1
1: 0
2: 1
3: 6
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915297502 Original CRISPR CTGCACTGCATGGGAAAGAC AGG (reversed) Intronic
900215852 1:1481150-1481172 CTTCACTTCATGGGAAGTACAGG + Intronic
900222990 1:1519204-1519226 CTTCACTTCATGGGAAGTACAGG + Intronic
903576161 1:24341012-24341034 CTGCACAGCCAGGGAAAGAAGGG + Intronic
904504477 1:30939475-30939497 CTGCCCAGCATGGAAAAGACTGG + Intronic
904851129 1:33460668-33460690 ATGCTCTGCCTGGGAATGACGGG - Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907309793 1:53532680-53532702 CTGCCCTGCATGGGCCAGAGGGG - Intronic
907392397 1:54166830-54166852 GAGAACAGCATGGGAAAGACTGG + Intronic
907984318 1:59515631-59515653 GAGAACAGCATGGGAAAGACTGG - Intronic
908311522 1:62889312-62889334 TTGAACTGAATGGGATAGACAGG - Intergenic
909023690 1:70460262-70460284 CTGAAATGTATGGGAAAGCCTGG + Intergenic
909442393 1:75712161-75712183 GTACACTACATGGTAAAGACTGG + Intergenic
909488354 1:76198901-76198923 CTCCACTGAATGGGAAGGCCTGG + Intronic
909561360 1:77012558-77012580 CTGCACTGACAGGGAAAGACAGG + Intronic
911084798 1:93967511-93967533 CTAAATTGCAAGGGAAAGACCGG - Intergenic
911244448 1:95501205-95501227 CAACACTGCATGGGACAGACTGG - Intergenic
912542226 1:110425753-110425775 CTGCAAAGCATGGGAAAAGCAGG - Intergenic
912942909 1:114060929-114060951 ATGCACTGCGGGGGAAAGAGTGG + Intergenic
914324797 1:146602051-146602073 CTTTACTGCCTGGGAATGACTGG - Intergenic
914384781 1:147157969-147157991 CAGCTTTGCATGGGAAAGACAGG + Exonic
914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG + Intergenic
915165920 1:153947745-153947767 CTCCACTGCAAGGGGAAGAGTGG + Exonic
915297502 1:154931560-154931582 CTGCACTGCATGGGAAAGACAGG - Intronic
915424685 1:155815074-155815096 CTGCACTCCATGGGCAACAGAGG + Intronic
916196366 1:162227177-162227199 ATGCACAGCGGGGGAAAGACTGG - Intronic
916462880 1:165045297-165045319 CTCCACTGTATGGGAATGAAAGG + Intergenic
920748693 1:208653427-208653449 CTGAACTCCTTGGGAAAGAATGG - Intergenic
921502990 1:215929525-215929547 CTGCAGTCTATGTGAAAGACAGG + Intronic
922551522 1:226497825-226497847 TTGCCCTGCATGGAAAATACAGG - Intergenic
922891517 1:229065553-229065575 CTTTAGTGCATGGGAAAGAGAGG + Intergenic
1062851038 10:743627-743649 CTGCATTTAGTGGGAAAGACAGG - Intergenic
1066470297 10:35691339-35691361 GTGGACTGCAGCGGAAAGACTGG - Intergenic
1067562477 10:47313726-47313748 CTGGAAAGCATGGGAAAGCCTGG - Intergenic
1067569288 10:47359919-47359941 CTGCCCTGGAGGGGAAAGAAAGG - Intergenic
1069514759 10:69068776-69068798 GTGCACTGCTTGGGAAACAATGG - Intergenic
1070522136 10:77263270-77263292 GTGCAGTGCAAGGGAAAGGCGGG - Intronic
1074334250 10:112553201-112553223 CTTCACTGCAGGTGAAAGAGAGG - Intronic
1075792323 10:125093840-125093862 CTGCTCTGCATTGGAAAACCCGG + Intronic
1076052842 10:127349109-127349131 TTTAACTTCATGGGAAAGACTGG - Intronic
1076261778 10:129072152-129072174 GAGAACAGCATGGGAAAGACAGG - Intergenic
1076519291 10:131070727-131070749 CAGCACTCCATGGGCAAGGCTGG + Intergenic
1076711995 10:132341772-132341794 CTGCACATCTTAGGAAAGACTGG + Intronic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1078567701 11:12431164-12431186 CTACACAGGATGGGAAACACTGG - Intronic
1083274548 11:61589160-61589182 GGGCACTGGATGGAAAAGACTGG - Intergenic
1084351254 11:68601442-68601464 CCACACTGCCTGGGAGAGACTGG - Intronic
1084440688 11:69171076-69171098 CTGCACTTTGTGGGAAAAACAGG + Intergenic
1084972632 11:72780230-72780252 CTGCCCTGCACGGCAAAGAGAGG + Intronic
1086231573 11:84577001-84577023 CAGAATAGCATGGGAAAGACTGG - Intronic
1086721708 11:90128991-90129013 CAGAATAGCATGGGAAAGACTGG + Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1090041053 11:123291798-123291820 CTGCAGTTCATAGGAAATACAGG + Intergenic
1090978517 11:131695969-131695991 CTGGAGTGCATGAGAAAAACTGG + Intronic
1090991942 11:131825573-131825595 CTGCACTGTATGGGAAGGTTGGG + Intronic
1091278514 11:134368813-134368835 CTGCCCTGCATGGGCATGGCTGG + Intronic
1092080100 12:5708944-5708966 TTACAGTCCATGGGAAAGACTGG - Intronic
1094111051 12:26863168-26863190 CTGCACACCATAGGAGAGACAGG + Intergenic
1094233938 12:28141033-28141055 CTAGACTCTATGGGAAAGACAGG + Intronic
1096226576 12:49870049-49870071 CTGACCTGGATGAGAAAGACAGG + Exonic
1096686650 12:53292556-53292578 CTTCACTGCAGGGAAAAGGCAGG - Exonic
1097043804 12:56172486-56172508 TTGCTCTGCAGGGGAAACACAGG + Exonic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097332305 12:58344656-58344678 CTGCATTGAAAGGGAAAGAGAGG + Intergenic
1098182343 12:67861239-67861261 CTGCATTGCATAGGAAAATCAGG - Intergenic
1098238493 12:68442210-68442232 CGGAATAGCATGGGAAAGACTGG + Intergenic
1099949338 12:89283138-89283160 CTGCACTTCCTGGGAAACAGTGG + Intergenic
1100598325 12:96090501-96090523 GAGAACAGCATGGGAAAGACTGG - Intergenic
1100774249 12:97956902-97956924 CTGTAATACATGGGAAAGACTGG + Intergenic
1101933684 12:109037750-109037772 CGGCACTCCTTGGCAAAGACTGG - Intronic
1102589461 12:113946471-113946493 CTGCCCTGGATGGGAATGACGGG + Exonic
1103003769 12:117406013-117406035 CTGCTCTGCATGGGCCAGGCTGG - Intronic
1103401878 12:120648930-120648952 CTCCAATGAATGGGAAGGACGGG - Intronic
1103576672 12:121882601-121882623 CTCCAGTGCATGGGACAGACAGG + Intergenic
1103968124 12:124652975-124652997 CTGCAGTGCAGGGGAGAGAAGGG + Intergenic
1104766211 12:131331957-131331979 CTGCACTGAAAGTGAAAGAATGG - Intergenic
1104813189 12:131630576-131630598 CTGCACTGTAAGTGAAAGAATGG + Intergenic
1106224977 13:27778461-27778483 ATGCAATGCATGGGTAAGGCGGG - Intergenic
1106932660 13:34683567-34683589 CTGCACTGCATAAAAAACACTGG - Intergenic
1107583844 13:41822414-41822436 CTACACTGCATAGGAAAAAGGGG - Intronic
1107702494 13:43061980-43062002 CTGTATTGCATGTGAGAGACGGG - Intronic
1107922559 13:45224943-45224965 CTGCAGTGAATAAGAAAGACAGG + Intronic
1112384874 13:98930367-98930389 CTGCACTGGATGGGAGAAACTGG - Intronic
1113375793 13:109764641-109764663 CTGTGCTGCCAGGGAAAGACAGG + Intronic
1113802472 13:113093807-113093829 CTCCCCCGCATGGGAAAGGCCGG + Intronic
1114200651 14:20516919-20516941 CTTCATTTCATGGGAAAGAGAGG - Intergenic
1114615764 14:24067550-24067572 CTGCACTACAGGGGAGAGAGGGG - Intronic
1115518805 14:34212305-34212327 CTGCACGGCATAGGAAACACAGG - Intronic
1116148078 14:41100481-41100503 GAGAATTGCATGGGAAAGACGGG - Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1118370071 14:65130315-65130337 CTGTACTAGATGAGAAAGACAGG - Intergenic
1118935785 14:70286880-70286902 CAGAATAGCATGGGAAAGACTGG - Intergenic
1119037796 14:71245498-71245520 CTGCTTTGCATGGGAGAGAAAGG - Intergenic
1119165258 14:72487116-72487138 CATCATTGCATGGAAAAGACAGG - Intronic
1120104803 14:80481348-80481370 AAGAACAGCATGGGAAAGACCGG + Intronic
1120251874 14:82068545-82068567 CTGCTCTGCATTGGATACACTGG + Intergenic
1120764042 14:88312045-88312067 CTGCACAAAATGGCAAAGACAGG - Intronic
1121267525 14:92614018-92614040 CTGCCCTGCTTGGGAAAGCCAGG - Intronic
1121822480 14:96982655-96982677 CTACAGTGCATGGGAAAGAATGG - Intergenic
1122863632 14:104593739-104593761 CTGCTCTGCAGGGAAAGGACAGG + Intronic
1127844316 15:62856491-62856513 CTGCACTGCCTGGCAGAGGCCGG - Intergenic
1129195784 15:73965382-73965404 CTTCACTGCAGGAAAAAGACTGG - Intergenic
1131049659 15:89338167-89338189 CTGCACTACACGGCAAATACTGG + Intergenic
1131341069 15:91601388-91601410 ATTTACTGCATGGGAAATACTGG - Intergenic
1133297887 16:4764140-4764162 CTGTACTGGATGGCACAGACAGG - Intronic
1135400603 16:22163917-22163939 CTGCCCTGCATGGCATATACTGG - Intergenic
1137670387 16:50275009-50275031 CTGCATTCCATGGGAGAGGCAGG + Intronic
1138024621 16:53512746-53512768 AAGAACAGCATGGGAAAGACCGG + Intergenic
1139672863 16:68503599-68503621 GTGAAGTGCCTGGGAAAGACAGG - Intergenic
1140008766 16:71108895-71108917 CTTTACTGCCTGGGAATGACTGG + Intronic
1143965916 17:10756397-10756419 CTGCACTGAATAGGAAACCCTGG - Intergenic
1144128578 17:12224394-12224416 CTGCACGAGATGGGAAAGCCTGG - Intergenic
1144995515 17:19265486-19265508 CTGCTCTGCATGGGGCAGAAAGG + Intronic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1145304507 17:21666016-21666038 CTGCAAGGCCTGGGGAAGACTGG - Intergenic
1151070648 17:71206916-71206938 GTGCAATGCATAGGAATGACTGG + Intergenic
1152834476 17:82520225-82520247 CTGCGCTGCTTGGGCAAGAACGG + Exonic
1155489819 18:26389552-26389574 CTGCAATGCACTGGAAAGAATGG + Intronic
1156997041 18:43481301-43481323 CTGTATTGCATGGGACAGGCTGG - Intergenic
1164567384 19:29337101-29337123 TTGAAATGCCTGGGAAAGACGGG - Intergenic
1165401466 19:35603392-35603414 CTGCACTGGAGGAGAAAGATGGG + Intergenic
929356533 2:41031198-41031220 GAGGACAGCATGGGAAAGACTGG + Intergenic
929533819 2:42768152-42768174 GTGCACTGCACGTGAAAGGCAGG - Intronic
933645251 2:84807554-84807576 CTGCACTGCATAGGAAAGGTTGG - Intronic
934980397 2:98834489-98834511 CAGCACTGCATGGGAAAGGGGGG + Intronic
936904604 2:117522805-117522827 TTGCACTTCATGGGAAAAATAGG - Intergenic
936938670 2:117860774-117860796 CTGAACTGCAGAGGATAGACTGG - Intergenic
938992072 2:136639903-136639925 CTCCACTGCATGCTAAGGACAGG - Intergenic
940408655 2:153334977-153334999 TTGAATAGCATGGGAAAGACTGG - Intergenic
941224050 2:162822796-162822818 TTACAGTGCATGGGAAACACAGG + Intronic
941477389 2:165966707-165966729 GAGAACAGCATGGGAAAGACTGG - Intergenic
944505706 2:200408409-200408431 CTGAATTGCAGGGGAGAGACTGG + Intronic
946458626 2:219850327-219850349 CTGCACTCCATGGAAAAGGGAGG + Intergenic
947316336 2:228863405-228863427 CTGAACAGAATTGGAAAGACTGG - Intronic
947675678 2:231977120-231977142 CTGCACTGAAAGTGAAAAACTGG + Intronic
947857137 2:233331622-233331644 TTCCACTGCAAGGGGAAGACGGG - Exonic
948616747 2:239204215-239204237 CTGCACAGCATGGGGACGCCGGG - Intronic
948624500 2:239260781-239260803 CTGCCCTCCATGGGAAAGAGAGG - Intronic
949070146 2:242019508-242019530 CGGCACAGCAGGGGAAAGGCTGG + Intergenic
1168873750 20:1154985-1155007 CTGCACTGAATAGGAAACTCAGG - Intronic
1169264365 20:4158653-4158675 CGGGGCTGCATGGGGAAGACAGG - Intronic
1169488856 20:6054805-6054827 GAGAACAGCATGGGAAAGACTGG - Intergenic
1171257842 20:23704344-23704366 CTGTACTGAATAGAAAAGACAGG - Intergenic
1173549739 20:43924287-43924309 CTGCTCTGCGTAGGAAAGGCAGG + Intronic
1174285377 20:49469042-49469064 TTGAACTGGATGGGAAAGGCTGG + Intronic
1174506269 20:51019743-51019765 CTGCAGGGCCTGGGAAAGAGTGG - Intronic
1175195521 20:57240800-57240822 CAAAACAGCATGGGAAAGACTGG + Intronic
1175353713 20:58345552-58345574 ATGCCCTGCATGGAGAAGACAGG + Intronic
1176655827 21:9588443-9588465 CTGCAAGGCCTGGGGAAGACTGG - Intergenic
1176827579 21:13714937-13714959 CTGCGCTGCCTGGGGAAGAAAGG + Intergenic
1178576677 21:33798796-33798818 ATGCAGTCCAGGGGAAAGACTGG + Intronic
1179654132 21:42834676-42834698 GTGCCCTGCATGGGAAAGATGGG - Intergenic
1180084851 21:45503993-45504015 CTGCCCTGCAAGAGAGAGACAGG - Exonic
1181592696 22:23894847-23894869 CTGCACAGCATCGGCAAGATCGG + Exonic
1181602741 22:23961778-23961800 CTGCTCTGCAGGGGACAGTCTGG - Intergenic
1181605773 22:23979529-23979551 CTGCTCTGCAGGGGACAGTCTGG + Intronic
1182330474 22:29548075-29548097 AAGAACAGCATGGGAAAGACCGG + Intronic
1183175782 22:36223815-36223837 CTGCACTTAAGGGGAATGACAGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
952655460 3:35780231-35780253 AGGCACTGCATGTGAAATACAGG + Intronic
952769882 3:36989676-36989698 CTGCAGTGCATGGGACAGCCTGG - Exonic
955128879 3:56143443-56143465 GAGAACAGCATGGGAAAGACTGG - Intronic
955786249 3:62542538-62542560 CTGCACAGCAAGCAAAAGACTGG + Intronic
957035182 3:75287820-75287842 CTGAAATGCCTGGGAAGGACAGG + Intergenic
957963274 3:87288607-87288629 CAGAATAGCATGGGAAAGACCGG - Intergenic
958839203 3:99183055-99183077 CTCCACTGGATGGAAGAGACTGG + Intergenic
959172392 3:102859253-102859275 GAGAACAGCATGGGAAAGACTGG + Intergenic
960199042 3:114809904-114809926 CGGCACAGCATGGGGAAGAGAGG - Intronic
961336522 3:126183457-126183479 CTGCATTTCATGGAAAAGAAGGG + Intronic
964033050 3:152162114-152162136 CTACACTGCAGGGAAAAGAAGGG - Intergenic
965481898 3:169229067-169229089 CTGCACTGGCTTGGAAACACTGG + Intronic
965535823 3:169822771-169822793 CTGCTCTACCTGGGAAACACCGG + Exonic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
968565470 4:1310361-1310383 CGGCACTGCTTAGGAAAGACGGG - Intronic
970398932 4:15699731-15699753 CAGAATAGCATGGGAAAGACCGG + Intronic
972799612 4:42461022-42461044 CTGCCCAGCATGGTAGAGACTGG + Intronic
974105554 4:57466118-57466140 CTGCACTAGATGGTAAAGAGAGG - Intergenic
975439881 4:74399038-74399060 GTGCACTGCATGGGACTGGCAGG - Intergenic
976161223 4:82201496-82201518 CTGCAGTCCATGGGCAAGTCTGG + Intergenic
976286630 4:83376917-83376939 TAGCATAGCATGGGAAAGACTGG + Intergenic
976620025 4:87117946-87117968 CTGCTCTCCATGGCAGAGACAGG + Intronic
981328555 4:143481481-143481503 TTACACTGGATGGGAAGGACAGG + Intergenic
981611276 4:146596451-146596473 CTACACTGGAAGGGAAGGACAGG + Intergenic
982823582 4:159974816-159974838 CCACACTCCAAGGGAAAGACAGG + Intergenic
984180653 4:176478818-176478840 ATGCAATGCATGTGAAAGAAAGG + Intergenic
985715617 5:1458083-1458105 CTGACCTGCCTGGGAGAGACGGG + Intronic
986076418 5:4342412-4342434 CGGCTCTTCATGGGAAAGGCAGG + Intergenic
987207002 5:15638250-15638272 CTCCACTGCACGTGAAAGTCTGG - Intronic
987447526 5:18038634-18038656 CTGCACTGGATTGGAAACTCTGG + Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
990524486 5:56611317-56611339 GAGAACAGCATGGGAAAGACTGG + Intergenic
991131888 5:63132183-63132205 TTGCTGTGCACGGGAAAGACTGG - Intergenic
991277898 5:64872358-64872380 CTGCACTGTATGAGAGAGGCAGG + Intronic
999268987 5:150285449-150285471 CAGCTCTGCCTGGGAAAGGCAGG + Intronic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
999805035 5:155073214-155073236 GAGAACAGCATGGGAAAGACCGG + Intergenic
999941874 5:156551815-156551837 ATGCACAGCATGGGAATGTCAGG - Intronic
1001514974 5:172349326-172349348 CTGCCCTGCACGGCCAAGACAGG + Intronic
1003238338 6:4318630-4318652 CAGCACTGTCTGGGAAAGTCTGG + Intergenic
1004392592 6:15222067-15222089 CTGCAGTGCAGGGTCAAGACAGG - Intergenic
1005637474 6:27765746-27765768 TTGCACTGCTGGGTAAAGACGGG - Intergenic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1006904892 6:37526575-37526597 GTGCACTGCAGAGGAAGGACTGG - Intergenic
1008101726 6:47398871-47398893 CTCCTCTGCATGGGGAAGAGTGG - Intergenic
1009414113 6:63396686-63396708 CTGCAAAGGGTGGGAAAGACAGG + Intergenic
1010157971 6:72816936-72816958 CTGCCTTGCATATGAAAGACAGG + Intronic
1011955300 6:93017989-93018011 ATCCACTGCTTGGGAAATACTGG - Intergenic
1013341096 6:109216776-109216798 CTGCTCTGCATGGAAAAGCCAGG + Intergenic
1013412569 6:109894517-109894539 CTGCACAGAAGGGGAAAAACAGG + Intergenic
1013643730 6:112114196-112114218 CTGAAATGCAGGGCAAAGACTGG + Intronic
1014566253 6:122952696-122952718 CTGCACAGCAAAGGAAAGATGGG + Intergenic
1014742284 6:125159944-125159966 GAGAACAGCATGGGAAAGACCGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018504296 6:164447872-164447894 CTGCACTGAAAGTGAAAAACAGG - Intergenic
1019882742 7:3877230-3877252 CTCCAATGCATGGAAAAAACAGG - Intronic
1024090425 7:45935234-45935256 CTGCATTCCATGGGAAAGACAGG + Intergenic
1024822592 7:53350470-53350492 GTGCACTGCATTGGAAAGACAGG + Intergenic
1025302203 7:57826780-57826802 CTGCAAGGCCTGGGGAAGACTGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1029116776 7:98241642-98241664 CTTCACTGAATGGTTAAGACTGG + Intronic
1029465013 7:100720133-100720155 CTGCACTGCCTGGGCAACATAGG + Intergenic
1029703198 7:102261160-102261182 CTGAACTTCTTGGAAAAGACAGG - Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1033040897 7:137917303-137917325 CAGCACTGCCTGGAAAAGCCGGG + Intronic
1035095194 7:156348369-156348391 TAGCACAGCATGAGAAAGACTGG - Intergenic
1035647998 8:1243134-1243156 GAGCACTGCATGGGAAAGGCAGG + Intergenic
1036098527 8:5751821-5751843 AAGAACAGCATGGGAAAGACCGG + Intergenic
1036457913 8:8925720-8925742 CAGAATAGCATGGGAAAGACCGG + Intergenic
1036708485 8:11062047-11062069 CTGCATTCCATGGGACAGACAGG + Intronic
1037647411 8:20805125-20805147 AAGAACAGCATGGGAAAGACTGG + Intergenic
1037900137 8:22683382-22683404 CTGCACTGCTTAGGAAGGTCAGG - Intergenic
1042165256 8:65938946-65938968 CTGAAGTGCATGGGAAACCCAGG - Intergenic
1044704172 8:94992606-94992628 ATTCACAACATGGGAAAGACTGG - Intronic
1047194718 8:122711248-122711270 TAGAACAGCATGGGAAAGACTGG - Intergenic
1047505416 8:125475754-125475776 CTGCACTGGTTGGGAGGGACAGG - Intergenic
1048119406 8:131563221-131563243 CAGCATGGCATGGGGAAGACTGG + Intergenic
1049373637 8:142279151-142279173 CTGCCCTGCATGGGAAAGTAGGG + Intronic
1049422832 8:142524473-142524495 CTGCACTGCATGCCAAGGGCAGG - Intronic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1050372305 9:4934238-4934260 TTACACTGGATGGGAAAGTCAGG - Intergenic
1050572461 9:6955398-6955420 CTGCACTGCATGAAAAACAAAGG - Intronic
1050782532 9:9355651-9355673 CTGGATTTCATGAGAAAGACAGG + Intronic
1051714262 9:19964967-19964989 TTGAACTCCATGGGGAAGACAGG - Intergenic
1052381681 9:27778417-27778439 GAGAACAGCATGGGAAAGACTGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1054877389 9:70111121-70111143 CTGCACAGCTTGTGAACGACAGG + Intronic
1055727132 9:79242606-79242628 CTACTGTGCATGGGAAAGCCAGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1059549716 9:115216758-115216780 AGGAACAGCATGGGAAAGACCGG - Intronic
1060224654 9:121783602-121783624 GCGCACTGCATGGGAAATAGCGG + Exonic
1060959734 9:127671578-127671600 CTGCACCCAATGGGCAAGACAGG - Intronic
1062083842 9:134638450-134638472 CTCCCCTGCATGGGACAGAGTGG + Intergenic
1062172019 9:135140092-135140114 CAGCACTGCAGGGGAAAGGAAGG + Intergenic
1062617129 9:137402957-137402979 GAGAACAGCATGGGAAAGACCGG + Intronic
1203633544 Un_KI270750v1:91904-91926 CTGCAAGGCCTGGGGAAGACTGG - Intergenic
1186109388 X:6239887-6239909 AAGAACAGCATGGGAAAGACCGG + Intergenic
1186307058 X:8273245-8273267 ATGCTCTCCATGGGCAAGACTGG - Intergenic
1189311776 X:40024155-40024177 CTGCATTCCAAGGGATAGACTGG - Intergenic
1192250416 X:69408483-69408505 CTGCCCTACATGGGGAAGGCAGG + Intergenic
1193535716 X:82712954-82712976 AGGCACTGCATGGGACAGAGTGG - Intergenic
1193886800 X:86992993-86993015 CTGCACTGGGTGGCAAAGTCAGG - Intergenic
1194893610 X:99411703-99411725 ACGCACTGCATGAGAAAGACTGG - Intergenic
1195310539 X:103628636-103628658 CTGAACTGCAGGGGAAATAAGGG + Intronic
1195598885 X:106723960-106723982 GTGCAAAGCATGGGAGAGACAGG - Intronic
1196740530 X:119021231-119021253 CTGCACAGCTTGGGAATGAAGGG + Intergenic
1196784216 X:119407999-119408021 CAGCAGTGCACGGGGAAGACTGG - Intronic
1198152396 X:133923654-133923676 CTGAACAGCATGGGAACAACTGG + Intronic