ID: 915304510

View in Genome Browser
Species Human (GRCh38)
Location 1:154969973-154969995
Sequence AGTGAGCATTAGAACTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915304505_915304510 -10 Left 915304505 1:154969960-154969982 CCGGCCAAGCTGGAGTGAGCATT 0: 1
1: 0
2: 0
3: 18
4: 140
Right 915304510 1:154969973-154969995 AGTGAGCATTAGAACTGGAGGGG 0: 1
1: 0
2: 0
3: 15
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915304510 Original CRISPR AGTGAGCATTAGAACTGGAG GGG Intronic
902451814 1:16501076-16501098 AGGCAGCATCAGAACTGGACTGG - Intergenic
903754050 1:25648238-25648260 ATTGAGCTTTAGAAAAGGAGTGG + Intronic
913159448 1:116132179-116132201 AGTGAGAATTAGAGCTGCTGTGG + Intronic
913211369 1:116585293-116585315 TGTGAGCATCAGAACTGATGAGG - Intronic
915304510 1:154969973-154969995 AGTGAGCATTAGAACTGGAGGGG + Intronic
915939550 1:160110073-160110095 GGGGATCATCAGAACTGGAGAGG + Intergenic
916125698 1:161569057-161569079 AGGGTGCATCAGAACTGGAGGGG - Intergenic
916135614 1:161650888-161650910 AGGGTGCATCAGAACTGGAGGGG - Intronic
916444074 1:164855906-164855928 AGTGAGCCTGTGGACTGGAGAGG - Intronic
916861116 1:168806520-168806542 AGTGAGCAGTAGCCCTGGTGAGG - Intergenic
917450227 1:175141813-175141835 AGTGAGAATGAGGACTGGAGGGG - Intronic
920062595 1:203237980-203238002 AGTGGGCAGTAGAACTAGAAGGG + Intronic
924618964 1:245643044-245643066 AGTAACCATAAGAGCTGGAGTGG - Intronic
1063122507 10:3114772-3114794 AGTGAGGATGGGAACTGCAGGGG + Intronic
1063887432 10:10593918-10593940 AGTGAGCATTACATATGGGGAGG + Intergenic
1067961207 10:50852528-50852550 AATAAGCATTAGAACAGGATGGG - Intronic
1070722819 10:78768382-78768404 CATGAGCATTACATCTGGAGAGG + Intergenic
1071435026 10:85640814-85640836 AGCAAGCATTAGACCAGGAGTGG + Intronic
1071501693 10:86208552-86208574 AGTGAGCATCAGGATTGAAGAGG - Intronic
1071709417 10:88034991-88035013 AGTGAGCATTAGAATAGTACAGG + Intergenic
1078663832 11:13308130-13308152 AGTGAGGATTAGATGCGGAGTGG + Intronic
1078886279 11:15503393-15503415 AGTGGAAATTAGAACTGGTGAGG - Intergenic
1079022366 11:16919726-16919748 TCTGAGTATTGGAACTGGAGGGG - Intronic
1079386535 11:19984933-19984955 ATAGAACATTAGAACTGGAAGGG - Intronic
1079412219 11:20200026-20200048 ATAGAACATTAGAACTGGAAGGG + Intergenic
1080144585 11:28966174-28966196 TGTGAACATTAGAAGTTGAGGGG + Intergenic
1082108154 11:48243076-48243098 AGTAAGCATTGGAGGTGGAGTGG + Intergenic
1086028294 11:82321575-82321597 GGAGAGCATTAGAACAGCAGAGG - Intergenic
1086324199 11:85682095-85682117 AGTGAGCATTAAACCAGGTGTGG + Intronic
1087913780 11:103783811-103783833 AGTGGGCAAGAGAACTGAAGAGG - Intergenic
1089502274 11:118939743-118939765 AGTGAGCAGAGGCACTGGAGTGG + Intronic
1091174192 11:133545233-133545255 AGTGGGCATTAGTAATGGTGGGG + Intergenic
1093163391 12:15776427-15776449 AGTGTGCATGTGAACTTGAGGGG - Intronic
1095614745 12:44175025-44175047 AGTGAGGAAAAGAGCTGGAGCGG + Intronic
1097120055 12:56724804-56724826 TGTGAGTATTAGGAGTGGAGGGG - Intronic
1097339421 12:58420136-58420158 ATAGAGCATTAGACCAGGAGTGG + Intergenic
1097465070 12:59912246-59912268 AGTGACCATTAGAATTTAAGTGG + Intergenic
1099827877 12:87801548-87801570 AGAGAGCATGTGAACTGGAGAGG - Intergenic
1101957506 12:109223937-109223959 AGTGAACACTAGAACTGGCATGG - Intronic
1104597728 12:130131559-130131581 AGTTAGCAAAAGAACAGGAGTGG + Intergenic
1105230340 13:18488911-18488933 TGTGAGCATAAGCTCTGGAGAGG + Intergenic
1106862699 13:33927743-33927765 GGTGAGCTATGGAACTGGAGAGG + Intronic
1107032304 13:35865800-35865822 AGTCAGCATTAGAACAAGAATGG - Intronic
1108354072 13:49614542-49614564 AGAGAACATTAAAAATGGAGTGG + Intergenic
1109310968 13:60692843-60692865 ACTGAGCAGGAGAACAGGAGAGG - Intergenic
1112225696 13:97537793-97537815 AGTTAGCAACAGAACAGGAGTGG + Intergenic
1114254273 14:20988558-20988580 CGTGAGCATTCTCACTGGAGGGG + Intergenic
1115067261 14:29279018-29279040 AGTGAGTCATAGAACTGAAGAGG + Intergenic
1115078168 14:29416290-29416312 AGTAAGCATGACAACTGAAGAGG + Intergenic
1116353726 14:43900489-43900511 ATTGAGCAATAGGACTGGAAAGG + Intergenic
1118597562 14:67447855-67447877 AGTGGCCATTAGAGCTGGGGAGG + Intronic
1119919126 14:78429926-78429948 AATGAGCATTAGAATTGAAAGGG + Intronic
1120134584 14:80851337-80851359 AGTGAGCAATGGAACTGAAGGGG + Intronic
1120249823 14:82049817-82049839 AATGAGAACTAGAACTAGAGAGG + Intergenic
1120733201 14:88025299-88025321 AGTGGGCTTTAGAACTGAAGGGG - Intergenic
1122770216 14:104094545-104094567 GGTGAGAATTGGGACTGGAGCGG - Intronic
1126387705 15:48110854-48110876 AGTGAGAACAAGAAGTGGAGGGG - Intergenic
1126705546 15:51401989-51402011 AGGGAGAAGTAGACCTGGAGTGG + Intronic
1127608566 15:60615119-60615141 AGAGAGCATTAGGACTTGGGTGG - Intronic
1129193017 15:73948345-73948367 AGTGTCCATTAGAGCAGGAGGGG - Intronic
1129678917 15:77647013-77647035 AGTGAGCAGTGGAACTGGGACGG + Intronic
1130430844 15:83845439-83845461 ATTGTGCAATAGAACTGGACTGG + Intronic
1134409074 16:13988317-13988339 AGTGATTATTAGAACTGGGAAGG + Intergenic
1138228377 16:55319327-55319349 GCTGAGCATTAGAACTGGCCGGG - Intergenic
1138773217 16:59689055-59689077 AGAGAGCATTAGAAATGCAAAGG - Intergenic
1138979452 16:62249428-62249450 TGTGAGGATTACAATTGGAGGGG + Intergenic
1143066701 17:4255108-4255130 AGTGTGGGTTAGAACTGGAGTGG - Intronic
1145906557 17:28519581-28519603 AGGGAGCACTGGAACTGGATGGG - Intronic
1148632233 17:49120036-49120058 AGTGAAAATTAGAACTCTAGGGG - Intergenic
1149373893 17:56024141-56024163 AGTGAGGTTTAGAACTGTGGGGG + Intergenic
1149539538 17:57458620-57458642 AGAGAGTATTAGAGCTGGAGAGG - Intronic
1151114025 17:71713298-71713320 AGAGAGCATCGGAGCTGGAGGGG - Intergenic
1151362451 17:73596756-73596778 AGGGAGGATGAGAGCTGGAGAGG - Intronic
1152179683 17:78811176-78811198 AGTGATCATTTGAAGTGGGGTGG - Intronic
1152497397 17:80683256-80683278 ACTGAGGATTAGAACTGAACTGG - Intronic
1154121990 18:11659494-11659516 AGTTAGCATCCCAACTGGAGAGG + Intergenic
1154523062 18:15250959-15250981 TGTGAGCATAAGCTCTGGAGAGG - Intergenic
1155792477 18:29991195-29991217 AGTGAGAATTAGAAACAGAGAGG - Intergenic
1156458001 18:37305531-37305553 AGTCAGCATTTCAACTGGAGGGG - Intronic
1157211498 18:45746484-45746506 AGTGAGCCTTAGAAGTGTAATGG + Intronic
1159925994 18:74269530-74269552 AGTGTGCATTAGCTATGGAGTGG - Intronic
1160139465 18:76308154-76308176 AGAGACCAGTAGAACTGCAGTGG - Intergenic
1160179968 18:76625519-76625541 AGTGTGTATGAGAACTGCAGGGG + Intergenic
1160316743 18:77855278-77855300 AGTGAGCTGTAAACCTGGAGCGG + Intergenic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1167044490 19:47041633-47041655 AGAAAGCTTTAGAGCTGGAGAGG + Intronic
925538770 2:4943939-4943961 GCTGAGCATAAGAAGTGGAGAGG + Intergenic
925752707 2:7104192-7104214 ATTGAGCATTAGAACAAAAGAGG + Intergenic
926309410 2:11664069-11664091 AGAGAGCCTTAGAACTGATGAGG - Intronic
928309908 2:30200937-30200959 CATGAGCAGTAGAACTGAAGGGG - Intergenic
932196139 2:69785744-69785766 AAGGAGCATAAGCACTGGAGTGG - Intronic
935916080 2:107951564-107951586 AATGAGTATTGAAACTGGAGGGG - Intergenic
938522356 2:132083802-132083824 TGTGAGCATAAGCTCTGGAGAGG - Intergenic
939258868 2:139781158-139781180 AATAAGCATTAAAACTGTAGAGG + Intergenic
939621681 2:144427708-144427730 AGTAATCATTAGAACTAGACAGG + Intronic
940224927 2:151390922-151390944 AGGGAGGATTTGAAGTGGAGAGG + Intergenic
942581101 2:177417695-177417717 AATGAGCAATTGAACTGGATGGG + Intronic
943113686 2:183639561-183639583 CCTGAACATTAGAACTGCAGAGG + Intergenic
946015005 2:216596938-216596960 AGTGAGCAGTAGAACTGCATTGG + Intergenic
946922230 2:224591827-224591849 GGTGAACTTTAGATCTGGAGAGG + Intergenic
947987912 2:234464785-234464807 AGAGGGCAGCAGAACTGGAGAGG - Intergenic
948447134 2:238041412-238041434 AGGGAGCATGAGGACGGGAGAGG - Exonic
1169994335 20:11540259-11540281 AATGTGCATTAGAAAAGGAGAGG + Intergenic
1171355890 20:24545152-24545174 AGGGAGGATTAGAAATGGAGAGG + Intronic
1176774327 21:13117256-13117278 TGTGAGCATAAGCTCTGGAGAGG + Intergenic
1177872565 21:26591130-26591152 AGGGAGAATTAGGAGTGGAGAGG - Intergenic
1179949479 21:44701742-44701764 AGTGAGCTTTACAGCCGGAGGGG - Intronic
1180521951 22:16216970-16216992 TGTGAGCATAAGCTCTGGAGAGG + Intergenic
1181296776 22:21846635-21846657 AGTGATAATTAGAACTAAAGTGG - Intronic
1181991385 22:26839525-26839547 AGGGAGCCTTGGAACTGGAATGG - Intergenic
1183338321 22:37263827-37263849 AGGGAGCATTTTCACTGGAGTGG - Intergenic
1185388062 22:50545590-50545612 AGTGAGCATTATCATTGCAGGGG - Intergenic
959434715 3:106300267-106300289 AGAGGGCATTAGAAATTGAGAGG + Intergenic
961401744 3:126651708-126651730 AGTGAGCATACGAACTAGTGTGG + Intronic
962387861 3:134947321-134947343 AGTGGTAATTAGAACTGGGGGGG - Intronic
964887172 3:161497667-161497689 AGTTAGGATTAGAAATGGAATGG + Intronic
966647870 3:182267372-182267394 AGTGAGAATTATGACTTGAGAGG + Intergenic
968190818 3:196665907-196665929 AGTGGGAAGTAGATCTGGAGGGG - Intronic
968260948 3:197323752-197323774 AGTGAGAATTAGAACTCTTGCGG + Intergenic
969492630 4:7508897-7508919 AGTGAGCAGAAGTTCTGGAGGGG + Intronic
969712732 4:8853424-8853446 AGTGAGCATGAGATGTGCAGCGG - Intronic
970300840 4:14679976-14679998 AGGGGGCATGAGATCTGGAGTGG + Intergenic
984315711 4:178128854-178128876 AGAGACCAATGGAACTGGAGAGG + Intergenic
985960415 5:3298707-3298729 AGTGAGCAGTTGAAATGGTGTGG + Intergenic
987378554 5:17261308-17261330 AGTGACCACTAAACCTGGAGAGG - Intronic
987943606 5:24574572-24574594 AGTTGGCATCAGATCTGGAGTGG - Intronic
990345815 5:54870250-54870272 AGTGGCCGTTAGAACTGGTGTGG - Intergenic
996903045 5:128565813-128565835 TGGCAGCAGTAGAACTGGAGAGG - Intronic
1000811650 5:165870287-165870309 AGTTGGCATTTGAACTTGAGCGG + Intergenic
1004397271 6:15256399-15256421 ATTGAGAATTAAGACTGGAGTGG + Intronic
1006929752 6:37680649-37680671 AGTAAGCATGAGCACTGGATCGG + Intronic
1007217280 6:40250158-40250180 CTTGAGCATTAGAGCTGGAGAGG - Intergenic
1007445910 6:41905832-41905854 AGGGTGCATGAGAACTGGAGAGG + Exonic
1009880214 6:69557542-69557564 AGTGACCTTTAGAATTAGAGAGG - Intergenic
1009895477 6:69744713-69744735 GGTGAGCATTGGAACTACAGTGG - Intronic
1010987293 6:82439528-82439550 CGGGAGGATGAGAACTGGAGCGG + Intergenic
1011629519 6:89310716-89310738 AGTGAGCATTAGATGAGAAGCGG + Intronic
1024497758 7:50067874-50067896 AGTTAGAGTTAGAACTGGTGTGG + Intronic
1028908690 7:96183433-96183455 AGAGAGCATTAGTAGGGGAGAGG + Intronic
1029839252 7:103344687-103344709 AGTGAGAGGTAGAGCTGGAGGGG - Exonic
1030223872 7:107127264-107127286 AGTGAGCATTGGAATAGGAAAGG + Intronic
1031670423 7:124536238-124536260 AGGAAGCATTACTACTGGAGGGG + Intergenic
1037402499 8:18507055-18507077 AGTGGTCATTAGAACTAGGGAGG - Intergenic
1040417197 8:47206022-47206044 AGTGAGCCTCAGAAAGGGAGGGG - Intergenic
1042452424 8:68963441-68963463 AGAGAATATTAGAGCTGGAGTGG - Intergenic
1043358451 8:79441335-79441357 AGTGAACAGTAGTTCTGGAGGGG - Intergenic
1043700964 8:83289350-83289372 AATGAACATTAGAACTGAATAGG - Intergenic
1047283511 8:123466138-123466160 TCTGAGAATTACAACTGGAGAGG + Intronic
1048468552 8:134687134-134687156 ACTGAGCATCAGAGCTGGAAGGG - Intronic
1049364143 8:142228508-142228530 AGTGTGCATTCGGACCGGAGAGG - Intronic
1053423226 9:37994178-37994200 AGTGACCATGAGATCTGGAATGG + Intronic
1053701051 9:40690939-40690961 TGTGAGCATAAGCTCTGGAGAGG - Intergenic
1054312344 9:63490337-63490359 TGTGAGCATAAGCTCTGGAGAGG - Intergenic
1054411115 9:64814393-64814415 TGTGAGCATAAGCTCTGGAGAGG - Intergenic
1055476389 9:76667383-76667405 AGTGAGCAGCAGAACTGGCTGGG + Intronic
1058719807 9:107753290-107753312 AGGGAGCATAATAACTGGAAAGG - Intergenic
1059040346 9:110807950-110807972 AGTGTGTATTTGCACTGGAGAGG - Intergenic
1060766272 9:126296807-126296829 AGAGAGGCTTAGAACTGGAGTGG - Intergenic
1186049417 X:5574413-5574435 AATGAGCATCTGAACTAGAGTGG - Intergenic
1189611158 X:42737494-42737516 TCTGATAATTAGAACTGGAGTGG - Intergenic
1189748716 X:44196520-44196542 AGTGAGAAGAAGAACTGAAGGGG + Intronic
1190765665 X:53473637-53473659 AGTCAGGGTTGGAACTGGAGAGG + Intergenic
1191714524 X:64185216-64185238 AGTGAGAGCTAGAAGTGGAGAGG + Exonic
1193872487 X:86817536-86817558 GGTCAGCTTTGGAACTGGAGAGG + Intronic
1194579072 X:95649006-95649028 AGTGAACACTAAATCTGGAGGGG + Intergenic
1194666035 X:96678581-96678603 TGTGAGGATTGGAACTGGAGTGG - Intergenic
1194764480 X:97833596-97833618 AGTGAACTTGAGAACAGGAGGGG - Intergenic
1199255407 X:145713703-145713725 AGTGAGCAGGAGGGCTGGAGAGG + Intergenic
1199474665 X:148232052-148232074 AGAGTGGATAAGAACTGGAGAGG + Intergenic
1199819292 X:151428778-151428800 AGGGATGACTAGAACTGGAGTGG - Intergenic