ID: 915305464

View in Genome Browser
Species Human (GRCh38)
Location 1:154974697-154974719
Sequence TGCTTGGAGGTTGGCGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 3, 2: 0, 3: 12, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915305456_915305464 10 Left 915305456 1:154974664-154974686 CCAAAGTGGGTGGGAGCGCGTGC 0: 1
1: 1
2: 0
3: 4
4: 69
Right 915305464 1:154974697-154974719 TGCTTGGAGGTTGGCGGCGCGGG 0: 1
1: 3
2: 0
3: 12
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915305464 Original CRISPR TGCTTGGAGGTTGGCGGCGC GGG Exonic