ID: 915302942

View in Genome Browser
Species Human (GRCh38)
Location 1:154961884-154961906
Sequence TTACCACGGCACCACGCGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 18}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915302932_915302942 26 Left 915302932 1:154961835-154961857 CCGGACGAGACGCTACGCCTGAA 0: 1
1: 0
2: 0
3: 0
4: 11
Right 915302942 1:154961884-154961906 TTACCACGGCACCACGCGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 18
915302937_915302942 9 Left 915302937 1:154961852-154961874 CCTGAAAACAGGCGGCGGGCGAG 0: 1
1: 0
2: 1
3: 7
4: 54
Right 915302942 1:154961884-154961906 TTACCACGGCACCACGCGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915302942 Original CRISPR TTACCACGGCACCACGCGAG TGG Intronic
901243850 1:7712848-7712870 TTAACATGGCAGCAGGCGAGAGG + Intronic
915302942 1:154961884-154961906 TTACCACGGCACCACGCGAGTGG + Intronic
1082865268 11:57894439-57894461 TTACCATGGCACAGCGGGAGAGG + Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1091407657 12:219352-219374 ACAGCACGGCACCACGCGGGAGG + Intergenic
1102967722 12:117141099-117141121 TTACCAAGGTCCCCCGCGAGTGG + Intergenic
1116390751 14:44386162-44386184 TTCCCAAGGCACCACCCCAGTGG + Intergenic
1117191050 14:53292223-53292245 TGACCACAGCACCAAGAGAGTGG - Intergenic
1127822927 15:62676006-62676028 TCTCCACGGCCCCAGGCGAGAGG - Intronic
1132503122 16:293428-293450 TTACCACAGCACCACTCCTGGGG - Intronic
1135510611 16:23079958-23079980 TCACCATGGCACCATGCAAGGGG - Exonic
1143146999 17:4782901-4782923 ATTCCAGGGGACCACGCGAGGGG - Exonic
1152927431 17:83093748-83093770 CTTCCACGGCACCACACGACGGG - Intronic
1160039737 18:75334940-75334962 TTACCACAGCCCCAGGCCAGGGG + Intergenic
937456018 2:122042376-122042398 TTGCCAGGGCAACACTCGAGCGG + Intergenic
948562540 2:238864208-238864230 ATACCACGGCACAGCCCGAGAGG - Intronic
1173681505 20:44885602-44885624 TTGCCACGGCCCCACGGGAGGGG - Intergenic
1179570154 21:42273827-42273849 TGACCAAGGCACCAGGCGAGTGG - Intronic
986704089 5:10441250-10441272 TGACCAAGGCACCATGCAAGGGG - Intergenic
1035759330 8:2057762-2057784 TCACCACTGCACCACGGGCGTGG - Exonic
1061287992 9:129635164-129635186 TTACCAGGGCACCATGCAAGCGG - Intronic
1061733104 9:132631927-132631949 TTACCAGGGCAACACCCAAGAGG + Intronic