ID: 915305380

View in Genome Browser
Species Human (GRCh38)
Location 1:154974259-154974281
Sequence GGAGTCTCCGCACCGCACCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915305374_915305380 15 Left 915305374 1:154974221-154974243 CCTAAGGAGAAAAAAGTCAAGAC 0: 1
1: 0
2: 6
3: 55
4: 470
Right 915305380 1:154974259-154974281 GGAGTCTCCGCACCGCACCGCGG 0: 1
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915305380 Original CRISPR GGAGTCTCCGCACCGCACCG CGG Intronic