ID: 915307390

View in Genome Browser
Species Human (GRCh38)
Location 1:154988462-154988484
Sequence ACGTTTCGGACGGAGACCAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 26}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915307390_915307401 21 Left 915307390 1:154988462-154988484 CCTCTGGTCTCCGTCCGAAACGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 915307401 1:154988506-154988528 AGAGCTGCTGCGGCGGGTGCTGG 0: 1
1: 0
2: 2
3: 79
4: 387
915307390_915307404 26 Left 915307390 1:154988462-154988484 CCTCTGGTCTCCGTCCGAAACGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 915307404 1:154988511-154988533 TGCTGCGGCGGGTGCTGGAGGGG 0: 1
1: 0
2: 2
3: 44
4: 415
915307390_915307403 25 Left 915307390 1:154988462-154988484 CCTCTGGTCTCCGTCCGAAACGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 915307403 1:154988510-154988532 CTGCTGCGGCGGGTGCTGGAGGG 0: 1
1: 1
2: 3
3: 34
4: 322
915307390_915307402 24 Left 915307390 1:154988462-154988484 CCTCTGGTCTCCGTCCGAAACGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 915307402 1:154988509-154988531 GCTGCTGCGGCGGGTGCTGGAGG 0: 1
1: 0
2: 9
3: 139
4: 952
915307390_915307397 11 Left 915307390 1:154988462-154988484 CCTCTGGTCTCCGTCCGAAACGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 915307397 1:154988496-154988518 CAGGCATTCCAGAGCTGCTGCGG 0: 1
1: 0
2: 3
3: 46
4: 529
915307390_915307393 -8 Left 915307390 1:154988462-154988484 CCTCTGGTCTCCGTCCGAAACGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 915307393 1:154988477-154988499 CGAAACGTCTACCTCTTCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 57
915307390_915307398 14 Left 915307390 1:154988462-154988484 CCTCTGGTCTCCGTCCGAAACGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 915307398 1:154988499-154988521 GCATTCCAGAGCTGCTGCGGCGG 0: 1
1: 0
2: 1
3: 23
4: 153
915307390_915307399 15 Left 915307390 1:154988462-154988484 CCTCTGGTCTCCGTCCGAAACGT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 915307399 1:154988500-154988522 CATTCCAGAGCTGCTGCGGCGGG 0: 1
1: 0
2: 4
3: 17
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915307390 Original CRISPR ACGTTTCGGACGGAGACCAG AGG (reversed) Exonic
901420084 1:9144982-9145004 GAGTTTCTGACGGGGACCAGAGG + Intergenic
915307390 1:154988462-154988484 ACGTTTCGGACGGAGACCAGAGG - Exonic
1076441357 10:130483450-130483472 ACATTGGGGAGGGAGACCAGGGG + Intergenic
1084531291 11:69729398-69729420 AAGTCTCAGAGGGAGACCAGCGG - Intergenic
1085228626 11:74945713-74945735 AAGTTTGAGATGGAGACCAGAGG - Intronic
1097904554 12:64906319-64906341 AGGTTTTGGAGGGAGACCAGTGG + Intergenic
1101842555 12:108339031-108339053 ACCTTCCGGGCAGAGACCAGAGG - Exonic
1110719480 13:78745479-78745501 AGGTTTCTGACTGAGAACAGTGG + Intergenic
1110823331 13:79942099-79942121 AGGGTTCAGACGGAGCCCAGGGG + Intergenic
1119555422 14:75548746-75548768 ACGTTTCGTTGGGAGACCAAAGG - Intergenic
1131228206 15:90642508-90642530 TCGGTGCGGACGGAGATCAGTGG - Exonic
1155426353 18:25711620-25711642 ACATTTGGGAAGGAGAGCAGAGG - Intergenic
925317005 2:2934250-2934272 AAGGCTCTGACGGAGACCAGGGG - Intergenic
948537343 2:238655973-238655995 ACTTTGGGGACGGAAACCAGTGG - Intergenic
1184367787 22:44063571-44063593 ACGCTGAGGACGGAGACCACAGG - Intronic
958212838 3:90512207-90512229 ACGTTTCAAACGAAGACCACAGG + Intergenic
960956975 3:123039465-123039487 AAGTTTGGGATGGAGACCAAAGG + Intergenic
985947636 5:3199499-3199521 ACGTTTCGGACACAGACCCTTGG - Intergenic
987973495 5:24980895-24980917 AGGTTTTGGGCTGAGACCAGGGG - Intergenic
1002334684 5:178469645-178469667 ACATTTCTGATGGAGCCCAGGGG + Intronic
1006151586 6:31992884-31992906 CCTTTTCTGATGGAGACCAGTGG + Exonic
1006157887 6:32025622-32025644 CCTTTTCTGATGGAGACCAGTGG + Exonic
1034917777 7:155055379-155055401 ACACTTTGGGCGGAGACCAGTGG - Intergenic
1038147983 8:24915354-24915376 ACATCACGCACGGAGACCAGTGG - Intronic
1041876506 8:62693707-62693729 AAGGTTGGGATGGAGACCAGGGG - Intronic
1050294176 9:4187887-4187909 ACATTTTGGGCGGAGACCATGGG + Intronic
1188730843 X:33644640-33644662 ATGTCTGGGACTGAGACCAGTGG + Intergenic
1193786082 X:85760907-85760929 TCCTTTGGGAGGGAGACCAGAGG - Intergenic