ID: 915312589

View in Genome Browser
Species Human (GRCh38)
Location 1:155011828-155011850
Sequence GCCTCCCCCTTCTTTCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 0, 3: 46, 4: 430}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915312589_915312594 8 Left 915312589 1:155011828-155011850 CCTGGCAGAAAGAAGGGGGAGGC 0: 1
1: 0
2: 0
3: 46
4: 430
Right 915312594 1:155011859-155011881 CACCCATCCCTCCCAGATGATGG 0: 1
1: 0
2: 2
3: 14
4: 204
915312589_915312599 15 Left 915312589 1:155011828-155011850 CCTGGCAGAAAGAAGGGGGAGGC 0: 1
1: 0
2: 0
3: 46
4: 430
Right 915312599 1:155011866-155011888 CCCTCCCAGATGATGGGTCTAGG 0: 1
1: 0
2: 1
3: 12
4: 126
915312589_915312595 9 Left 915312589 1:155011828-155011850 CCTGGCAGAAAGAAGGGGGAGGC 0: 1
1: 0
2: 0
3: 46
4: 430
Right 915312595 1:155011860-155011882 ACCCATCCCTCCCAGATGATGGG 0: 1
1: 0
2: 0
3: 12
4: 126
915312589_915312601 18 Left 915312589 1:155011828-155011850 CCTGGCAGAAAGAAGGGGGAGGC 0: 1
1: 0
2: 0
3: 46
4: 430
Right 915312601 1:155011869-155011891 TCCCAGATGATGGGTCTAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 128
915312589_915312603 19 Left 915312589 1:155011828-155011850 CCTGGCAGAAAGAAGGGGGAGGC 0: 1
1: 0
2: 0
3: 46
4: 430
Right 915312603 1:155011870-155011892 CCCAGATGATGGGTCTAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 131
915312589_915312605 27 Left 915312589 1:155011828-155011850 CCTGGCAGAAAGAAGGGGGAGGC 0: 1
1: 0
2: 0
3: 46
4: 430
Right 915312605 1:155011878-155011900 ATGGGTCTAGGAGGGCCCCTTGG 0: 1
1: 0
2: 1
3: 11
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915312589 Original CRISPR GCCTCCCCCTTCTTTCTGCC AGG (reversed) Intronic
900126945 1:1072903-1072925 TCCTCACCATTATTTCTGCCCGG - Intronic
900375976 1:2355012-2355034 GCCTCCCCCGACTCTCAGCCCGG - Intronic
900379046 1:2374556-2374578 GCCTCACCCTTCTCTCTGCAGGG - Exonic
900421797 1:2558943-2558965 GGTTCCCCTTTCTGTCTGCCTGG - Intronic
900508060 1:3039442-3039464 CCCTCCCCCTTCTTATTTCCTGG + Intergenic
900609501 1:3538516-3538538 GGCTCCCCCCTGTTTCTGCCTGG - Intronic
900691098 1:3981114-3981136 CCCTCTGCCTTCTTCCTGCCTGG - Intergenic
900724874 1:4209446-4209468 GCCTTCTCTTCCTTTCTGCCTGG + Intergenic
900808896 1:4786222-4786244 GCCTCTCCCTTCTGTGTGCAAGG - Exonic
900878994 1:5367013-5367035 GCCTCACCCTTCCTTCTGCAGGG - Intergenic
901143744 1:7051955-7051977 GCCTCCCCCTTCTTCCGCTCAGG + Intronic
901273305 1:7970601-7970623 CCCTCCCATTTCTTTCTCCCTGG + Intronic
902830917 1:19011996-19012018 GCTTGCCCCTTCTCTCTGCCTGG - Intergenic
903338013 1:22637701-22637723 GCCTCCCCTTTCTTCCCGTCTGG - Exonic
903358377 1:22762090-22762112 GCCTCCCCCTCCTCCCAGCCTGG + Intronic
903360578 1:22774435-22774457 GCCTCCTTCTTCCTTCTTCCTGG - Intronic
903501471 1:23802304-23802326 CCCTTCGCCTGCTTTCTGCCAGG + Exonic
903655146 1:24944352-24944374 CCCTTCCCATTCTGTCTGCCTGG + Intronic
903741273 1:25560055-25560077 CCCACCCCCTTCTCTCGGCCTGG - Intronic
903757757 1:25674605-25674627 TCCTCCCTCCTCTTTTTGCCTGG - Intronic
904399426 1:30246434-30246456 GCCTTCCCCTCCTGTCTGTCGGG - Intergenic
905396255 1:37668622-37668644 TCCTCTCCCTTCTCCCTGCCTGG - Intergenic
905798389 1:40828269-40828291 GCCCACCCCATCTTTCTCCCAGG + Intronic
905816567 1:40955492-40955514 GCCACTCCCTTCTTTTTGCCTGG + Intergenic
906403804 1:45525417-45525439 GACTCCCCTTTCTTTCTTGCAGG + Intergenic
907181195 1:52571763-52571785 GCATCCCCCACTTTTCTGCCTGG + Intergenic
907385705 1:54124166-54124188 GCCTTCCCCTGCATTCTGCCTGG + Intergenic
907870898 1:58441868-58441890 GGCTCCATCTTCTTTCTGACTGG + Intronic
907901517 1:58745913-58745935 CCCTCTCCCTTCTCTCTCCCTGG + Intergenic
908023022 1:59917777-59917799 GCCCCTGCCTTTTTTCTGCCTGG + Intronic
908290242 1:62658648-62658670 GCCTTCCCCTTCATTCTTCAAGG - Intronic
908587062 1:65581318-65581340 GGCTCCCCCTTCTGGGTGCCAGG + Intronic
908815354 1:68026556-68026578 TTCTCCCCCTTCTTACTGACTGG + Intergenic
910535872 1:88296880-88296902 GTTACCCGCTTCTTTCTGCCTGG + Intergenic
910672468 1:89786881-89786903 TCCTGCCCCTTCTCTTTGCCTGG - Intronic
910758230 1:90712710-90712732 GCCTCCTCCTTCATTCTCCCTGG + Intronic
912523046 1:110259605-110259627 CCCTTCCCCTTCTTCCTGCCTGG + Intronic
912932701 1:113979333-113979355 CCCACCCCCTCCTTTCCGCCAGG - Intergenic
913452956 1:119004541-119004563 CCCTCCCCCATGTCTCTGCCAGG - Intergenic
914999386 1:152574186-152574208 CCATCCCCCTTCTCTCTGCAGGG - Intronic
915078223 1:153330407-153330429 GCCTTCCCCTGGTGTCTGCCTGG - Exonic
915312589 1:155011828-155011850 GCCTCCCCCTTCTTTCTGCCAGG - Intronic
915976667 1:160395496-160395518 CCTTCCTCCTTCTTTCTGCCTGG - Intergenic
918450222 1:184650421-184650443 GGAACCCCCTTCTTTCTGCGTGG - Intergenic
918511217 1:185316535-185316557 GACTCCCCGTTCTTGCTGTCAGG - Intronic
919669853 1:200328837-200328859 GCCATCCCCTTCTTACTTCCAGG + Intergenic
919886987 1:201941882-201941904 GCCTCCCCCTCCCTTCTCCCTGG - Intronic
921053508 1:211527302-211527324 GCCTCCCCCTTCATGCTGTGTGG - Intergenic
921241489 1:213188337-213188359 CCCTCCCCCTCCATTCTGCCTGG - Intronic
922712061 1:227841778-227841800 GCATCCTCCTCCTCTCTGCCAGG + Intronic
922958999 1:229628985-229629007 GCCTCCCCTTTGTTTCACCCTGG - Intronic
923116004 1:230938455-230938477 GCCTGGCCCTTCCTCCTGCCTGG - Intronic
923540081 1:234882501-234882523 GCACTCCCCATCTTTCTGCCTGG + Intergenic
924510584 1:244726473-244726495 ACATCCTCCTTCTTTCTGGCTGG + Intergenic
1062970619 10:1645432-1645454 GCATCCCCCTTACTTCTGCTAGG - Intronic
1063639092 10:7813442-7813464 GCCCTCCTCTTCTCTCTGCCAGG + Intergenic
1065027124 10:21549599-21549621 CCTCTCCCCTTCTTTCTGCCTGG - Intronic
1066441094 10:35439807-35439829 GCCACTCCCTTGTTACTGCCAGG + Intronic
1067047813 10:42995445-42995467 GTCTCCCCCTGCTCTTTGCCCGG - Intergenic
1067348659 10:45456303-45456325 GCCTCTCCTTTCTGTCTCCCAGG - Exonic
1068629306 10:59283602-59283624 GCCACCACCCTCTTCCTGCCAGG - Intronic
1068968330 10:62936085-62936107 CCCTTCCCTTTCTTCCTGCCTGG - Intergenic
1069016255 10:63432480-63432502 GCTTCCTCCTCCTTCCTGCCTGG + Intronic
1069469824 10:68677980-68678002 GCCTCCCTCCTCACTCTGCCTGG - Intronic
1069632425 10:69905003-69905025 GCCTCCCCCTCCCTCCTGCAGGG - Intronic
1070637858 10:78143614-78143636 CCCTTCCTCTTCTTCCTGCCTGG - Intergenic
1071027350 10:81131303-81131325 TTCTCCCCCTTCTCTCTGCTTGG - Intergenic
1072368164 10:94735510-94735532 GCCTCTCCCTTCTCTCTGTGAGG + Exonic
1072717735 10:97762817-97762839 ACCCTCCCCCTCTTTCTGCCTGG + Intergenic
1073415618 10:103379254-103379276 TCCTCCCCCTTCTTCCTTCTTGG - Intronic
1073930616 10:108569989-108570011 GCCTCCCATTTAATTCTGCCTGG - Intergenic
1075997906 10:126893163-126893185 GCATCCCCCTGCTTCCTGCTGGG + Intergenic
1076135118 10:128040373-128040395 TCATCCCCCTTCACTCTGCCTGG - Intronic
1076209924 10:128632333-128632355 GCCTCCCCCTCCTCCCAGCCCGG + Intergenic
1076216459 10:128697678-128697700 GCCTCCTCCTCCCATCTGCCTGG + Intergenic
1077035155 11:490942-490964 TCCTCCCTCCCCTTTCTGCCTGG + Exonic
1078073541 11:8136069-8136091 GCCTTGACCTTCTTTTTGCCTGG - Intronic
1078532209 11:12145464-12145486 GACTCCCCCTGCTTTCTCCAGGG - Intronic
1078553114 11:12293913-12293935 CCCTCCCTCTTCTTCCTTCCTGG - Exonic
1078658408 11:13263789-13263811 TCGTCCCGCATCTTTCTGCCTGG - Intergenic
1080836124 11:35942917-35942939 CCTTCCCCTTTCTTTCAGCCAGG + Intergenic
1081237143 11:40659363-40659385 GGGACCCCCTCCTTTCTGCCTGG - Intronic
1081737263 11:45412729-45412751 GCCTGCCCCTCCTCCCTGCCTGG + Intergenic
1083669584 11:64292422-64292444 GCCTCGCCCTGCTTCCTGGCTGG - Intronic
1083841164 11:65305027-65305049 GACTCCCCCTTCTTCCTCCATGG + Intronic
1083959597 11:66007239-66007261 GCCTCCCCCTACTTCCTTTCTGG - Intergenic
1084468721 11:69342782-69342804 GCCTGCCCCTTGTTTCTCCAGGG - Intronic
1084603320 11:70159216-70159238 CCCTTCCCCTTCTTCCAGCCTGG - Intronic
1085309206 11:75506303-75506325 CCCTCCTCCTTCTTCCTCCCTGG - Intronic
1087199731 11:95333287-95333309 GCTTCCCCCTTCCTTATCCCTGG + Intergenic
1088743909 11:112788447-112788469 CCTTCCCCCTTGTTTGTGCCTGG - Intergenic
1088933867 11:114379174-114379196 GCCTCCTCCTTTTTTCTCCTTGG - Intergenic
1089149022 11:116350618-116350640 GCCTTCCCCTACTTGCTGGCTGG - Intergenic
1089606511 11:119644536-119644558 GCCTCACACTTCTATGTGCCAGG + Intronic
1089974080 11:122717414-122717436 CCCTACCCCTTCTTACTGCCAGG - Intronic
1090398520 11:126434366-126434388 GCCTCCCGCTGCCTTCTCCCCGG - Intronic
1090826222 11:130388449-130388471 GCATCCTCATTCTTTCTGCCAGG - Intergenic
1091213463 11:133884717-133884739 GCCTCCCCATGCTTCCTGACTGG - Intergenic
1091302486 11:134516278-134516300 GCCTCCCCCTTCTCTAAGCAGGG + Intergenic
1091403078 12:192648-192670 GGCTGCCCCTTCCTTCTCCCAGG - Exonic
1091403989 12:197602-197624 GCCTCCCCCTTCTCTCTCCTTGG - Intronic
1091648800 12:2294291-2294313 GCCACGCTCTTCCTTCTGCCAGG - Intronic
1092285888 12:7129155-7129177 GCCTCCACCTCATTTCTGGCAGG + Intergenic
1092745044 12:11665329-11665351 CCCTCGATCTTCTTTCTGCCTGG + Intronic
1093142622 12:15527259-15527281 GCCTCCCCCGCGATTCTGCCTGG + Intronic
1093458754 12:19389301-19389323 GCCTCCCCAGACTTTCTGACTGG - Intergenic
1094680967 12:32666711-32666733 CCCTCCCCCTTTTTTCTGAGTGG - Intergenic
1095313413 12:40728386-40728408 CCCTTCCCCTTGTTCCTGCCTGG - Intronic
1095871650 12:47034926-47034948 TCTTCCCCCTTCTCCCTGCCTGG - Intergenic
1096769249 12:53923643-53923665 TTCTCACCTTTCTTTCTGCCTGG + Intergenic
1096971486 12:55669968-55669990 ACCTCCCTTTTCTTTCTGTCAGG - Intergenic
1101242801 12:102855089-102855111 TCCTCCCCCAACTTTCTGCAGGG + Intronic
1101706845 12:107228464-107228486 TCCTCCTCTTTCTTCCTGCCTGG - Intergenic
1101907132 12:108835513-108835535 GCCTTCCCCTTCCTGCTTCCCGG - Intronic
1102864740 12:116365322-116365344 TCTTCCTCCTTCTTTGTGCCTGG + Intergenic
1102911225 12:116715598-116715620 GCCTCGCCCCTCTTTTGGCCTGG + Exonic
1103012645 12:117469122-117469144 TCCTCCCCCTTGTTTCTGGCTGG - Intronic
1103058777 12:117842357-117842379 GCACAGCCCTTCTTTCTGCCTGG - Intronic
1103137263 12:118518411-118518433 GCAACCCCCTTCTTCCTGCTTGG - Intergenic
1104373550 12:128244800-128244822 ACCTCCTTCTTCCTTCTGCCTGG + Intergenic
1104641604 12:130470663-130470685 GCGTGCCCCTGCTTTCTGCCCGG - Intronic
1104955439 12:132462971-132462993 CCCTCCCCCTTCCTGCTGACGGG + Intergenic
1106823727 13:33494535-33494557 ACCTCCCCCACCTTTCTGCATGG + Intergenic
1107054689 13:36090378-36090400 GCCATCCCATTCTGTCTGCCTGG - Intronic
1108573099 13:51769293-51769315 GCCTGACCCTTCCTTCTCCCAGG - Exonic
1109740663 13:66550532-66550554 CCCTCCACCATCTTTCTGCCAGG + Intronic
1110272698 13:73608796-73608818 GCCTGCCCATTCTCTCTGCCGGG + Intergenic
1112429766 13:99341235-99341257 GCCTCCACCTTCTTTACCCCTGG + Intronic
1113413344 13:110109208-110109230 GCTTTCCCCTTCTCTCTGCCGGG - Intergenic
1115697763 14:35919052-35919074 TCTTCCCCCTTCTCTCTCCCTGG - Intronic
1116331120 14:43598545-43598567 GTCTCCCCGTTCTCTCTGCTGGG - Intergenic
1116676504 14:47912609-47912631 GCCACCCCCTTATCCCTGCCTGG - Intergenic
1117765274 14:59075639-59075661 GCCCTGCCCTTCTTTGTGCCTGG - Intergenic
1118460382 14:65981701-65981723 GCCCCTGCCTCCTTTCTGCCAGG - Intronic
1118750949 14:68807567-68807589 GCCTCCTGCTCCTTCCTGCCTGG - Intergenic
1119032339 14:71202573-71202595 ACCACTCCCTTCTTTTTGCCTGG - Intergenic
1119104766 14:71913525-71913547 GCCTCCCACATCCTCCTGCCTGG + Intergenic
1119330535 14:73789993-73790015 GCCTACCCCTTCTGGCTGCCAGG - Intronic
1119365050 14:74084459-74084481 GCCTCGCCCTCCATCCTGCCAGG + Exonic
1119703060 14:76768251-76768273 GGCTCCCCCCTCTTCCTGTCTGG - Intronic
1119885738 14:78139870-78139892 CCTTCCTCCTTCTTTCTGCTGGG - Intergenic
1119886805 14:78150379-78150401 GCCTCCTCCACATTTCTGCCTGG + Intergenic
1121027556 14:90627636-90627658 TCCTCCCTCTTCTTTATGACAGG + Intronic
1121105269 14:91275154-91275176 GCCAGCCCCCTCTGTCTGCCTGG - Intronic
1121990392 14:98551581-98551603 GCCTCCCCCGAGTTCCTGCCTGG - Intergenic
1122017144 14:98805740-98805762 GCCTCCCCATCCTATCTGCAGGG - Intergenic
1122256634 14:100482945-100482967 GCCTCCTCCATGTTTCTGGCTGG + Intronic
1122817607 14:104321330-104321352 CCCCCCCCCATCTTCCTGCCGGG + Intergenic
1122853771 14:104550153-104550175 TCCTGACCCTTCTTCCTGCCTGG + Intronic
1122994384 14:105254986-105255008 GCCCCCCCCATCTCTCTTCCTGG + Intronic
1123106671 14:105845023-105845045 GCCCCTCCCTTCTTCCTGCTTGG - Intergenic
1124626043 15:31308110-31308132 GCTCCCTCCTTCTTTCTCCCGGG + Intergenic
1125732577 15:41901539-41901561 GCCTGCCCCTCCTTCCTCCCAGG - Intronic
1127995464 15:64151316-64151338 GCCTTTCCCTCCTTTCAGCCTGG - Intergenic
1128314209 15:66650095-66650117 CCCTGCCTCTTGTTTCTGCCTGG + Intronic
1128357544 15:66938688-66938710 GCCTTCTCCTTCTTCCTGCCTGG + Intergenic
1128594420 15:68930791-68930813 GCCTGGCCCTTCCTTCTCCCTGG + Intronic
1129664857 15:77573812-77573834 GTCCCTCCCTTCTTGCTGCCTGG + Intergenic
1130997017 15:88909574-88909596 GTTTCTTCCTTCTTTCTGCCTGG - Intronic
1132352130 15:101146437-101146459 TCCTTCCTCTTCTTCCTGCCTGG + Intergenic
1132389367 15:101427345-101427367 GCCTCCCCCGTCTTTCCACTTGG - Intronic
1132555149 16:568980-569002 GCCTCCCCCTTACCTCTGCCAGG - Exonic
1132598249 16:762842-762864 GCCTGCCCCTGCCTTCTCCCTGG + Intronic
1133191923 16:4140129-4140151 CCCTTCCTCTTCTTTCTGCCTGG + Intergenic
1133611662 16:7439385-7439407 GCCTCACCTTTCTTTCTGGGTGG + Intronic
1133972693 16:10578956-10578978 GCCCTCCCCTTCTTTCCACCTGG - Intronic
1134662253 16:15992920-15992942 GCCTGTGCCATCTTTCTGCCTGG + Intronic
1134680603 16:16122285-16122307 GCCTCTCCATCCTTTCTGCAAGG - Intronic
1135500269 16:22990148-22990170 GGCTCCCCCTTTTTTATGCTTGG + Intergenic
1136245207 16:28971521-28971543 GCCTTCCCCTTCTTACTTTCAGG - Intergenic
1137559097 16:49491881-49491903 TCCTCCCGCGTCTTCCTGCCGGG - Intronic
1138303094 16:55948988-55949010 GCCTCCCCATACTTTCTGGCTGG + Intronic
1139515664 16:67451085-67451107 GCCTCAAGCTTTTTTCTGCCTGG - Intronic
1139557285 16:67720230-67720252 GACTCTGCCTTCCTTCTGCCTGG - Intergenic
1140887659 16:79258979-79259001 GGATCTCCCTTCTTTCAGCCTGG - Intergenic
1141299725 16:82802778-82802800 GCCTCCCTCTTCAAGCTGCCAGG + Intronic
1141703671 16:85653492-85653514 GCCTCCTCCTGCTTTGTGCCTGG + Intronic
1141884483 16:86882419-86882441 TCCTGCCCTTTCTTTCTGCAGGG - Intergenic
1141913316 16:87075785-87075807 GGGGCCCCCTTCTTTCTGCTGGG - Intergenic
1142157486 16:88539262-88539284 GCCTCCACCCTCCTTCTTCCAGG + Intergenic
1142964689 17:3573279-3573301 CCCTCCCCCTTCTTCCCTCCAGG + Intronic
1143011032 17:3866264-3866286 CCCTCCCCACTCTTTCAGCCTGG - Intronic
1143016279 17:3892775-3892797 TCCTTCCCCTTCTGTCTGCGGGG - Intronic
1143309038 17:5973049-5973071 GCCTCCCTCTGCTGTCTGTCAGG + Intronic
1144635849 17:16908533-16908555 GCCTCTGCCTTCCTTCAGCCGGG + Intergenic
1144864830 17:18328766-18328788 GCCTCTCTCTTCCCTCTGCCTGG - Exonic
1145218987 17:21073179-21073201 CCTTCCCCCTTCTCTCTTCCTGG - Intergenic
1145755234 17:27385398-27385420 TCTTCCCTCATCTTTCTGCCTGG + Intergenic
1146623694 17:34419869-34419891 TCATCCCTCTTCTTTCTACCTGG + Intergenic
1146629354 17:34458807-34458829 GTCTCCCCCTCCTTTCTTCCCGG + Intergenic
1146974092 17:37096310-37096332 CCCTGCCCCTTCTTCCTACCAGG + Intronic
1147268952 17:39253364-39253386 GCCTCCTCCTTTTTTCTCCTAGG - Intergenic
1147467136 17:40619118-40619140 GGCTCCACCTCCTCTCTGCCGGG - Intergenic
1148154613 17:45415794-45415816 CCCTACCCTTTCTTTCTGCCTGG - Intronic
1148714069 17:49703099-49703121 GCCACCCTCTTCTTCCAGCCAGG + Intronic
1148998874 17:51736504-51736526 GCCTTCCCCTTTTTCCTGGCTGG + Intronic
1149672739 17:58429928-58429950 GCTTTCCCCTTCTTTTTGTCTGG - Intronic
1149855935 17:60082687-60082709 CCATCCCACTTCATTCTGCCTGG + Intergenic
1150640955 17:66949036-66949058 GCTTCCCCCTTCCTTATCCCTGG - Intergenic
1151384630 17:73747604-73747626 GCCTTCCTCCTTTTTCTGCCTGG + Intergenic
1151459501 17:74246097-74246119 TCCTTCCCCTTCCTTCTTCCAGG - Intronic
1151740558 17:75979216-75979238 GCCCGCCCCTTCTTTCTCCGTGG + Exonic
1152198283 17:78930229-78930251 GCCCCCACGTTCTTTCTGGCAGG + Intergenic
1152373657 17:79906311-79906333 GACTCCCCCATCCTTCTGCAGGG - Intergenic
1152761123 17:82107505-82107527 GCCTCTTCCTCCTTTCTGGCGGG - Intronic
1154122945 18:11666302-11666324 ACCTCCCTGGTCTTTCTGCCTGG - Intergenic
1155197709 18:23490387-23490409 CTCTTCCCCTTCTTCCTGCCTGG + Intergenic
1155435943 18:25813234-25813256 GCCTCCCCACTCTTTCTGTAGGG - Intergenic
1156119545 18:33825366-33825388 TCCTCCTCTTTCTTTGTGCCTGG - Intergenic
1157906884 18:51577178-51577200 GACTCCCCATTCATGCTGCCAGG + Intergenic
1158914148 18:62103421-62103443 GCCTACCCCTTCCCTCAGCCAGG - Intronic
1159025670 18:63180472-63180494 GCCTCCACCTTCTCTCTCCAGGG - Intronic
1160069271 18:75611101-75611123 GCATCCCGGTTCTCTCTGCCTGG - Intergenic
1160706764 19:533547-533569 GCCAGCCCCTTCTGTCTGCTTGG + Intronic
1160785854 19:900019-900041 GCCTCCCTTTTCTACCTGCCTGG - Intronic
1161329759 19:3680920-3680942 GCCTCCGCCTACTTTATGCCAGG - Intronic
1161391837 19:4025192-4025214 GCCTCCACCTGCTCTGTGCCAGG + Intronic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1162963850 19:14146151-14146173 ACCTACCCCATCTCTCTGCCTGG - Intergenic
1162974955 19:14203309-14203331 TCCACCCCCTCCTTTCTCCCTGG - Intronic
1163697676 19:18772205-18772227 GAATGCCCCTTCGTTCTGCCTGG + Intronic
1163825258 19:19519882-19519904 CCCACTCCCTTCTGTCTGCCTGG + Intronic
1164747988 19:30629971-30629993 TCCACTCCCTTGTTTCTGCCAGG + Intronic
1164772213 19:30818240-30818262 TCCATCACCTTCTTTCTGCCTGG + Intergenic
1166432149 19:42736999-42737021 TCCTCCCACTTCATTCTGACTGG - Intronic
1166435266 19:42762192-42762214 TCCTCCCACTTCATTCTGACTGG - Intronic
1166445130 19:42852218-42852240 TCCTCCCACTTCATTCTGACTGG - Intronic
1166448132 19:42876181-42876203 TCCTCCCACTTCATTCTGACTGG - Intronic
1166452531 19:42914395-42914417 TCCTCCCACTTCATTCTGACTGG - Intronic
1166455019 19:42933677-42933699 TCCTCCCACTTCATTCTGACTGG - Intronic
1166464812 19:43022961-43022983 TCCTCCCACTTCATTCTGACTGG - Intronic
1166470935 19:43079143-43079165 TCCTCCCACTTCATTCTGACTGG - Intronic
1166482091 19:43183063-43183085 TCCTCCCACTTCATTCTGACTGG - Intronic
1166484572 19:43202178-43202200 TCCTCCCACTTCATTCTGACTGG - Intronic
1166491692 19:43266058-43266080 TCCTCCCACTTCATTCTGACTGG - Intronic
1166561600 19:43736366-43736388 TCCTGTCCCTTCCTTCTGCCTGG + Intronic
1167311654 19:48740641-48740663 CCCTCCCCGCTCTTCCTGCCGGG - Exonic
1167562195 19:50232634-50232656 CCCTCCCCCATCTTTCTCCATGG - Intronic
1167853068 19:52216507-52216529 GCCTGCCTCTTCTCTCTCCCAGG + Exonic
1168094790 19:54108244-54108266 ACCTCCCCCTCCTGCCTGCCAGG - Exonic
1168133475 19:54336097-54336119 GCTGCTCCCTTCTTCCTGCCTGG + Intronic
1168267073 19:55228970-55228992 GCTTCCTCCTCCTATCTGCCTGG + Exonic
1168413858 19:56156793-56156815 GCTCCCCCCTTCTGTGTGCCTGG + Intronic
1168502678 19:56906555-56906577 CTTTCCCCTTTCTTTCTGCCTGG - Intergenic
925387455 2:3472078-3472100 CCGTCCCCCTTCGTCCTGCCTGG - Intronic
925555433 2:5125991-5126013 GCCCCCCCCTTCTCTCTCCAAGG - Intergenic
925977947 2:9154212-9154234 ACCTTTCCCTTCTTTCTTCCTGG + Intergenic
927091138 2:19713590-19713612 CCCTCCCTCCTCTTTCTTCCTGG - Intergenic
927730364 2:25465657-25465679 TCCTCCCCATTCCCTCTGCCTGG + Intronic
927791747 2:26015611-26015633 CCCTTCCCCTTCTTTCCTCCAGG - Intergenic
928326037 2:30320258-30320280 ATTTCCCCCTTCTTCCTGCCTGG + Intronic
929226661 2:39517727-39517749 ACCTCTCCCTTCTTTCTTGCTGG - Intergenic
930060240 2:47282522-47282544 CCCTCCTCCTTCCTGCTGCCTGG - Intergenic
931097471 2:58957453-58957475 CCCTCCTCCTTCTTCCTGCCTGG + Intergenic
933355217 2:81200946-81200968 GCCTCCCATTTCTTACTACCAGG + Intergenic
933836396 2:86249341-86249363 GCCTCCCCCTCCCCGCTGCCCGG + Intronic
934054765 2:88242263-88242285 GTCTCCCCCTTCTTCTTGGCAGG + Intergenic
934543753 2:95197631-95197653 GCCTTTTCCTTCTTTCTACCTGG + Intergenic
934708648 2:96501682-96501704 GCTTTCCCCTTCTGACTGCCAGG - Intronic
934901848 2:98165911-98165933 GGCTCCCCATTCTCTTTGCCGGG - Intronic
935641278 2:105292702-105292724 GCCTCCCCCCTTTTACTGTCTGG - Intronic
936013879 2:108943302-108943324 GCCTCCCCTCTGTTTCTCCCAGG - Intronic
936341165 2:111633771-111633793 GCTTCCCCCTTCGGCCTGCCCGG + Intergenic
937360890 2:121229320-121229342 ACCTCCCCCTTCTTTTCTCCTGG - Intronic
937913392 2:127087247-127087269 CCCTCCCCCTTCTTTCTCAGGGG - Intronic
938092841 2:128444576-128444598 GCCTCCCCCTCTTCTCTGCCAGG + Intergenic
939785479 2:146505795-146505817 GCCTCCATCTTCATTTTGCCTGG + Intergenic
940578219 2:155542123-155542145 TCCTGCTCCTTCTTCCTGCCTGG + Intergenic
942357584 2:175135090-175135112 TCCTCCCCCTTCTCCATGCCTGG - Intronic
943175763 2:184472043-184472065 TCCTCCTCCTTCTTACTGCTTGG - Intergenic
944147235 2:196518850-196518872 TCCTCACCAGTCTTTCTGCCAGG + Intronic
944699954 2:202238146-202238168 TCGTCCCACTTCTTTCTCCCGGG - Intronic
946227162 2:218270174-218270196 GCCTACGCCTACTTCCTGCCGGG - Exonic
946717327 2:222566382-222566404 GCGTTGCCCTTCTTGCTGCCTGG + Intergenic
948254090 2:236553261-236553283 TCCTCCACCTACTGTCTGCCTGG - Intergenic
948408716 2:237742750-237742772 GACTCCCCGGTCCTTCTGCCTGG + Intronic
948588742 2:239036571-239036593 GCCCCCTCCTGCTTCCTGCCTGG + Intergenic
948903267 2:240966594-240966616 GCCGCCCCCTTCCTTATACCAGG + Intronic
948922187 2:241071020-241071042 GCCTGCCCCTTCTGCCTGGCTGG - Intronic
1168895198 20:1319423-1319445 GCCACCCACCTCTTACTGCCTGG - Intronic
1169083823 20:2815086-2815108 AGCTCACCCTTCTGTCTGCCCGG + Exonic
1170292476 20:14785882-14785904 TGCTCCCCCTTTTTTCTTCCTGG - Intronic
1170894811 20:20403522-20403544 GCCTCCTCCTTCCTTCTCCGTGG + Intronic
1171386215 20:24770872-24770894 TCCTCCCCCTTCCTTCTCCATGG + Intergenic
1172185698 20:33029800-33029822 CCTTCCTCCCTCTTTCTGCCTGG - Intergenic
1172291191 20:33778253-33778275 ACCTTCCCTTTCTTGCTGCCTGG + Intronic
1173494570 20:43509228-43509250 CCCTCCCCTTTCTCTCTGACAGG + Intronic
1173749704 20:45467896-45467918 TCCTTCCCCATCCTTCTGCCTGG + Intergenic
1173807991 20:45938744-45938766 CCCTCCCCCTCTTCTCTGCCTGG - Intronic
1173828517 20:46062889-46062911 ACCTCCCTCTTCTGTCTTCCAGG - Exonic
1173875162 20:46365725-46365747 TCCTCCCTCTTCTCCCTGCCAGG - Intergenic
1175127718 20:56764807-56764829 GCCTGCCTCATCTTCCTGCCTGG - Intergenic
1176122783 20:63461651-63461673 GCCTCCTCCTCCCTGCTGCCTGG - Intronic
1176122794 20:63461684-63461706 GCCTCCTCCTCCCTGCTGCCCGG - Intronic
1178906688 21:36642595-36642617 GCCTTCCCCTGCTTCCAGCCAGG + Intergenic
1178983502 21:37284191-37284213 GCCTGCCTCTTCTTCCTGCAGGG - Intergenic
1179364017 21:40738962-40738984 TGCTCCCCCTTCTTCCTGCAGGG - Intronic
1179937873 21:44616521-44616543 GCCTCCTCCTCCTCCCTGCCAGG + Intronic
1181348829 22:22240980-22241002 GCCTAACACTTGTTTCTGCCGGG - Intergenic
1181497622 22:23296406-23296428 CCCTCTCCCTTCATTCTTCCTGG - Intronic
1181728805 22:24830064-24830086 GCCTCCTCTTTCTTCCTGCATGG + Intronic
1181792036 22:25275800-25275822 GCCTCCCTCTCCTTTCTGCTTGG - Intergenic
1181827676 22:25531623-25531645 GCCTCCCTCTCCTTTCTACTTGG - Intergenic
1181992643 22:26849242-26849264 TCATCTCCCATCTTTCTGCCTGG - Intergenic
1183419278 22:37701284-37701306 GCCTCCCCCTCATTTTTGCCAGG + Exonic
1184066464 22:42124498-42124520 GGATCCCTCTTCTTCCTGCCAGG + Intergenic
1184068932 22:42136650-42136672 GGATCCCTCTTCTTCCTGCCAGG + Intergenic
1184106737 22:42371745-42371767 CCCTCCTCCCTCTTCCTGCCTGG + Intergenic
1184339844 22:43880240-43880262 TCCTCCTCCTGCTTCCTGCCAGG + Exonic
1184450982 22:44582638-44582660 GCTTTTCTCTTCTTTCTGCCTGG - Intergenic
1184535887 22:45086442-45086464 GCCTCCACCTACTACCTGCCAGG + Intergenic
1184698404 22:46151866-46151888 TCCTTCACCTTCTTACTGCCAGG + Exonic
1184789121 22:46688511-46688533 GCGCCCCCTTTCTTTCTGTCAGG - Intronic
1184998390 22:48226996-48227018 GCCGCCACGTTCTTTCTCCCAGG + Intergenic
1185105992 22:48870232-48870254 TCCTCCCCCTGCCTCCTGCCAGG + Intergenic
1185418750 22:50723451-50723473 GACTCCTGCTTCTTGCTGCCTGG + Intergenic
949182167 3:1145372-1145394 GCCTCCACCTTCTTGCTCCAGGG - Intronic
949500902 3:4679200-4679222 GCCTTCATCTACTTTCTGCCTGG - Intronic
949562950 3:5219577-5219599 CCCTCTTCCTTCTTTCTGCAAGG + Exonic
949694341 3:6677018-6677040 TCCTCCCCTTTCTGTCTTCCTGG + Intergenic
950182999 3:10928215-10928237 GCCTCTCCCTCCTCTGTGCCAGG + Intronic
950377294 3:12582017-12582039 GCCTACCCCATTTCTCTGCCAGG - Intronic
950457561 3:13101713-13101735 GCCTCCTCCATGTTTCTACCTGG - Intergenic
951081117 3:18451039-18451061 CTCTCCCTCCTCTTTCTGCCTGG - Intergenic
951203225 3:19897518-19897540 ACATCTCCCATCTTTCTGCCAGG + Intronic
951882829 3:27496222-27496244 GGCTCCCTCTTTATTCTGCCAGG - Intergenic
953260003 3:41328739-41328761 GCCTCACCCTTACTTCTGCCTGG - Intronic
953370541 3:42384345-42384367 GCCTATCCCTTCTTTCTTCTTGG - Intergenic
954149016 3:48648000-48648022 GCCTCCCCTTTCTTTCTCCTGGG - Intronic
954328952 3:49878872-49878894 GCCTCCTCCCTCTGTCTGGCAGG + Intergenic
954334084 3:49906067-49906089 GACTCCCCCTCCTTCCAGCCTGG + Intronic
954392158 3:50273527-50273549 GCCGCCCACGTCGTTCTGCCGGG - Exonic
954852209 3:53612765-53612787 GACTGCCCCAGCTTTCTGCCTGG - Intronic
955522272 3:59786354-59786376 CCCTCCTCTTTCTTTCTACCTGG + Intronic
955580278 3:60412418-60412440 TCATCTCCCTTCTGTCTGCCAGG + Intronic
956426899 3:69145193-69145215 CCCTCCTCCTTTTTTCTGCCTGG - Intergenic
958993327 3:100873049-100873071 GCCTTCCTCTTCCTTCTTCCAGG + Intronic
959388913 3:105748537-105748559 GCTTCTCCCTTCCTTCTCCCTGG - Intronic
960264536 3:115605340-115605362 GCCTTCCCTTTCTTTTTGTCAGG - Intergenic
960639951 3:119814957-119814979 CCCTCCCCATCCTTGCTGCCAGG + Exonic
961453994 3:127015379-127015401 GCATGCCCCTTCTTGTTGCCTGG + Intronic
961467485 3:127090493-127090515 GCATCTCCCTTCTTCCTCCCTGG - Intergenic
961560022 3:127722326-127722348 GCCCCCCACTGCTCTCTGCCTGG - Intronic
962462922 3:135631211-135631233 CCCTTCCCCTTCTTTGTGCCTGG - Intergenic
962860356 3:139394091-139394113 TCCTCCCCCTTCTTACTCTCTGG - Intergenic
963293429 3:143518030-143518052 TCCTCCACCTTCTTACTGTCAGG + Intronic
963662300 3:148142203-148142225 TCCTCCCCCTGCTCTCTGACAGG - Intergenic
965693442 3:171381808-171381830 CCCTCCTCCTTCCTGCTGCCTGG + Intronic
967986692 3:195100566-195100588 GCCTCCTCCTCCTCTCTCCCTGG + Intronic
968228034 3:196988219-196988241 ACCTCCTCCGTCTTTCTGCAGGG + Intergenic
968675655 4:1877565-1877587 CCCTCTTCCTTCCTTCTGCCAGG + Intronic
969365919 4:6694236-6694258 GCCTCCCCTGCCTTTATGCCAGG - Intronic
969447107 4:7251688-7251710 CCCATCCCCTTCTTCCTGCCTGG - Intronic
969533389 4:7741509-7741531 TCCTCCCCCTCCTCTCTGGCAGG + Exonic
970503523 4:16703195-16703217 GCCTCCCCTTACTTTTTACCAGG - Intronic
970930457 4:21505528-21505550 GCTTCCCTCTCTTTTCTGCCTGG + Intronic
973017441 4:45158935-45158957 TCCTCCCCCTTCTTAGTCCCTGG + Intergenic
973783426 4:54312733-54312755 TCTTCCCATTTCTTTCTGCCTGG + Intergenic
977684864 4:99836325-99836347 CACACCCCCTTCTTTCTGTCTGG + Intronic
977745575 4:100542759-100542781 TCCTCACCTTTCTTTCTGCCTGG + Intronic
978368116 4:108003778-108003800 GCCCCCTTCTTCTTTCTGCAAGG - Intronic
979354937 4:119691907-119691929 TCCTCCCAGATCTTTCTGCCTGG - Intergenic
979439242 4:120731715-120731737 GCCTCCTCCTTCCTGTTGCCTGG + Intronic
981243431 4:142506428-142506450 GCCTAACCCTTCTTTCTTCTAGG - Intronic
982767365 4:159364448-159364470 GCCTCACCCTCCATCCTGCCTGG - Intergenic
983394334 4:167174499-167174521 GCCTCCTCCTTGTTTCAACCCGG - Intronic
984482871 4:180328267-180328289 GCCTCCCCCTTCATTTTTCTTGG + Intergenic
985690820 5:1311312-1311334 ACCTCCCCCTTTTTTCTGAGTGG - Intergenic
986670001 5:10134360-10134382 TCTTCCACCTTCTTCCTGCCTGG - Intergenic
987659350 5:20852699-20852721 GCTTCCTCACTCTTTCTGCCTGG - Intergenic
988215319 5:28264418-28264440 CCATTCCCCTTCTTTATGCCTGG - Intergenic
988764297 5:34352951-34352973 GCTTCCTCACTCTTTCTGCCTGG + Intergenic
990598293 5:57332670-57332692 TCCACCACTTTCTTTCTGCCAGG - Intergenic
992406228 5:76460288-76460310 GCTCCACCCTTCTCTCTGCCTGG - Intronic
992768669 5:80027097-80027119 CCCTTCTCCTTCTTTCTTCCTGG + Intronic
994953498 5:106497272-106497294 GCCTCACTCCTCTTTCCGCCTGG + Intergenic
995551583 5:113287066-113287088 TCCTCCCCCATATATCTGCCCGG - Intronic
995717299 5:115092733-115092755 GGCTCCCCATTGTTCCTGCCTGG + Intergenic
998515096 5:142745883-142745905 GTGTCCCCCTTCTCTTTGCCAGG - Intergenic
999697159 5:154197344-154197366 GCTTCCACGTTTTTTCTGCCTGG + Intronic
1001708408 5:173758857-173758879 GCTTGCCCCTTCTTGGTGCCAGG - Intergenic
1002600191 5:180350046-180350068 GCCACCCCCTCCTCTCTGCAGGG + Intronic
1002884201 6:1279389-1279411 GCCTCCAGTTTCTGTCTGCCGGG + Intergenic
1002960322 6:1908192-1908214 CCATCCCACTTCGTTCTGCCCGG - Intronic
1005788404 6:29270943-29270965 GCCACCCCTTTCTTTCTTCCAGG - Intergenic
1006627570 6:35408177-35408199 GCCCCTCCCATCTTCCTGCCTGG - Intronic
1006719196 6:36139109-36139131 GCTTCCTCCATCTTTGTGCCTGG + Intronic
1007191290 6:40021118-40021140 GCCTCCTCCTGCTTCCTTCCTGG - Intergenic
1007605108 6:43112453-43112475 ACCTCCTCCATCTGTCTGCCAGG + Intronic
1007751360 6:44073690-44073712 CGCTCCCGCTTCTTTCTGCGAGG + Intergenic
1007777818 6:44233573-44233595 TCCTGCCCCTTCCTTCTGCCAGG + Exonic
1007924841 6:45642633-45642655 GTCTCCCCCTTCTTCCTGGTGGG - Intronic
1008879554 6:56367238-56367260 GCCTCTCCCTTCCTCCTGGCTGG + Intronic
1009721907 6:67482663-67482685 TCCTCCTCCTTCTTTTTTCCAGG + Intergenic
1011395018 6:86897295-86897317 TCCTCCACCTTCTTACTGTCAGG - Intergenic
1011933236 6:92739733-92739755 ACCTCCCCCTTTTCTCTCCCTGG + Intergenic
1012501198 6:99889666-99889688 CCCATCCCCTTCTTTCTGCCTGG - Intergenic
1012626961 6:101416362-101416384 GCCTCTCCCTGCTTGCTTCCTGG + Intronic
1012840643 6:104325029-104325051 TCGTCTCCCTTCTTTCTCCCTGG - Intergenic
1013070895 6:106728376-106728398 GGCTCTACCTCCTTTCTGCCTGG - Intergenic
1013449586 6:110266528-110266550 GCCTCCTCCTCCTTTCCTCCAGG + Intronic
1014227538 6:118864878-118864900 TGCAGCCCCTTCTTTCTGCCTGG + Intronic
1014829345 6:126083271-126083293 CTCTAACCCTTCTTTCTGCCTGG + Intergenic
1015111484 6:129596757-129596779 GCCCCCTCCTTCATTCTGTCTGG - Intronic
1015583425 6:134751109-134751131 CCTTCCCCGTTCTTTCTTCCTGG - Intergenic
1016738779 6:147507820-147507842 ACCCCACCCTCCTTTCTGCCCGG - Intergenic
1017085374 6:150708326-150708348 TCCTTCCCCTTCTCTCTCCCAGG + Intronic
1018186695 6:161271372-161271394 GCCTCCCCCTTCCTTCCAGCTGG + Intronic
1018230065 6:161666784-161666806 GCCTCTCACTGCTTTCTTCCAGG - Intronic
1019346216 7:531972-531994 GCTTCCCCCTGCTCTCTGCGTGG - Intergenic
1019789435 7:3001349-3001371 GCCTCCCCTTTCTTTCCCCATGG - Intronic
1019924424 7:4182741-4182763 GCCTCTCCCTCCCTACTGCCAGG - Intronic
1024426024 7:49227367-49227389 GTCTCCTCCTTCTCTCTGGCCGG + Intergenic
1024919821 7:54545112-54545134 CCCTCCCCCTCCTTTCGTCCTGG - Intronic
1026116616 7:67501318-67501340 TCTTCCTCCTTCTTCCTGCCTGG - Intergenic
1029439289 7:100578316-100578338 GGCACCCCCTGCTTTCTGGCAGG - Intronic
1029956636 7:104647237-104647259 GCCTCTCCCTTTTTTCAGACAGG + Intronic
1030707329 7:112707435-112707457 CCCTTTCCCTTCTCTCTGCCTGG + Intergenic
1031529237 7:122856035-122856057 CCTTCCCCCTTCCTTCTGCCTGG + Intronic
1031530001 7:122864866-122864888 TCTTCCCCCTTCTTACTGGCTGG - Intronic
1032481969 7:132254672-132254694 GCTTCCCGCTTCCATCTGCCAGG + Intronic
1032588914 7:133174603-133174625 TCCTCCCACTTCTGTCTCCCAGG + Intergenic
1032740027 7:134729611-134729633 GGGCCTCCCTTCTTTCTGCCTGG + Intergenic
1032884101 7:136119379-136119401 GCCCCTCCCTCCTCTCTGCCAGG + Intergenic
1033258994 7:139826125-139826147 GCCACCCCCTCCATGCTGCCGGG + Intronic
1033290620 7:140079676-140079698 TGCTCACCCTGCTTTCTGCCAGG + Intergenic
1034165609 7:149022799-149022821 GCTGCCCCCTTCTCCCTGCCCGG - Intronic
1034441765 7:151089267-151089289 GTCCCCACCTTCTTTCTGCGAGG + Intronic
1035140118 7:156751337-156751359 TCCTCCACCTTCTCTCTTCCAGG - Intronic
1035289732 7:157830138-157830160 GCCAGCCCCTCCTTTCTTCCAGG - Intronic
1035520716 8:273679-273701 GCCTCCCACTTCTGGCTCCCGGG - Intergenic
1036088399 8:5638064-5638086 GACTCTCCCTTCTATCTCCCAGG + Intergenic
1036190960 8:6670545-6670567 GCCTCCTCCATTTTTTTGCCAGG + Intergenic
1036771377 8:11580540-11580562 GCCTCCTCCTTCTATGGGCCTGG - Intergenic
1038544859 8:28418014-28418036 GCATCACCCTTCTTGCTTCCAGG + Intronic
1039583032 8:38682399-38682421 GGCTCCCCCTCCTTTCAGCGCGG - Intergenic
1040634962 8:49262454-49262476 CCTTCCCCTTTCTTTCTGCGTGG + Intergenic
1041299975 8:56401260-56401282 GCCTTCCCCTTCTTCCTGGTTGG - Intergenic
1041919687 8:63168293-63168315 GCCTCGGCCATCTTCCTGCCCGG + Intergenic
1042834687 8:73068810-73068832 GCCTACCCCTTCTTTGTGTCTGG + Intronic
1043549099 8:81348793-81348815 TCTTCCTCCTTCCTTCTGCCTGG - Intergenic
1044300274 8:90575559-90575581 TATTCCCTCTTCTTTCTGCCAGG + Intergenic
1045525800 8:102940458-102940480 CCCTCCCCCATCTTCCTCCCTGG + Intronic
1047470322 8:125165084-125165106 GCCTCCTCCTTGTTCCTCCCTGG + Intronic
1048509450 8:135049136-135049158 GCCTGCCTCTTCTCTCTCCCAGG + Intergenic
1048978035 8:139683973-139683995 GCCCCCTCCTTCTTCCTGCCTGG + Intronic
1049419454 8:142510541-142510563 GCCTCCCCCTCCTTCCCGCGCGG + Intronic
1049651446 8:143771649-143771671 TCCTCCCCCTGCCTCCTGCCTGG - Intergenic
1051197247 9:14576206-14576228 CACTGCCCATTCTTTCTGCCTGG + Intergenic
1052964848 9:34332269-34332291 GCATCCGCCTCCCTTCTGCCTGG + Intronic
1054791421 9:69260193-69260215 GCCCTCCCCTCCTTTCTTCCAGG - Intergenic
1057678989 9:97158762-97158784 GCCTCCCCATTCTTATTTCCCGG + Intergenic
1057835689 9:98443216-98443238 GCCTCCTCTTTGTTTCTCCCAGG + Intronic
1057935634 9:99236398-99236420 GCCTCTCTCTTCCTTCTGCTCGG + Intergenic
1060703332 9:125778705-125778727 GTCTCCCCCTGCTCTTTGCCCGG + Intronic
1061321874 9:129835758-129835780 GCCCCCCTCTCATTTCTGCCGGG + Intronic
1061433857 9:130548190-130548212 GCCTGTCCCTTCTCTCTCCCAGG - Intergenic
1061801373 9:133115052-133115074 GCTTCCTCCTTCTGTCAGCCAGG - Intronic
1061996686 9:134189776-134189798 GCCACCCCCTTCAGACTGCCAGG - Intergenic
1062389027 9:136326854-136326876 GCCTGCCCCTTCCTTCCTCCTGG - Intergenic
1185644833 X:1609274-1609296 GCCGCCCCCTCCGTTCTCCCAGG - Intergenic
1186514797 X:10158803-10158825 CCCTCCCCCGTCTTTCTGTCTGG - Intronic
1187403925 X:18985006-18985028 GCCTTCCCCCTTTTTCTTCCGGG - Intergenic
1188111376 X:26198824-26198846 GCCTGCCACAGCTTTCTGCCTGG + Intergenic
1188483273 X:30655387-30655409 CCTTCCCCCTTCTACCTGCCTGG - Intronic
1189273006 X:39764868-39764890 GACTCCCTCTTCTCTCTGCAGGG - Intergenic
1189435000 X:40984728-40984750 GCCTCCCCCTTCTTTTTTTCAGG + Intergenic
1189725975 X:43968699-43968721 CCCTCTCCCTTCATGCTGCCAGG + Intronic
1190339721 X:49286770-49286792 GCCTCTCCCGTCCTTCTGCAGGG + Exonic
1192050068 X:67716648-67716670 GCGTCCATCCTCTTTCTGCCTGG - Intronic
1192237029 X:69302523-69302545 GCCTCCCTCTGCTCTCTGCTGGG + Intergenic
1193998431 X:88395527-88395549 GCTTTTCCCTTCTTTCTGCCTGG - Intergenic
1197251200 X:124217995-124218017 GCCTCAGCCTTCTGTCTTCCGGG + Intronic
1198092574 X:133346171-133346193 GCCTTCCCCCTTTTTCTGCATGG - Intronic
1198750586 X:139933125-139933147 CCCTCCCCCTCCTTGCTCCCGGG + Intronic
1199244999 X:145593663-145593685 GCCCCTCCCCTCATTCTGCCTGG + Intergenic
1200032394 X:153306999-153307021 GCCTCCCCCTACAGTCAGCCCGG - Intergenic