ID: 915303241

View in Genome Browser
Species Human (GRCh38)
Location 1:154963237-154963259
Sequence CTGAGCACCCTCTCCGGTTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915303241_915303247 13 Left 915303241 1:154963237-154963259 CCCAAACCGGAGAGGGTGCTCAG 0: 1
1: 0
2: 2
3: 10
4: 78
Right 915303247 1:154963273-154963295 CCCAGAAGCCAAGAAGGTGTTGG 0: 1
1: 2
2: 20
3: 170
4: 869
915303241_915303245 7 Left 915303241 1:154963237-154963259 CCCAAACCGGAGAGGGTGCTCAG 0: 1
1: 0
2: 2
3: 10
4: 78
Right 915303245 1:154963267-154963289 ACAGGTCCCAGAAGCCAAGAAGG 0: 1
1: 2
2: 1
3: 40
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915303241 Original CRISPR CTGAGCACCCTCTCCGGTTT GGG (reversed) Exonic