ID: 915311571

View in Genome Browser
Species Human (GRCh38)
Location 1:155008132-155008154
Sequence CTGTGGGCACCGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915311571_915311579 5 Left 915311571 1:155008132-155008154 CCTTCCTCTTTCGGTGCCCACAG 0: 1
1: 0
2: 0
3: 12
4: 193
Right 915311579 1:155008160-155008182 CCAATCTGTCTATCCCCCTCAGG 0: 1
1: 0
2: 1
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915311571 Original CRISPR CTGTGGGCACCGAAAGAGGA AGG (reversed) Intronic
900432481 1:2609420-2609442 CTGTGGGCACAGGAAAAGGTTGG + Intronic
904049613 1:27631364-27631386 GTGTGGGCCTCGAAAAAGGATGG - Intronic
905703573 1:40037770-40037792 CAGTGGGCAACAAAAGAGGCAGG - Intergenic
906511440 1:46412344-46412366 CTGTGGGCCCCGAGAGGGCAGGG - Intronic
906681059 1:47725640-47725662 CTGAGGGCTCAGAAAGGGGAAGG - Intergenic
909482888 1:76144265-76144287 CTGAGGCCAAGGAAAGAGGATGG + Intronic
910685626 1:89913198-89913220 ATGTGGCCACCTAATGAGGAGGG - Intronic
912270855 1:108207837-108207859 TTATGGGCAGCGAAAGAGAAAGG - Intergenic
912309285 1:108603338-108603360 CTGGGGACAACCAAAGAGGAGGG + Intronic
912755140 1:112318184-112318206 CCGAGGCCACAGAAAGAGGATGG - Intergenic
913687443 1:121246214-121246236 CTTTGGGCACTGGAAGAGTATGG + Intronic
914039305 1:144033859-144033881 CTTTGGGCACTGGAAGAGTATGG + Intergenic
914150154 1:145034077-145034099 CTTTGGGCACTGGAAGAGTATGG - Intronic
915131455 1:153698102-153698124 CTGCGGGCACCGGGAGGGGAAGG + Intergenic
915229693 1:154436117-154436139 CGGTGGGCACTGAGAAAGGAAGG + Intronic
915311571 1:155008132-155008154 CTGTGGGCACCGAAAGAGGAAGG - Intronic
916379215 1:164189651-164189673 TTGTGGCCACAGAAACAGGATGG + Intergenic
916720945 1:167484396-167484418 CTCTGGGCTCCCAAAGGGGAAGG - Intronic
917431444 1:174973824-174973846 CTGTGGGTCCTGTAAGAGGAAGG + Intronic
920474771 1:206264734-206264756 CTTTGGGCACTGGAAGAGTATGG + Intronic
921512140 1:216045038-216045060 CTGTGAGCACCAAGAGAAGAGGG + Intronic
922770274 1:228178140-228178162 ATGTGGGCTCAGAAAGTGGAAGG - Exonic
923783120 1:237042866-237042888 CTGCGGGAACCGGGAGAGGAGGG + Intronic
1065553195 10:26889142-26889164 CTTTGGGCAGCCAAGGAGGATGG + Intergenic
1068739468 10:60452144-60452166 CTGTGTGCACCGCTAGAGGCTGG - Intronic
1069313222 10:67065515-67065537 CTGTGGGCCCAGGAAGAAGATGG - Intronic
1069420373 10:68241443-68241465 CTTTGGGAACCTAAGGAGGAGGG - Intergenic
1069779314 10:70944826-70944848 CTGAGGGCACTGAAAGAGGCTGG - Intergenic
1070920976 10:80186277-80186299 CTGTGGGGACTGAAGGGGGAAGG + Intronic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1073771059 10:106736408-106736430 CTGTGGGAACATGAAGAGGAAGG - Intronic
1074643890 10:115421806-115421828 CTGTGGTAACCAAAACAGGATGG + Intronic
1075050289 10:119178516-119178538 CCGGGGACGCCGAAAGAGGAGGG + Intronic
1075895309 10:125989938-125989960 CGGTGGGGACAGCAAGAGGATGG - Intronic
1077365442 11:2159674-2159696 CTGTGGGCACCCAGAGAGCGTGG + Intronic
1081190647 11:40099975-40099997 CGGTGGGCCCCAAAAAAGGAAGG - Intergenic
1082042056 11:47694330-47694352 CTCTGTGCAACTAAAGAGGAAGG - Intronic
1085804566 11:79623245-79623267 CTGTGGGAATTGATAGAGGAAGG - Intergenic
1086815906 11:91370393-91370415 ATGTGGGCCCAGAATGAGGAGGG + Intergenic
1090419807 11:126566820-126566842 CTGTGAGCATCTAAAGAGAAAGG - Intronic
1091077819 11:132637423-132637445 CTGTGGCCACTGAAAGATGGAGG - Intronic
1091699447 12:2650497-2650519 CTGCGGGCACCGGGAGAGAATGG - Intronic
1092287605 12:7137932-7137954 CTGAGGGCACAGGAAGGGGATGG - Intronic
1093524297 12:20089869-20089891 CTGGGGACTCCGAAAGAGGCAGG + Intergenic
1097745918 12:63302898-63302920 CTGTGGGCAGTGGAAGAGAATGG - Intergenic
1101320517 12:103669300-103669322 CTGTGCGAACAGACAGAGGAAGG - Intronic
1102960848 12:117092464-117092486 CTGTGAGCCCCCAGAGAGGAGGG + Intronic
1103893150 12:124254872-124254894 CTGTTGGAGCTGAAAGAGGAGGG + Intronic
1104728899 12:131094403-131094425 CTGTGGGCACCGGGGCAGGACGG + Intronic
1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG + Intergenic
1108526936 13:51293471-51293493 CTGTGGGCAAAGAAAGGAGAAGG - Intergenic
1108692380 13:52871026-52871048 CTGAGGGAACAGAAAGAGGGAGG + Intergenic
1113629191 13:111869426-111869448 CTTGGGGCACAGGAAGAGGATGG - Intergenic
1114679895 14:24475517-24475539 CTGTGGGCTGCAATAGAGGAAGG - Intergenic
1115872714 14:37823235-37823257 CTGTGGACACCAGGAGAGGAGGG - Intronic
1116034857 14:39615543-39615565 CTGTGTGCCCTGAGAGAGGATGG + Intergenic
1118006419 14:61568098-61568120 CGGTGGGCACAGAGAGATGAGGG - Intronic
1118837608 14:69487672-69487694 CTGGGGGCAACAAAAGGGGAAGG + Intronic
1120089723 14:80317567-80317589 CTTTGGGGACTGGAAGAGGAAGG - Intronic
1121567759 14:94923508-94923530 CTGTGGGCAGTGAAGGTGGAGGG - Intergenic
1123991091 15:25683882-25683904 CTGGGGTCACAGACAGAGGAGGG - Intronic
1124362069 15:29044961-29044983 GTGTGGACACAGAAAGAAGATGG - Intronic
1124868885 15:33521100-33521122 CTGTGGGCACCTAAAGCCGTAGG - Intronic
1126967333 15:54069867-54069889 CTGTGGCCAAGGAAAGAGAAAGG - Intronic
1129663416 15:77565884-77565906 ACGTGGGCACCCACAGAGGACGG - Intergenic
1129858862 15:78844645-78844667 CTGTGGCCAGTGAATGAGGATGG - Intronic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1130359715 15:83171726-83171748 CTGTGGACTCCAAAAGGGGATGG + Intronic
1131268520 15:90932783-90932805 CTGTGGGCTCCCAAAGAGCCAGG - Intronic
1131390507 15:92044211-92044233 TTGTGGGCACTGAGATAGGAGGG - Intronic
1132495110 16:259357-259379 GTGAGGGCACCCAACGAGGACGG - Intronic
1132858856 16:2060186-2060208 CTGTGAGCACAGAACGAGGACGG - Intronic
1133116776 16:3582080-3582102 CTGTGAGCACGGACAGAGGAAGG + Exonic
1134586196 16:15413532-15413554 TTGTGGACAAAGAAAGAGGAAGG - Intronic
1139706937 16:68747298-68747320 TCCTGGGCACAGAAAGAGGAGGG + Intronic
1143020226 17:3913775-3913797 CTGTGGGCACTGCCAGGGGATGG - Intronic
1143113274 17:4565617-4565639 CTATGGGCACAGAAAGTGGATGG - Intergenic
1143203660 17:5128993-5129015 CTCTGGGCAGCTACAGAGGAGGG + Exonic
1143867046 17:9931545-9931567 CTGGGGGCCCCGACAGGGGAAGG + Intronic
1147418866 17:40312169-40312191 TTGTGGGCACCCAAAGGGCAGGG - Intronic
1148127091 17:45242490-45242512 ATGTGGGCACCGGAGGAAGAGGG + Intronic
1149444721 17:56704825-56704847 CTGTGGGCCTTGAAAGAGAAAGG + Intergenic
1149774861 17:59349324-59349346 CTGTGGGCTGAGAAAGGGGAGGG - Intronic
1150417148 17:64996891-64996913 CTTCGGGCACCGAGAGAGGGAGG - Intergenic
1150794513 17:68227031-68227053 CTTCGGGCACCGAGAGAGGGAGG + Intergenic
1152336888 17:79703750-79703772 CTGTGGGCATGGAAAGATGCTGG - Intergenic
1152680851 17:81667021-81667043 CCGCGGGCACAGACAGAGGAGGG - Intronic
1153055048 18:937316-937338 CTGTGGGCTCCCCATGAGGAGGG + Intergenic
1153826372 18:8878735-8878757 CTGTGGGCCACTAAAGAGCAAGG - Intergenic
1154156095 18:11945376-11945398 ATGTGGACACTGAAAGAGTAAGG - Intergenic
1156336072 18:36172675-36172697 CTGTGGGCAGGCAAAGTGGAAGG - Intronic
1156495935 18:37525112-37525134 CTGTGGCCAGCTTAAGAGGAAGG - Intronic
1157074472 18:44449996-44450018 CTGTGGGAACAGAAAGCAGAAGG - Intergenic
1158395866 18:57077998-57078020 CTCTGGGGTCCCAAAGAGGAAGG + Intergenic
1160842381 19:1151988-1152010 CTCTGGGCACTGGAAGAGGCTGG + Intronic
1163784804 19:19269551-19269573 CTGTGGACACGCAAAGAGGGAGG + Intronic
1164596462 19:29533581-29533603 CTCTGGGCACGGAAAATGGATGG + Intronic
1164817948 19:31220808-31220830 CTGTGTGCTCAGAAAGATGAAGG + Intergenic
1167472337 19:49682258-49682280 CGGTGAGCCCAGAAAGAGGATGG + Exonic
931733994 2:65177702-65177724 CTGTGGGCGCCTAATGAGCATGG - Intergenic
934603669 2:95678384-95678406 TTGTTGGCACTGAAAGAGCACGG + Intergenic
935266753 2:101401535-101401557 TTGTGGGCACAAAAAGAAGAAGG + Intronic
936537049 2:113320622-113320644 TTGTTGGCACTGAAAGAGCACGG + Intergenic
937093167 2:119220066-119220088 CTGTGGCCAGCGCAAGAGTATGG - Intergenic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
938950350 2:136249395-136249417 CTGTGGGCACAGGGAGAGGCAGG + Intergenic
943064206 2:183069805-183069827 CTGTGGGCACCTGAGGACGAGGG - Intergenic
943338407 2:186646663-186646685 CTGTGGGGAAAAAAAGAGGAGGG - Intronic
944047353 2:195428354-195428376 CTGGGGGCCCCTAAAAAGGAAGG + Intergenic
945404806 2:209432294-209432316 CTGTAGGCAGAGAAACAGGAAGG - Intronic
946147653 2:217743145-217743167 CTGTGGGCCCCAAAAGGGGCTGG + Intronic
947388530 2:229616555-229616577 TTCTGGGGACAGAAAGAGGAAGG - Intronic
947720749 2:232367995-232368017 CAGAGGGCACCGCAGGAGGAAGG - Intergenic
947869812 2:233428311-233428333 CTGTGGGCAGCTAAGAAGGATGG + Intronic
948461950 2:238134112-238134134 CTGAGGGCCCTGACAGAGGAGGG + Intergenic
948711212 2:239826912-239826934 CTGAGTGCACGGAGAGAGGAAGG - Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1168961363 20:1872163-1872185 CTGGAGGCAGCGTAAGAGGAAGG - Intergenic
1171081526 20:22190866-22190888 CTGTGGTAACCAAAACAGGATGG + Intergenic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1172550634 20:35796740-35796762 CTTTGGTCAGAGAAAGAGGAAGG + Intronic
1172778298 20:37420646-37420668 CTGTGGGCAAGGAACGAGGAGGG - Intergenic
1173595945 20:44258411-44258433 CTGTGGGCACCGCCAGGGGCTGG - Intronic
1175226063 20:57444657-57444679 GTGTGGGAGCGGAAAGAGGATGG + Intergenic
1176098974 20:63356415-63356437 CCTAGGGCACCGAGAGAGGAAGG + Exonic
1178223560 21:30688610-30688632 CTGAGGTCCCCCAAAGAGGAAGG + Intergenic
1179952601 21:44718561-44718583 CTATGGGCAACGAAAGTGGCTGG - Intergenic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1182760564 22:32719318-32719340 CTGTGGGCTCCAAAAGAGTTTGG - Intronic
952493351 3:33893344-33893366 CTGTAGTCACCAAAAGAGCATGG - Intergenic
953653816 3:44832080-44832102 CTGGGGGCACAGAAAAGGGAGGG + Intronic
954713772 3:52517215-52517237 CTGGGGGCGCTGAGAGAGGAGGG + Intronic
955003543 3:54949065-54949087 CTGGGGGCACTGGATGAGGAAGG - Intronic
959182841 3:103004055-103004077 CTTTGGGAAGCGAAGGAGGAAGG - Intergenic
962096738 3:132300111-132300133 CTGTGGGCCACTAAAGAGCAAGG - Intergenic
962602987 3:137009370-137009392 CTGGGGCCACTGAAAGAAGATGG + Intronic
966672809 3:182547479-182547501 CTGTGGGCACAGAACAAGCATGG + Intergenic
967172477 3:186832763-186832785 CTGTGGTCACAGATAGGGGAAGG + Intergenic
967721420 3:192820107-192820129 CTGTGGGGAGAGAAAGGGGAGGG + Intronic
967732900 3:192922450-192922472 ATGAGGGCACAGAAAGAGAAGGG + Intergenic
968690544 4:1987701-1987723 GTGTGGGCACGGAGACAGGAGGG - Intronic
968983278 4:3862496-3862518 CAGTGGGGGCAGAAAGAGGAGGG - Intergenic
970419847 4:15895650-15895672 CTGTGAGCACCACAAGAGGAGGG + Intergenic
971370366 4:26014370-26014392 CTGTGGGCAAAGAAAGGGCAAGG - Intergenic
972093197 4:35314815-35314837 ATGTTGGCATTGAAAGAGGATGG + Intergenic
976980925 4:91227675-91227697 CTGTGGACTCCAAAAGGGGAAGG - Intronic
983670786 4:170235580-170235602 CTATGGGCAAGGAAAGAGTAAGG - Intergenic
984194562 4:176642842-176642864 CTGTTGACACCCAAAGTGGAGGG - Intergenic
985624959 5:980541-980563 CTGTGGCCAGAGAAAGAGGCTGG + Intronic
986165488 5:5268771-5268793 AGGTGGGCAGAGAAAGAGGAAGG - Intronic
989563355 5:42875899-42875921 CTGTGGCCCCCGGAAGAGGAAGG - Intronic
990988490 5:61662312-61662334 CTGCGGTCACAGGAAGAGGATGG + Intronic
1000236832 5:159369822-159369844 CTGTGGACAACTAAAGAGCAAGG + Intergenic
1002169663 5:177367893-177367915 CTGTGGGCCACGTAGGAGGAAGG - Intronic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1004331804 6:14728697-14728719 ATGTGGGCAGAGAAGGAGGAGGG + Intergenic
1004757284 6:18625479-18625501 CTGAGGTCCCCAAAAGAGGAAGG - Intergenic
1005363690 6:25056269-25056291 CTGTGGTCTCCTGAAGAGGAAGG - Intergenic
1007001034 6:38312786-38312808 CTGTGGTAACCAAAAGAGGATGG - Intronic
1007998653 6:46335611-46335633 CTGTTGGGACCTCAAGAGGAAGG - Intronic
1010862703 6:80933148-80933170 CTGTAGTCACCAAAAGAGCATGG - Intergenic
1010923542 6:81714763-81714785 CTTTGGGCATTGAAAGAGAAAGG + Intronic
1013177461 6:107689872-107689894 CTGTGGGCACCTGACGGGGAAGG - Intergenic
1014411763 6:121132634-121132656 CTGCTGGGACCCAAAGAGGATGG + Intronic
1015074805 6:129143000-129143022 CTGTTGGCACGGATAAAGGAAGG - Intronic
1018419564 6:163630353-163630375 CAGTGGGCACTGAAGGAGAAAGG + Intergenic
1019579223 7:1751738-1751760 CTGGGGGCAGCCACAGAGGAGGG + Intergenic
1022342847 7:29485453-29485475 CTGTGAGCATTCAAAGAGGAGGG + Intronic
1023551472 7:41374456-41374478 CGGTGGGCACAGACACAGGAGGG + Intergenic
1023959453 7:44914185-44914207 CTGAAGGCACCCAAAGAGGGAGG - Intergenic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1031972565 7:128075038-128075060 CTGAGGGCACTGACAGAGAAGGG - Intronic
1032170562 7:129581183-129581205 CTGTGGGCCACTAAAGAGCAAGG + Intergenic
1032322489 7:130897730-130897752 GTGTGGGCACCCCAGGAGGAAGG + Intergenic
1032793824 7:135261701-135261723 CTGTGGGCACAGAAGCAGTAGGG + Intergenic
1032965360 7:137091275-137091297 CCATTGGCACCTAAAGAGGAGGG - Intergenic
1033028205 7:137798296-137798318 TTGTGAGAACTGAAAGAGGAAGG + Intronic
1033321333 7:140342440-140342462 CAGTGGTCAAAGAAAGAGGAAGG - Intronic
1033365545 7:140670677-140670699 CTGTGGGCATCATAAGTGGAAGG - Intronic
1035241057 7:157529429-157529451 GAGTGGGCACCAAAAGAGGAGGG - Intergenic
1035277088 7:157754133-157754155 CTGTGGGCTCAGGAAGAGCAGGG + Intronic
1035939306 8:3878106-3878128 ATGTGGGCAGGGAAGGAGGAAGG - Intronic
1036185110 8:6615825-6615847 CAGTGGGCACCGCAATTGGAGGG + Intronic
1036996475 8:13663500-13663522 CTTTGGGCACCTAAGGAGGGAGG - Intergenic
1037744149 8:21629934-21629956 CTGTGGCCACTGTGAGAGGATGG - Intergenic
1038650895 8:29402283-29402305 CTGTGAGCCCCGACAGAGGTAGG - Intergenic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1044184579 8:89236368-89236390 CTGTGGACCACTAAAGAGGAAGG - Intergenic
1044811707 8:96070260-96070282 ATTGGGGCACCAAAAGAGGATGG - Intergenic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1060116416 9:120944909-120944931 CTGAGGGCAAAGGAAGAGGAAGG - Intergenic
1060745457 9:126127982-126128004 CTCTGGGCACTGAAAGAAGAGGG + Intergenic
1061423518 9:130485012-130485034 CTGGGGGCTCAGGAAGAGGAGGG + Intronic
1061572254 9:131485035-131485057 CTGGAGGCACCCACAGAGGATGG - Exonic
1061667836 9:132170615-132170637 CTGTGGTCCCCGTGAGAGGAAGG + Intronic
1061681787 9:132246067-132246089 CTGTGGGCGCCAAAGGAGGCAGG - Intergenic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1186115384 X:6300069-6300091 TTCTGGGCACTGAAAGAGGCTGG - Intergenic
1186519535 X:10193248-10193270 CTGTGGGCATCGGAAGCTGACGG + Intronic
1190151971 X:47956649-47956671 CTGTTGGCCCCAAAAGGGGAAGG + Intronic
1190176723 X:48156640-48156662 CTGTGGCCTCCAAAAGAGCAGGG - Intergenic
1197100502 X:122647924-122647946 CTGTGAGCACCTTAAGAGCAGGG + Intergenic
1200051764 X:153436018-153436040 CTGAGGTCACCCAAAGAGGAAGG + Intergenic
1200071773 X:153532728-153532750 CTGTAGGCACCAAAAGGGCAGGG - Intronic