ID: 915310726

View in Genome Browser
Species Human (GRCh38)
Location 1:155004693-155004715
Sequence CTGGAGCAGCTGATGAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915310713_915310726 18 Left 915310713 1:155004652-155004674 CCTCCTTAGTGGTAACTGGGGAG 0: 1
1: 0
2: 0
3: 4
4: 99
Right 915310726 1:155004693-155004715 CTGGAGCAGCTGATGAAACAAGG 0: 1
1: 0
2: 0
3: 24
4: 306
915310714_915310726 15 Left 915310714 1:155004655-155004677 CCTTAGTGGTAACTGGGGAGAAG 0: 1
1: 0
2: 2
3: 15
4: 114
Right 915310726 1:155004693-155004715 CTGGAGCAGCTGATGAAACAAGG 0: 1
1: 0
2: 0
3: 24
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915310726 Original CRISPR CTGGAGCAGCTGATGAAACA AGG Intronic
901098811 1:6703347-6703369 CTGGAAGAGCTGATGGACCATGG - Intergenic
905273973 1:36805335-36805357 CTGGATCAGCTCATGAAAGGGGG + Intronic
905369548 1:37475740-37475762 CTGGGTGAGCTGGTGAAACACGG + Exonic
905484968 1:38289202-38289224 CTGGAGTAGCTGAGGCTACAGGG - Intergenic
905532815 1:38695548-38695570 CTGAAGCTGATGATAAAACATGG - Intergenic
906323289 1:44829525-44829547 CTGGGCCAGCTGGAGAAACAGGG + Exonic
908072738 1:60481280-60481302 CTGTAACAGAAGATGAAACATGG - Intergenic
908311021 1:62883875-62883897 CTGTAAGAGTTGATGAAACAGGG + Intergenic
909548662 1:76875142-76875164 CTTGAGCAGCTGCAGAAACGAGG - Intronic
910458929 1:87427253-87427275 CTGGAGAAGCAAATGCAACAAGG - Intergenic
911550764 1:99277218-99277240 CTGTAACAAGTGATGAAACATGG - Intronic
912223230 1:107701377-107701399 CTGGAGCAGCTGGGAACACAGGG + Intronic
912281043 1:108314124-108314146 CTTGAGCAGTTGGTGAAAGAAGG + Intergenic
912577812 1:110691035-110691057 CTGTAACAGGAGATGAAACATGG + Intergenic
914316211 1:146514152-146514174 CTGGAGAAGCAAATGCAACAAGG - Intergenic
914498144 1:148219209-148219231 CTGGAGAAGCAAATGCAACAAGG + Intergenic
915310726 1:155004693-155004715 CTGGAGCAGCTGATGAAACAAGG + Intronic
915353595 1:155241872-155241894 CTGCATCTGATGATGAAACAAGG - Intronic
915994153 1:160547206-160547228 ATGGTGCAGATGATGAAACTGGG - Intronic
917649182 1:177059806-177059828 CTAGAGCAACAGATGAAATAAGG + Intronic
917660629 1:177173709-177173731 CAGGAGAAGGTGATGACACAGGG - Intronic
917802778 1:178585372-178585394 CTGCAGCAGCTGATGAAGCTTGG - Intergenic
919880217 1:201896039-201896061 CTGGAGCAGCTGGAGAATCTGGG + Intergenic
921394736 1:214656433-214656455 ATGGAGGATCTGATGAAAAAGGG - Intronic
922841971 1:228650169-228650191 CTGCAGCCGCTGATGGAACTAGG - Intergenic
923125925 1:231034437-231034459 CTGGAGAAGCACATGAATCAAGG - Intronic
924780550 1:247143575-247143597 CTAGAGAAGCTGGTGGAACAGGG - Intronic
1063577906 10:7278519-7278541 CTGGAGCTCCTGATGGGACAGGG + Intronic
1063836692 10:10022615-10022637 CTGGAGCATCTGATGGAAAAGGG - Intergenic
1066609320 10:37222259-37222281 CTGGGGAAGGTGAAGAAACATGG - Intronic
1067227827 10:44386786-44386808 CCTGCGCAGCTGATGAAACCCGG + Intergenic
1068562637 10:58532868-58532890 TTGTAACAGCAGATGAAACATGG + Intronic
1068764517 10:60748260-60748282 CTGGAGGGCCTGCTGAAACATGG - Intergenic
1068866335 10:61899060-61899082 CTTGAAGAGCTGAAGAAACAGGG + Intergenic
1072265506 10:93722960-93722982 CTGGAACTGCTGGTCAAACATGG - Intergenic
1073424480 10:103448004-103448026 CAGGAGCAAGTGGTGAAACAAGG - Intronic
1073509884 10:104036311-104036333 CTGGAGCAGGTCAAGAAGCATGG - Intronic
1073695159 10:105858391-105858413 CTGCAGCACCTGATTAAACCAGG + Intergenic
1074180395 10:111057772-111057794 TTGGAACAGGAGATGAAACATGG + Intergenic
1074243923 10:111668939-111668961 CATGACCAGCTGAAGAAACAAGG - Intergenic
1074284615 10:112086397-112086419 CTGGAGAAGCTGAGGCAAGAAGG + Intergenic
1075518530 10:123129374-123129396 CTGGAGGAGGTGATCAACCAGGG - Intergenic
1075650138 10:124122386-124122408 CTGCCGCAGCTGATGGACCAGGG - Intergenic
1075744189 10:124715212-124715234 CTGGAACTGATGTTGAAACATGG + Intronic
1076438546 10:130463205-130463227 CTGGAGCAGCTGACAGAAGAGGG + Intergenic
1079636340 11:22746221-22746243 CTGGTGAAGCTGCTGAGACAAGG + Intronic
1080724291 11:34880044-34880066 CTAGAACTGCTGATGAGACATGG + Intronic
1081724809 11:45320869-45320891 CTGGAGAAGCTGAGGCAGCATGG + Intergenic
1083117563 11:60477237-60477259 CTGCAGAAGCTGATGAAAAATGG + Intergenic
1083497661 11:63072306-63072328 TTGTAGCAGGAGATGAAACATGG - Intergenic
1083942350 11:65903190-65903212 CTGGGGCAGCTGAGGGAGCAGGG + Intergenic
1085034488 11:73291940-73291962 TTGGAGCAGCTGAGGCAGCAAGG - Intronic
1085543986 11:77300096-77300118 ATGGAGCAGGTGATCAAAAAAGG - Intronic
1089206022 11:116763330-116763352 CTGGAGCATCTTTTGAAACTGGG - Intronic
1091338690 11:134793881-134793903 CTGTAGCAGCTGATGGGAAAGGG - Intergenic
1091853066 12:3716305-3716327 CTGTAACAGGGGATGAAACAGGG - Intronic
1092314534 12:7396402-7396424 TTGGTGCAGGTGATGCAACATGG - Exonic
1092728193 12:11504803-11504825 GTGGAGCAGCTGATGTCTCAAGG - Intergenic
1092902560 12:13073567-13073589 CTGTAGCAGGAGATGAAACATGG - Intronic
1092920637 12:13228700-13228722 CTGCAGCAGCTCAGGACACAAGG + Intergenic
1092932198 12:13326602-13326624 CTGCAGAAGTTGAAGAAACAAGG + Intergenic
1093078858 12:14786796-14786818 CTGGAGGAGGGGAAGAAACAGGG + Exonic
1093356316 12:18172789-18172811 GTGGAGCAGGTGATCAAAAAAGG - Intronic
1094606847 12:31956640-31956662 GTGGAGCAGGTGATGGAAAAAGG + Intergenic
1094743343 12:33314708-33314730 CTGGAGCAGCTGGGAACACAGGG + Intergenic
1095539768 12:43295813-43295835 CTGAAGGAGCTGAAGAAACATGG + Intergenic
1096194656 12:49642221-49642243 CTCCAGCAGCTGAGGAAAGAAGG - Exonic
1096216734 12:49801872-49801894 CTGGAGTTTCTGCTGAAACAGGG + Exonic
1096538223 12:52288699-52288721 CTGGAGCAGGAGATGAGAGAAGG - Intronic
1097275206 12:57808456-57808478 CTGGAACAGCTGCTTGAACATGG + Exonic
1099615612 12:84931467-84931489 TTGTAGCAGCAGATAAAACATGG + Intergenic
1100715550 12:97301807-97301829 GTGTGGCAGCTGTTGAAACAGGG - Intergenic
1101203630 12:102463120-102463142 GTGTGGCAGCTGATGAAACCAGG + Intronic
1102796601 12:115694410-115694432 CTGGAACAGCTTTTGACACATGG - Intergenic
1102962691 12:117102828-117102850 CTGGAGGAGCTGATTAAAAGTGG + Intergenic
1103461679 12:121109784-121109806 CCGGTGCAGCTGCTGAGACAGGG + Intergenic
1104762909 12:131308185-131308207 GTGTAGCAGCTGATGCAAAATGG - Intergenic
1104817015 12:131653188-131653210 GTGTAGCAGCTGATGCAAAATGG + Intergenic
1104910338 12:132237216-132237238 CTGGGGCAGCTGAGGGTACACGG - Intronic
1104927485 12:132321282-132321304 CCGGAGCAGCTGGTGTACCATGG - Intronic
1106554966 13:30801693-30801715 CGGGAGCAGATTATGAAACAAGG - Intergenic
1108808118 13:54185354-54185376 CTGGAGCAGCAGACAAAACTGGG + Intergenic
1108897611 13:55353404-55353426 TTGTAACAGCAGATGAAACATGG + Intergenic
1109319907 13:60797839-60797861 TTGTAGCAGCTGAAGAAATATGG + Intergenic
1112230846 13:97588147-97588169 CTTGACCAGCTGCAGAAACAAGG - Intergenic
1113044208 13:106137134-106137156 CTGTAACAGAAGATGAAACATGG - Intergenic
1113454502 13:110438533-110438555 CTGGAGCAGAGGATGACACGTGG + Intronic
1113487838 13:110668036-110668058 CTGGACCAGCTGCAGAAGCATGG + Intronic
1114353097 14:21876159-21876181 TTGGAACAGGAGATGAAACATGG + Intergenic
1116164852 14:41322595-41322617 CTGGAGCGGCTTATAGAACAGGG - Intergenic
1117699556 14:58399314-58399336 CTGGAGCATCTGTTAAAATATGG + Intronic
1118945706 14:70385156-70385178 CTGGAGCTGCTGATAAATGATGG - Intronic
1119966130 14:78917603-78917625 CTTGAGCTGCTGATGAAAGAAGG + Intronic
1120749594 14:88185848-88185870 CCGGAGCAGCTGAACAAGCATGG - Exonic
1120979599 14:90278513-90278535 CTGGAGGAGCTCAGGAAGCAAGG + Intronic
1123115973 14:105894222-105894244 CTGGGGCAGCTGTTGGGACAGGG + Intergenic
1124000682 15:25757806-25757828 GTGGAGCAGGTGATCAAAAAAGG - Intronic
1124877138 15:33605566-33605588 CTCCAGCATCTGATGAGACATGG + Intronic
1125766519 15:42140210-42140232 CTAGAGCAGCAGTTGATACATGG - Exonic
1125832842 15:42728742-42728764 CAAGAGCAGCTGGTGACACAGGG - Exonic
1126221050 15:46213708-46213730 CAGGAGCAGATGAGGAAATAAGG - Intergenic
1127332745 15:57954897-57954919 CTGGAGCACAGGATGAAATAAGG - Exonic
1129672490 15:77614971-77614993 CCGGAGCAGCTCATGCAACATGG + Exonic
1130437449 15:83915229-83915251 CAGGAGAAGAAGATGAAACAGGG - Intronic
1130906497 15:88244227-88244249 CTGGAGCAGCATCTGGAACATGG - Intronic
1131618818 15:94045371-94045393 CTGTAGCAGGAGATGGAACATGG - Intergenic
1132121731 15:99181739-99181761 CTGGGGCAGCTGGTGAACCTTGG + Intronic
1138208503 16:55143181-55143203 CTGGAGCAACTGAGGAGACACGG - Intergenic
1140809453 16:78563346-78563368 CTGGAGCAGCTGCAGATTCAGGG + Intronic
1141100350 16:81193179-81193201 CTGGACCAGCTGCTGAGACCAGG - Intergenic
1141112593 16:81282423-81282445 ATGGGGCAGCTGATGGAACAAGG - Intronic
1141733439 16:85837163-85837185 CTTGAGAAGCTGTTGCAACACGG + Intergenic
1142203740 16:88773105-88773127 CTGGAGCCGCTGGTGACAGATGG - Intronic
1142666902 17:1468488-1468510 CTGCTGCAGCTGAGGAGACAAGG + Exonic
1143046700 17:4086604-4086626 CTGGAGTAGCTGCAGAAGCAGGG + Exonic
1143063546 17:4223767-4223789 CTGTACCAGCTGCTGAAACTTGG - Intronic
1143617958 17:8064676-8064698 CTGAAGCAGGTGCTGAAGCAGGG + Intergenic
1144226054 17:13147977-13147999 CTGGAGGAGCTGTTGAAAATAGG + Intergenic
1144747577 17:17626126-17626148 CTGGCGCAGATGAGGAAACAGGG + Intergenic
1144838459 17:18171026-18171048 CTGGAGCTGCAGATGAAGGAAGG - Intronic
1146210759 17:30941022-30941044 CTGTAACAGGAGATGAAACATGG - Intronic
1146641915 17:34548034-34548056 CTGTAGCAGCTAAAGAGACAAGG - Intergenic
1146968353 17:37052256-37052278 CTGGAGAATCTGATGGAACAAGG + Intronic
1147031182 17:37638032-37638054 CTGTAACAGAAGATGAAACATGG + Intronic
1147727728 17:42577265-42577287 CTGGAGCAGCTGGCGCAACAAGG - Exonic
1148861451 17:50606392-50606414 CTGGAGCAGCTGACTTACCAGGG + Intronic
1150987700 17:70217125-70217147 ATGTATTAGCTGATGAAACACGG - Intergenic
1151561434 17:74871993-74872015 CTGGAGCAGCAGGTGAATGATGG + Intronic
1151980070 17:77503371-77503393 CTGGAGCAGGAGAGGAAGCAGGG - Intergenic
1152756526 17:82089344-82089366 GTGGAGCAGCTGAGGAAGGAGGG - Exonic
1155401088 18:25440419-25440441 GTGGGGCAGTTGATGAAACATGG - Intergenic
1155854790 18:30819730-30819752 TTGTAGCAGGAGATGAAACATGG + Intergenic
1156812077 18:41264751-41264773 CTGTAGCTGCTGCTGAAGCAGGG + Intergenic
1156882917 18:42102320-42102342 CTGGAGCAGCAGCTGAAGGAAGG - Intergenic
1157725320 18:49959485-49959507 CTGGGCCAGGTGAGGAAACAGGG + Intronic
1157758409 18:50240048-50240070 GTGGAGCAGTTGATCAAAAAAGG - Intronic
1158896765 18:61921537-61921559 CTGGTACAGATGAGGAAACAGGG + Intergenic
1160175685 18:76592274-76592296 CTGGCCCAGCTGAGGAAACAGGG - Intergenic
1160229436 18:77035150-77035172 CTGGAGAAGCAGAGGAAACCTGG - Intronic
1160512622 18:79461070-79461092 CTGGAGAAGCTGAGGACACGCGG - Intronic
1160908822 19:1465516-1465538 CTGGAGCACCTGGAGAAGCAGGG + Exonic
1161308126 19:3578408-3578430 TTGGAGCAGCTGATGGGCCATGG + Intronic
1162578571 19:11513803-11513825 CTGGAGCAGATGGAGAACCACGG - Exonic
1162804988 19:13133067-13133089 GTGGAGTTGCTAATGAAACATGG + Intronic
1162966926 19:14160501-14160523 GTGGAGCAGCTGGGGAGACATGG - Intronic
1163433664 19:17282714-17282736 CTGGAGCTGCTGCTGAGCCAAGG + Exonic
1164194744 19:22946319-22946341 CTAGAGGAGCTGATGATACATGG - Intergenic
1164511882 19:28904186-28904208 CAGGAGCAGATGCTGAAACAAGG - Intergenic
1166206683 19:41274458-41274480 CTTGAGCAGCTGATGGAAACGGG - Intronic
1166922295 19:46237540-46237562 CTAGGCCAGCTGCTGAAACAAGG - Intergenic
1167170140 19:47825438-47825460 CTGAGGCAGCTGATGACAGAAGG - Intronic
1167906584 19:52665602-52665624 GTGGAGCAGGTGATTAAAAAAGG - Intronic
1168543031 19:57228814-57228836 ATGGAGCATCTGAGGTAACAGGG - Intergenic
925414663 2:3660892-3660914 GTGGAGCAGGTGATCAAAAAAGG + Intronic
926199810 2:10786415-10786437 CTGAAGCAGCTGATCTCACAGGG + Intronic
926410791 2:12600451-12600473 CTGTAACAGGAGATGAAACATGG + Intergenic
927307055 2:21585675-21585697 TTTGAGCAGCTCATGAAAAAAGG + Intergenic
927803554 2:26123786-26123808 CTGAAGCAAATGATGAAAGAAGG + Intronic
927811797 2:26184575-26184597 CTGGAGCTGCAGATGCAAGAGGG + Exonic
928728066 2:34198565-34198587 CTGTAACAGGAGATGAAACATGG + Intergenic
931164135 2:59727650-59727672 CTGGAAGAGCTGAGGAAACTTGG - Intergenic
931638243 2:64359836-64359858 CTGGAGAAAGGGATGAAACAGGG - Intergenic
931788031 2:65639252-65639274 CTGGGGCAGCTGGTGGAGCAGGG - Intergenic
931914027 2:66933462-66933484 CTGTGGCAGCTGATGGAAGAGGG - Intergenic
932281636 2:70498155-70498177 CTGGAGCAGCTCATAAAAGCTGG + Intronic
932716602 2:74104804-74104826 CTGCAGAAACTGATGAACCAAGG - Exonic
932774946 2:74522766-74522788 CTGGAGCTGGTGAGGAAACAGGG + Exonic
933409778 2:81910420-81910442 CAGGAGCAGATGAGGAGACAAGG - Intergenic
933913320 2:86963386-86963408 CTGGTGAGGCTGGTGAAACAGGG + Intronic
934009675 2:87806512-87806534 CTGGTGAGGCTGGTGAAACAGGG - Intronic
934082567 2:88481833-88481855 CTGGCCCAGCTGATGACAGATGG - Intergenic
934957304 2:98633172-98633194 CAAGAGCAGCTGATGAATCTGGG - Intronic
935773255 2:106447230-106447252 CTGGTGAGGCTGGTGAAACAGGG - Intronic
935858661 2:107303111-107303133 CTGGAATTGCTGATGAAACCTGG + Intergenic
935906814 2:107848702-107848724 CTGGTGAGGCTGGTGAAACAGGG + Intronic
935993213 2:108740845-108740867 CTGGTGAGGCTGGTGAAACAGGG + Intronic
936128607 2:109813824-109813846 CTGGTGAGGCTGGTGAAACAGGG + Intronic
936216090 2:110557661-110557683 CTGGTGAGGCTGGTGAAACAGGG - Intronic
936425229 2:112412240-112412262 CTGGTGAGGCTGGTGAAACAGGG - Intronic
936668317 2:114624870-114624892 GTGGAGCAACAGATGAACCAAGG - Intronic
937183271 2:120014698-120014720 GTGGAACAGCTAATGAAAAATGG + Intronic
938737484 2:134199601-134199623 TTGGAGCAGCCGATAGAACAAGG - Intronic
939377778 2:141392086-141392108 CTGGTTAAGCTGATGAAGCAAGG + Intronic
939519109 2:143206858-143206880 CTGAAGTAGTCGATGAAACATGG + Intronic
940471812 2:154111101-154111123 CATGACCAGCTGAAGAAACAAGG - Intronic
943538241 2:189179729-189179751 CTGGAGCTGGTGCTGAAAAAGGG - Exonic
943633053 2:190276018-190276040 CTGTAACAGGAGATGAAACATGG + Intronic
944382196 2:199124081-199124103 TTGCAGCAGGAGATGAAACATGG - Intergenic
946254119 2:218430795-218430817 CTGGAAGAGCTGCTGAAAGACGG - Exonic
947384267 2:229575617-229575639 TTGGAGCAGGTGATCAAAGATGG - Intronic
947407427 2:229794091-229794113 CTGGAGGAGTTCATGAAATAAGG - Intronic
948350640 2:237337801-237337823 ATGGAGCAGGGCATGAAACACGG + Intronic
1168749051 20:269206-269228 CTGGAGTAGCTGATTAATGATGG - Intergenic
1170174720 20:13456052-13456074 CTATAACAGCAGATGAAACATGG + Intronic
1172671144 20:36635216-36635238 CTTCAGCAGCTGCTGAAACCTGG - Intronic
1172841705 20:37905988-37906010 CTGAATCAGCTGAGGACACACGG - Intronic
1174036742 20:47673183-47673205 CTGGAGCAGCTGTGGACAGAAGG - Intronic
1174766101 20:53255418-53255440 GAGGAGAAGCTGATGAAAGAGGG + Exonic
1176303444 21:5111004-5111026 ATGGAGCTGCTGCTGAATCAGGG + Intergenic
1178353992 21:31895315-31895337 CTGAAGCAGCTGTTGAACTAGGG + Intronic
1178546066 21:33493931-33493953 CTTGAGCAGCTGGGGAAGCAAGG - Intergenic
1178789438 21:35686273-35686295 CTGTAACAGAAGATGAAACATGG + Intronic
1178895176 21:36551651-36551673 CAGGAGGAGCTGTTGCAACAGGG - Intronic
1179484870 21:41703891-41703913 CTGGACAAGTTGATGACACACGG - Intergenic
1179853588 21:44150946-44150968 ATGGAGCTGCTGCTGAATCAGGG - Intergenic
1181109184 22:20591408-20591430 CTGGAGCCTCTGCTGAAGCAGGG + Intergenic
1181507887 22:23373870-23373892 CTGGAGGAGCTGGGGAAACCGGG + Intergenic
1181788996 22:25248429-25248451 CTGGAGCCTCTGATGACACATGG - Intergenic
1182080374 22:27524508-27524530 ATGGAGCAGCTGGGGAACCAGGG + Intergenic
1183293822 22:37018712-37018734 GTAGAGCACCTGATGAACCATGG + Exonic
1183636902 22:39069516-39069538 CTCGAGGACATGATGAAACAGGG + Intronic
1184158924 22:42686592-42686614 CTGGAGCTGCTGCTGACACGTGG - Intergenic
1185131924 22:49044206-49044228 GTGGAGGAGCAGCTGAAACAGGG - Intergenic
950053570 3:10009237-10009259 CTGGAGCAGCTGCTGACATCTGG - Intronic
951372158 3:21862768-21862790 CTGTGGCAGCAGATGTAACAGGG - Intronic
953972852 3:47360475-47360497 GTGGAGCAGGTGATGGAAAAAGG + Intergenic
954070807 3:48141613-48141635 CTGAGGCAGATGAGGAAACAAGG - Intergenic
958432169 3:94054133-94054155 CTGCAGCTTCTGATGGAACAAGG - Exonic
959037333 3:101383312-101383334 CTGGAGCAGCTGCTGCAAAGAGG + Intronic
959614946 3:108336764-108336786 CTGGAACAGCTCAAGAACCAAGG + Intronic
959648342 3:108727368-108727390 CTGGAGCATCTGATTATACCTGG - Intergenic
959669530 3:108960409-108960431 CTGTAACAGGAGATGAAACATGG + Intronic
961478171 3:127161546-127161568 GTGGAGCAGAGGATGAAGCAGGG - Intergenic
961741237 3:129034270-129034292 GTGGAGCAGCTGAGGACTCAGGG + Exonic
962281828 3:134057921-134057943 CAGGAACAGCTGATGAGACTAGG - Intergenic
962293498 3:134158195-134158217 CTGTACCAGCTGCTGAAACTTGG + Exonic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
962735455 3:138321596-138321618 CTGGAGCAGCTGAAAGAGCATGG - Intronic
962993296 3:140599760-140599782 GTGGAACAGCTGAGGCAACAGGG - Intergenic
963451980 3:145493542-145493564 TTGGACAAGCTGATGAAAAATGG - Intergenic
964532523 3:157683795-157683817 CTGGAGCAGCAGATTAAATCAGG - Intergenic
964662889 3:159140330-159140352 CTGGGGCAGCTGAAGTCACAAGG - Intronic
966877507 3:184331550-184331572 CTGGAGAAGCTGCTGAAGGAGGG + Exonic
968682928 4:1933914-1933936 ATGGAACAGCTGAGCAAACATGG + Intronic
969386029 4:6848966-6848988 CTGGAGCATTTGAGGACACACGG + Intronic
969390332 4:6888099-6888121 CTGGAGCTGCAGATCCAACAAGG - Intergenic
970346395 4:15156721-15156743 CTGGAACAGAGGATGAACCAAGG - Intergenic
970575813 4:17426549-17426571 ATGGAGGAGCTGGTGAACCAAGG + Intergenic
974204538 4:58683823-58683845 TTGGAACAGGTGATAAAACATGG + Intergenic
974291875 4:59943699-59943721 CAGGAGCCACTGATGAAATATGG - Intergenic
974474423 4:62361473-62361495 CTGGAGTAGCTGAAGACAAAGGG - Intergenic
974626114 4:64430883-64430905 ATGGAGAAGCTGCTGCAACAGGG + Intergenic
978490923 4:109311171-109311193 CTGTAACAGGAGATGAAACATGG + Intergenic
979348397 4:119616645-119616667 CTGCAGCAGCTGCTGGAACCAGG - Intronic
979359892 4:119749203-119749225 CTGTAACAGGAGATGAAACATGG - Intergenic
981488608 4:145315524-145315546 ATGGAGCAACTGAAGAAACTGGG + Intergenic
985562785 5:599809-599831 CTGGTGAAGCTGAAGAAAAAAGG - Intergenic
986332843 5:6730241-6730263 CTGGAGCAGGTGATGTCCCAGGG - Intronic
986566062 5:9115799-9115821 CTAGAGGAGGTGATGACACAGGG - Intronic
987925671 5:24337675-24337697 ATGGAGCAGCTGTTGATGCAAGG + Intergenic
988159890 5:27505207-27505229 CTGGACCAGCTTAAGAAACATGG + Intergenic
988730716 5:33970156-33970178 CTGCAGCAGCTGCTGGAGCAAGG - Intronic
991565108 5:67997022-67997044 CTTGAGGAGCTGCTGAAAGATGG + Intergenic
992475221 5:77095401-77095423 TTGGAACAGGAGATGAAACATGG - Intergenic
993054817 5:82969493-82969515 GTGGAGCAGATGATCAAAAAAGG + Intergenic
997379771 5:133427300-133427322 CTGTGGGAGCTGATAAAACAAGG - Intronic
998252997 5:140564966-140564988 CAGGAGCCGCAGAAGAAACAAGG - Exonic
998267488 5:140677085-140677107 CTGGAGCAGCTGTTCCACCAGGG + Exonic
998662504 5:144255411-144255433 ATGGTGCAGCTGATGGAAAATGG - Intronic
999953597 5:156676519-156676541 CTGGGGCGGCTCTTGAAACAGGG + Intronic
1001535479 5:172495008-172495030 CTGGAGGAGCCAATGAAATAGGG + Intergenic
1004903031 6:20211388-20211410 CTGCAGCACCTGAAGAGACAAGG + Intronic
1005473834 6:26188181-26188203 CTGTAGCTGCTGGAGAAACAAGG - Intergenic
1006015642 6:31078619-31078641 CTGGACCAGCTGTTGCTACAGGG - Intergenic
1006846631 6:37066635-37066657 CGGGAACAGGAGATGAAACAGGG + Intergenic
1006973519 6:38073271-38073293 CTGCAGCAGCTACTGAAAAAAGG - Intronic
1007655726 6:43450027-43450049 CTGCAGCAGCTGCTGGAACAGGG - Exonic
1009185025 6:60564645-60564667 CATGACCAGCTGAAGAAACAAGG + Intergenic
1013177776 6:107691806-107691828 CTGCAGCTGATGATGAAAAAAGG + Intergenic
1014360981 6:120473264-120473286 CTGGAGTAGCTGAGAATACAGGG + Intergenic
1018428695 6:163706285-163706307 CAGGAGCAGCTTCAGAAACACGG + Intergenic
1018987188 6:168646864-168646886 CTGGAGCACCTGAGGATACTTGG + Intronic
1020723293 7:11776705-11776727 CTGGATAAACTGATAAAACATGG + Intronic
1021823559 7:24522470-24522492 CTGGAGAAGCTCATGATTCATGG + Intergenic
1022020290 7:26393768-26393790 CTGGCACAGGTGATGAAACAGGG + Intergenic
1022679090 7:32527145-32527167 CCGAAACAGCTGATAAAACAAGG + Intronic
1024486435 7:49925529-49925551 ATGGAGCTGATGATGAAAGATGG + Intronic
1030607979 7:111658781-111658803 CTGGAGCAGCTGCTTACACCTGG + Intergenic
1031323035 7:120357043-120357065 CTGAAGGAGCTCATGAAATATGG - Intronic
1031769354 7:125823630-125823652 CTGTAGCAGGAGATAAAACATGG + Intergenic
1032330078 7:130970450-130970472 CAGGTGCAGCTAATGAAACAGGG - Intergenic
1033506407 7:142006611-142006633 TTGTAGCAGGTGATGGAACATGG - Intronic
1035917305 8:3638625-3638647 GTGGAGGAGCAGGTGAAACATGG + Intronic
1036390319 8:8318956-8318978 CTGGAGCACCTGAAGGAGCACGG - Exonic
1036984844 8:13517702-13517724 CTGGATCAGCTAATCAAATAAGG + Intergenic
1037846984 8:22292167-22292189 ATGGAGGAGCTGATTACACAGGG + Intronic
1037902002 8:22693968-22693990 CTGGAGCCGCTGAGGTAGCAGGG - Intergenic
1039402806 8:37285606-37285628 CTGTAACAGAAGATGAAACATGG + Intergenic
1039802520 8:40972101-40972123 CTGTAGCAGGAGATGAAACATGG + Intergenic
1040711171 8:50190867-50190889 CTAGAGCATATGAAGAAACAAGG + Intronic
1041816681 8:61980650-61980672 CTGGAGCAGCTTTCCAAACATGG - Intergenic
1042622989 8:70726577-70726599 CTGTAACAGGAGATGAAACATGG + Intronic
1043677654 8:82978763-82978785 CTGGAGAAGCAGATGAAAATAGG - Intergenic
1043812269 8:84755126-84755148 TTGAAGTAGCTGTTGAAACATGG + Intronic
1044055548 8:87565755-87565777 ATGGTGCAGCTGATGCCACAGGG + Intronic
1044889640 8:96819835-96819857 CTGTAACAGGAGATGAAACATGG - Intronic
1045299930 8:100902288-100902310 CTGGAGCCTTTGATTAAACAAGG + Intergenic
1045828723 8:106432360-106432382 CTGCAGCATTGGATGAAACAGGG - Intronic
1046756106 8:117974383-117974405 ATGGAGCAGATGAGGAAGCATGG - Intronic
1047297618 8:123585243-123585265 CTGGAGTAGCAGATTTAACACGG + Intergenic
1047764888 8:127982238-127982260 CTAGAGCTGCTGTTAAAACAAGG - Intergenic
1048141337 8:131797585-131797607 CTGGAGCTGCTGAGAAGACAGGG + Intergenic
1049674749 8:143884447-143884469 CAGGAGCAGCTGCTGGGACATGG + Intergenic
1049930055 9:447644-447666 ATGGAGAAACTGATGAACCATGG - Intronic
1050180849 9:2921064-2921086 CTGGAGCTACTGAAGAAGCAAGG - Intergenic
1050652625 9:7790314-7790336 CTGCAGCCGCTGATGAAAGGAGG + Intergenic
1051340955 9:16110033-16110055 CTGGAACAAGTGATGACACATGG + Intergenic
1051516956 9:17940426-17940448 GAGAAGCAGCTGATGAAACTAGG + Intergenic
1056126435 9:83539355-83539377 CAGGAGCAGCTGTTGAGTCAGGG + Intergenic
1059303867 9:113338998-113339020 CTGGAGCCTGGGATGAAACAGGG - Intronic
1059427828 9:114232086-114232108 CAGGAGCAGCTGTTGCAGCAAGG + Intronic
1060149744 9:121281027-121281049 CTGGAGCAGATCAGGGAACAGGG + Intronic
1062156711 9:135053200-135053222 CTGGACAAGCTGGAGAAACACGG - Intergenic
1185651113 X:1648782-1648804 ATGGGGCAGCTGATGTAACCCGG + Intergenic
1186061273 X:5710048-5710070 CTAGAGAATCTCATGAAACACGG + Intergenic
1186233857 X:7485726-7485748 CTGAAGCCACTGAAGAAACAGGG - Intergenic
1187503756 X:19862070-19862092 CTGTAACAGGAGATGAAACACGG - Intronic
1188153849 X:26716223-26716245 CTGTAACAGGAGATGAAACATGG - Intergenic
1188768451 X:34125556-34125578 CTGCAGCTGCTGCTGATACATGG - Intergenic
1192531112 X:71886894-71886916 TTGTAACAGGTGATGAAACATGG + Intergenic
1193094210 X:77528493-77528515 CTGGAGAAGCCGAGGAAACTAGG + Intronic
1193668202 X:84350396-84350418 CTGTAGCAGCTGTTGAGAGAAGG + Intronic
1194776846 X:97975882-97975904 CTGAAGAAGCTGAAGAACCAAGG - Intergenic
1195956033 X:110331564-110331586 CAGTAGGAGCTGATGAAATAAGG - Intronic
1196683334 X:118490714-118490736 CTGGAGAAGCTCATGAGGCAAGG + Intergenic
1196717892 X:118827607-118827629 CTGGAGCACGTGAAGGAACATGG + Intergenic
1197093467 X:122566659-122566681 CTTGAGCAGCTGAGTAGACAGGG - Intergenic
1197992822 X:132336261-132336283 CTGTAACAGGAGATGAAACATGG + Intergenic
1198392538 X:136190812-136190834 CTGGAGCAGCTGTTAACTCAGGG + Intronic
1198431137 X:136567329-136567351 CTGGAGGACCTGCTGATACAAGG + Intergenic
1200544100 Y:4497857-4497879 CTTGGGCAGTTGATGAGACAGGG - Intergenic