ID: 915298573

View in Genome Browser
Species Human (GRCh38)
Location 1:154939089-154939111
Sequence CCTCGGTGACATCACGGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915298567_915298573 12 Left 915298567 1:154939054-154939076 CCCAGTCTCCTTTTCTACAGAGT 0: 1
1: 0
2: 4
3: 20
4: 292
Right 915298573 1:154939089-154939111 CCTCGGTGACATCACGGTCATGG 0: 1
1: 0
2: 0
3: 7
4: 70
915298566_915298573 21 Left 915298566 1:154939045-154939067 CCACTGGCTCCCAGTCTCCTTTT 0: 1
1: 0
2: 5
3: 42
4: 565
Right 915298573 1:154939089-154939111 CCTCGGTGACATCACGGTCATGG 0: 1
1: 0
2: 0
3: 7
4: 70
915298569_915298573 4 Left 915298569 1:154939062-154939084 CCTTTTCTACAGAGTTGCTGTCA 0: 1
1: 0
2: 1
3: 12
4: 245
Right 915298573 1:154939089-154939111 CCTCGGTGACATCACGGTCATGG 0: 1
1: 0
2: 0
3: 7
4: 70
915298568_915298573 11 Left 915298568 1:154939055-154939077 CCAGTCTCCTTTTCTACAGAGTT 0: 1
1: 0
2: 0
3: 27
4: 284
Right 915298573 1:154939089-154939111 CCTCGGTGACATCACGGTCATGG 0: 1
1: 0
2: 0
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915298573 Original CRISPR CCTCGGTGACATCACGGTCA TGG Intergenic
902453493 1:16514514-16514536 TGTCGGTGACATCACGGACAGGG - Intergenic
902473544 1:16667176-16667198 TGTCGGTGACATCACGGACAGGG - Intergenic
902485259 1:16740266-16740288 TGTCGGTGACATCACGGACAGGG + Intronic
902498989 1:16895730-16895752 TGTCGGTGACATCACGGACAGGG + Intronic
902567037 1:17318484-17318506 CCTCAGTGACATTTCGGTCTTGG - Intronic
903322883 1:22553217-22553239 CCTCTGTGGCCTCACGGGCAGGG - Intergenic
913653762 1:120942343-120942365 TGTCGGTGACATCACGGAGAGGG + Intergenic
914001694 1:143699862-143699884 TGTCGGTGACATCACGGATAGGG - Intergenic
914005606 1:143729818-143729840 TGTCGGTGACATCACGGATAGGG - Intergenic
914081094 1:144412319-144412341 TGTCGGTGACATCACGGATAGGG + Intergenic
914096947 1:144552157-144552179 TGTCGGTGACATCACGGATAGGG - Intergenic
914098072 1:144561064-144561086 TGTCGGTGACATCACGGATAGGG - Intergenic
914176011 1:145280853-145280875 TGTCGGTGACATCACGGATAGGG + Intergenic
914198764 1:145466007-145466029 TGTCGGTGACATCACGGATAGGG - Intergenic
914267750 1:146052482-146052504 TGTCGGTGACATCACGGATAGGG - Intergenic
914300910 1:146376551-146376573 TGTCGGTGACATCACGGATAGGG + Intergenic
914477873 1:148039143-148039165 TGTCGGTGACATCACGGATAGGG - Intergenic
914502892 1:148263228-148263250 TGTCGGTGACATCACGGATAGGG + Intergenic
914514542 1:148362768-148362790 TGTCGGTGACATCACGGATAGGG - Intergenic
914517802 1:148388867-148388889 TGTCGGTGACATCACGGATAGGG - Intergenic
914519455 1:148402473-148402495 TGTCGGTGACATCACGGAGAGGG + Intergenic
914530732 1:148522335-148522357 TGTCGGTGACATCACGGATAGGG + Intergenic
914643955 1:149636509-149636531 TGTCGGTGACATCACGGAGAGGG + Intergenic
915298573 1:154939089-154939111 CCTCGGTGACATCACGGTCATGG + Intergenic
916194461 1:162210505-162210527 GCTCGGTGATATGACAGTCATGG - Intronic
1065042019 10:21706929-21706951 CTTCAGTGACACCACAGTCATGG + Intronic
1065583210 10:27192411-27192433 CCACAGTGACATCACAGTGATGG - Intergenic
1076680883 10:132170542-132170564 CCTCGGTGACATCTGGGACTTGG + Intronic
1091091145 11:132772532-132772554 CCTCCAGGACATCACAGTCACGG + Intronic
1113616526 13:111684508-111684530 GCCCGGTGCCATCACTGTCATGG - Intergenic
1113622056 13:111769779-111769801 GCCCGGTGCCATCACTGTCATGG - Intergenic
1122419749 14:101567894-101567916 CCTGGCTGACATCTCGGTCTTGG + Intergenic
1127866794 15:63040108-63040130 CCTTGGTGACAAAAAGGTCATGG + Intergenic
1128553508 15:68614613-68614635 CCCCGGAGCCCTCACGGTCAAGG + Intronic
1129189074 15:73927179-73927201 CGTCGGGGACAGCACGGGCATGG + Exonic
1131225329 15:90620141-90620163 CATCGGTGACATCCTGGCCAGGG + Intronic
1141957584 16:87383225-87383247 CCGCGGTGACACCACGTTGAGGG - Intronic
1148699363 17:49578637-49578659 CCTCGTGGTCATCACGCTCAGGG - Exonic
1151725483 17:75881436-75881458 TCACGGTGACAGCACAGTCAGGG + Intronic
1152319349 17:79599486-79599508 CTGCGGTGGCTTCACGGTCACGG - Intergenic
1160720276 19:594209-594231 CCTCGGTGACACCGGGGGCAGGG - Intronic
1165872210 19:38980996-38981018 CCTCTGGGACTTCAGGGTCATGG + Intergenic
1202705735 1_KI270713v1_random:22252-22274 TGTCGGTGACATCACGGACAGGG - Intergenic
946121989 2:217524140-217524162 CCTCTTTGGCATCATGGTCATGG - Intronic
948715355 2:239857489-239857511 CCAGGGTGACATCACCTTCAGGG + Intergenic
1170790089 20:19500918-19500940 CCTCTGTGACATCATGACCAAGG + Intronic
1175004720 20:55670000-55670022 CCTCGGGGAGCTCGCGGTCACGG - Intergenic
1177920309 21:27143794-27143816 CCTCGGAGGCACCACGGTCCGGG - Intergenic
1179195744 21:39160851-39160873 CCTCTGTGCCATCAGGGCCAGGG + Intergenic
1180701087 22:17781755-17781777 CCATGGTGAAATCACGGCCATGG + Intergenic
1181307138 22:21923229-21923251 CCACGACAACATCACGGTCATGG - Exonic
1184330125 22:43821898-43821920 CCTCTGTGACATCCCTGACAAGG - Intergenic
957198943 3:77107217-77107239 CTTCAGTGACATCACCTTCAGGG + Intronic
961530300 3:127536438-127536460 CCTAGGTGACACCAAGGTCCAGG + Intergenic
963971775 3:151438059-151438081 CCCCAGTGACCTCACAGTCAAGG + Exonic
969220414 4:5755221-5755243 GCTCTGTGACATCAAGGACAGGG - Intronic
977785050 4:101023120-101023142 CCACGGTGACTTCACTCTCATGG - Intergenic
980962815 4:139493213-139493235 CTTCTGAGACATGACGGTCAAGG + Intergenic
985173509 4:187176810-187176832 CCTCGGTGCCAGCCGGGTCAGGG + Intergenic
985674495 5:1223985-1224007 CCTCGGTGGCATCACAGCCGGGG - Exonic
994490820 5:100441050-100441072 CCTCAGGAACATTACGGTCATGG - Intergenic
999132960 5:149298717-149298739 CATCAGTGACATCATGGTCTTGG + Intronic
1019409255 7:899509-899531 CCTCGGCGACCTGCCGGTCACGG - Intronic
1023032492 7:36102865-36102887 CCTGGGTGACATCACAGTCCTGG + Intergenic
1027049167 7:75010729-75010751 CCTCTGTGACTTCAGGGTAAGGG + Intronic
1027701548 7:81476194-81476216 TCTTGGTGCCAGCACGGTCAAGG + Intergenic
1029383852 7:100230914-100230936 CCTCTGTGACTTCAGGGTAAGGG - Intronic
1032236599 7:130129812-130129834 CACCTTTGACATCACGGTCAGGG - Intronic
1034425413 7:151011368-151011390 CCTTGGTGACACCAAGGCCAAGG - Intronic
1035221560 7:157409474-157409496 CCCCACTGAAATCACGGTCAGGG - Intronic
1035289593 7:157829417-157829439 CATCTGTGGCCTCACGGTCAGGG - Intronic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1038575573 8:28701353-28701375 CCGCGGTGACACCCGGGTCAGGG - Exonic
1056929130 9:90860173-90860195 CGTCTGTGACCTCAAGGTCATGG - Intronic
1062389237 9:136327483-136327505 CGGCGGTGACATCACGGCCACGG + Exonic
1189330179 X:40139992-40140014 CCCAGGTGACATCAAGTTCATGG - Intronic
1198016298 X:132614634-132614656 CGCCTGTGACATCAAGGTCAAGG + Intergenic
1198392615 X:136191436-136191458 CCTGAGTGACATCCAGGTCACGG + Intronic