ID: 915302963

View in Genome Browser
Species Human (GRCh38)
Location 1:154961971-154961993
Sequence GCTGCCGGACCGTACCATCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 31}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915302954_915302963 15 Left 915302954 1:154961933-154961955 CCACACCAGCTCACCGAGGGGCG 0: 1
1: 0
2: 1
3: 9
4: 126
Right 915302963 1:154961971-154961993 GCTGCCGGACCGTACCATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 31
915302958_915302963 2 Left 915302958 1:154961946-154961968 CCGAGGGGCGGCAGCGCGCGGCC 0: 1
1: 0
2: 2
3: 19
4: 160
Right 915302963 1:154961971-154961993 GCTGCCGGACCGTACCATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 31
915302949_915302963 29 Left 915302949 1:154961919-154961941 CCGCTAGCGGCGGCCCACACCAG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 915302963 1:154961971-154961993 GCTGCCGGACCGTACCATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 31
915302956_915302963 10 Left 915302956 1:154961938-154961960 CCAGCTCACCGAGGGGCGGCAGC 0: 1
1: 0
2: 0
3: 20
4: 142
Right 915302963 1:154961971-154961993 GCTGCCGGACCGTACCATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 31
915302953_915302963 16 Left 915302953 1:154961932-154961954 CCCACACCAGCTCACCGAGGGGC 0: 1
1: 0
2: 0
3: 10
4: 140
Right 915302963 1:154961971-154961993 GCTGCCGGACCGTACCATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915302963 Original CRISPR GCTGCCGGACCGTACCATCC CGG Intronic
903816593 1:26068297-26068319 GCTGCCCGACCCTTCCATCTAGG - Intronic
905394370 1:37657678-37657700 GCTCCCGCACCCTGCCATCCCGG + Intergenic
915302963 1:154961971-154961993 GCTGCCGGACCGTACCATCCCGG + Intronic
1079009578 11:16817099-16817121 GCTGCCACACGGTGCCATCCCGG + Exonic
1093164138 12:15786447-15786469 GTTCCAGGACCCTACCATCCAGG - Intronic
1119568415 14:75648337-75648359 GTTGCCAGACCTTACCATCTGGG + Intronic
1124207303 15:27732471-27732493 GCTGGCAGCCCCTACCATCCTGG - Intergenic
1132604534 16:788258-788280 GCTGCCGGGCCGTGCAGTCCAGG + Intronic
1147833788 17:43315583-43315605 GCTCCCGGTCTGGACCATCCGGG - Intergenic
1149647485 17:58250614-58250636 GCTGCAGGGCCGTACCATGATGG - Exonic
1161808399 19:6458183-6458205 GTCGCCCGACCTTACCATCCTGG + Exonic
930396626 2:50829639-50829661 GATGCCGTCCCGTACCAACCTGG - Intronic
941367051 2:164621652-164621674 GCTCCCGCGCCGTCCCATCCGGG + Exonic
948180531 2:235976351-235976373 GCGGCCGGACTGTACCCTGCAGG - Intronic
1169081266 20:2798942-2798964 GCTGGCAGACCTTTCCATCCGGG - Intronic
1169381262 20:5109406-5109428 GATGCCGTCCCGTACCAACCTGG - Exonic
1173522332 20:43709434-43709456 GCTTCTGGACCAGACCATCCTGG + Intronic
1184823855 22:46933648-46933670 GCTGCCGGCCAGTGCCACCCTGG - Intronic
1185417974 22:50720432-50720454 GCTGCCGGCCTGTACGAGCCGGG + Intergenic
1007744414 6:44034652-44034674 GCTGCCGGTGCATGCCATCCTGG - Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1025993658 7:66514309-66514331 GCTGCTGGACTTTCCCATCCTGG - Intergenic
1026400056 7:70000968-70000990 GCTGCCAGGCAGAACCATCCTGG - Intronic
1032587191 7:133157638-133157660 ACTGCATGACCGTGCCATCCAGG - Intergenic
1035167564 7:157000518-157000540 GCTGCCGGGCGGAACCGTCCGGG - Intronic
1036252366 8:7173472-7173494 GGTGCCTGAATGTACCATCCGGG + Intergenic
1036365128 8:8113988-8114010 GGTGCCTGAATGTACCATCCGGG - Intergenic
1036520529 8:9487422-9487444 GCTGGCTGGCAGTACCATCCCGG - Intergenic
1036885799 8:12552109-12552131 GGTGCCTGAATGTACCATCCGGG + Intergenic
1061747266 9:132749611-132749633 GCTGCTGGACTCTAACATCCAGG + Intronic
1062128785 9:134881356-134881378 ACTGCAGGACCTTTCCATCCAGG + Intronic
1187509140 X:19901874-19901896 CCTGCCAGACAGTGCCATCCAGG - Intergenic