ID: 915313439

View in Genome Browser
Species Human (GRCh38)
Location 1:155015832-155015854
Sequence AAGGGCCCGGCAGGGGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 1, 2: 0, 3: 19, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915313424_915313439 25 Left 915313424 1:155015784-155015806 CCTGCGAGGTCTGCGGTGTTCGA 0: 1
1: 0
2: 0
3: 0
4: 20
Right 915313439 1:155015832-155015854 AAGGGCCCGGCAGGGGCCATGGG 0: 1
1: 1
2: 0
3: 19
4: 208
915313431_915313439 -2 Left 915313431 1:155015811-155015833 CCAGGTGAGCAGCAAGGGGGGAA 0: 1
1: 0
2: 1
3: 12
4: 242
Right 915313439 1:155015832-155015854 AAGGGCCCGGCAGGGGCCATGGG 0: 1
1: 1
2: 0
3: 19
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915313439 Original CRISPR AAGGGCCCGGCAGGGGCCAT GGG Intronic
900192816 1:1358643-1358665 AGGGGCCCGGCAGGAGCCAGAGG - Intronic
900312677 1:2041744-2041766 GAGTGCCCTGCAGGGGCAATGGG - Intergenic
900335572 1:2161350-2161372 AGGGGCCTGGCAGGAGCCAGGGG + Intronic
900460794 1:2801356-2801378 AAGGGCCTGGCAGGTGCTCTCGG - Intronic
900699285 1:4034115-4034137 CAGGGCCAGGCATGGGGCATGGG + Intergenic
903458983 1:23507833-23507855 AAGGGGCCTGCAGGACCCATTGG - Exonic
904341120 1:29835583-29835605 AGAGGACCAGCAGGGGCCATGGG + Intergenic
904533289 1:31182641-31182663 CAGGGCCCGGCAGGGGGCGGAGG - Intronic
904896386 1:33821345-33821367 AAGGAACAGGCAGGGGCCAAAGG - Intronic
905168949 1:36098785-36098807 CAGGGCCCATCAGGGGCCAAAGG - Exonic
905182271 1:36174846-36174868 CCGGGCCCGGCAGGAGCCAGTGG - Intronic
905224832 1:36472283-36472305 AGTGGCCAGGCAGGGGCCAGCGG + Exonic
911114890 1:94237208-94237230 AAGGGTCCGGCCGGGGCTAGGGG - Intronic
911115998 1:94247453-94247475 CAGGGTCCGGCAGGGGCTAGGGG - Intronic
913287624 1:117241230-117241252 CAGGGCCAGGCAGGGTCCAGTGG - Intergenic
913623641 1:120637259-120637281 AGGGGCCTGTCAGGGGCCGTGGG - Intergenic
914747214 1:150509497-150509519 AAGGGCAAGTCAGGGGCCACTGG - Intronic
915313439 1:155015832-155015854 AAGGGCCCGGCAGGGGCCATGGG + Intronic
916488308 1:165278893-165278915 CAGGACCCCGCAAGGGCCATGGG + Intronic
917843672 1:179002906-179002928 AAGGCCCCGGCACGGTCCTTTGG + Intergenic
918141871 1:181726592-181726614 AAGGGCCAGGGAGGGGGCAGGGG + Intronic
918251636 1:182708347-182708369 AAGGACACTGCAGGGGCCAGCGG - Intergenic
918482322 1:184991970-184991992 AGGGGCCCGGCAGGGCCCGGTGG - Intergenic
920300308 1:204984591-204984613 AGGAGCCCAGTAGGGGCCATTGG - Intronic
1062767986 10:80067-80089 AAGGGCCAGCCAGGGCCCAGTGG - Intergenic
1069894531 10:71672344-71672366 CAGGGCCTGTCAGGGGCCCTGGG - Intronic
1070796189 10:79218087-79218109 AAGGGCCAGACAGGGGCTTTTGG + Intronic
1070890971 10:79942025-79942047 CAGGGCTCGGCAGGGGCAAGAGG - Exonic
1071346285 10:84696963-84696985 AAGGGCACGTCTGAGGCCATAGG - Intergenic
1075719168 10:124574948-124574970 GAGGGCCCGGCAGGAGGCAGAGG - Intronic
1076280396 10:129241943-129241965 AAGGGCCCGTGAGGGGGCGTGGG - Intergenic
1076487889 10:130836012-130836034 ATGGGCCAGGCATGGGCCAGGGG - Intergenic
1077107451 11:848306-848328 AAGGACAGGGTAGGGGCCATGGG + Intronic
1077410786 11:2403037-2403059 AAGGCCTGGGCAGGGCCCATCGG + Exonic
1084490597 11:69476314-69476336 AGGGGCCAGGCAGGAGCCAAGGG - Intergenic
1084491991 11:69483951-69483973 AAGGGCCCCGCAGGGGCAGGCGG + Intergenic
1085157763 11:74311722-74311744 ACGGGCCGGGCCGGGGCCAGAGG - Intergenic
1085339325 11:75721037-75721059 AAGGGACAGGCAGGGGCAGTTGG + Intronic
1085703362 11:78764576-78764598 CAGGGCCCATCAAGGGCCATGGG + Intronic
1087451931 11:98334710-98334732 CAGGGACTGGCAGGGGCAATGGG - Intergenic
1088237527 11:107741686-107741708 AGTGGCCAGGCAGGGGCCTTGGG + Intergenic
1088813748 11:113408107-113408129 AAGGGCAGGGCAGGGGACAAGGG + Intergenic
1088814122 11:113410032-113410054 AAGGGCCCAGGAGGGTCTATGGG - Exonic
1088945069 11:114503916-114503938 CAAGGCCAGGCTGGGGCCATGGG - Intergenic
1089358715 11:117872659-117872681 ACGGACCAGGCTGGGGCCATGGG - Intronic
1089565441 11:119368847-119368869 AAGGGCTGGGCAGAGGCCAGCGG + Intronic
1089899186 11:121963368-121963390 AAGGGCTGGGCAGGGCCCGTGGG + Intergenic
1091054909 11:132408765-132408787 AAGAGCCAGGCAGGGACAATGGG + Intergenic
1096539234 12:52295530-52295552 CAGGGCCCTGCAGAGGGCATGGG - Intronic
1103601742 12:122058847-122058869 TAGGGTCAGGCAGGGGCCAGGGG + Intronic
1103704823 12:122865836-122865858 CAGGGCCCAGCAGGGGGCAGTGG - Exonic
1103940792 12:124500229-124500251 CAGGGGCCAGCAGGGGCCCTGGG - Intronic
1104059000 12:125252216-125252238 AAGGGCCCGGAGGAGGCAATGGG + Intronic
1104781350 12:131422386-131422408 AATGGCCCAGCAGCGGGCATGGG - Intergenic
1105278374 13:18949148-18949170 CAGGGCCCGGGAGGTGGCATTGG - Intergenic
1105799624 13:23891962-23891984 AAGGGGCTTGCAGGGCCCATGGG - Exonic
1105849422 13:24321073-24321095 AAGGGGCTTGCAGGGCCCATGGG + Exonic
1108578922 13:51812166-51812188 AGTGGACCGGCAGGGGCCGTGGG - Intergenic
1112577343 13:100647283-100647305 GAGTGGCCGGCAGGGGCCAGGGG - Intronic
1113292178 13:108919237-108919259 AAGGGCCCAGCCAGGGCCATGGG - Intronic
1121566540 14:94914364-94914386 AAGGGCTGGGCAGTGGCCCTTGG + Intergenic
1122262013 14:100529129-100529151 AAGGGCCAGGTAGTTGCCATTGG - Exonic
1122370258 14:101225588-101225610 AAGGGCCCCCCGGGGGCCGTGGG + Intergenic
1122757871 14:103997058-103997080 AGGGGCCATGCAGGGCCCATAGG + Intronic
1123106950 14:105846131-105846153 AGCTGCCCTGCAGGGGCCATGGG + Intergenic
1123923956 15:25090448-25090470 CAGGACCCTTCAGGGGCCATGGG - Intergenic
1123944492 15:25232505-25232527 AGGGGCCCTGCAGGGGGCTTCGG - Intergenic
1128656684 15:69467763-69467785 CAGGGCCCAACAGGGGCCCTGGG - Intergenic
1129412970 15:75359982-75360004 AAGGAGCCTGCAGGGGCCAAGGG + Exonic
1130533263 15:84764099-84764121 GAGGGCCAAGCAGGGGCCAGGGG - Intronic
1132039642 15:98514183-98514205 AAGAGCCCGCCAGGAGCCACGGG + Intronic
1132696122 16:1202744-1202766 CGGGGCCAGGCAGGGGCAATGGG - Intronic
1132873276 16:2124887-2124909 CGGGGCCTGGCAGGGGGCATGGG - Intronic
1133099519 16:3470645-3470667 AACGGCAGGGCAGGGGCCAGTGG + Intronic
1133267355 16:4593189-4593211 AAGGGCACAGCAGGGGCTGTGGG - Intronic
1133608773 16:7413590-7413612 AAGGGGCAGGCAGGGGGCAGGGG - Intronic
1134552363 16:15144066-15144088 CGGGGCCTGGCAGGGGGCATGGG - Intergenic
1135490424 16:22904712-22904734 CAGAGCCCAGGAGGGGCCATGGG + Intronic
1137592584 16:49702766-49702788 AAGGGCCAGGCTGGGGCCCTGGG + Intronic
1139421922 16:66854266-66854288 AAGGGCAGGGAAGGGGCTATGGG + Intronic
1140221184 16:73045497-73045519 AAGAGCCAGGCAGGGGCCTGTGG + Intronic
1141842571 16:86583592-86583614 CAGGGCTAGGCAGGGGCCACAGG + Intergenic
1142136225 16:88453179-88453201 CAGGGCCCGGCAGGAGGCACGGG + Intergenic
1142218214 16:88840261-88840283 AGGGGACCGGCAGGAGCCACAGG + Intronic
1142319886 16:89374523-89374545 CAGCGGCCGGCAGAGGCCATCGG - Intronic
1142414195 16:89932512-89932534 AAGGGCCTGGCTGGGGCTATGGG + Intronic
1142622437 17:1173405-1173427 AAGGGCCTGGCAGGGGCAGTGGG + Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1143779498 17:9221905-9221927 GAGGGCCCCGCAGTGGCCAGCGG + Intronic
1144638429 17:16925099-16925121 AGTGGACAGGCAGGGGCCATGGG - Intergenic
1144778686 17:17797296-17797318 AAAGGCCGGGCAGGGGCCCATGG + Exonic
1145910097 17:28537371-28537393 GAGGGGCCTGCAGGGGCCGTGGG - Exonic
1147556253 17:41481030-41481052 AAGAGCCCAGGAGGGGCCAGTGG - Exonic
1147583187 17:41638292-41638314 AAGGGCCCTGCAGGTGACAGGGG - Intergenic
1147632034 17:41938465-41938487 GAGGGCCCTGCAGCGGCCACCGG + Intronic
1148453178 17:47794320-47794342 AAGGGACCGGCAGGGGTGAGTGG + Intergenic
1152419389 17:80183939-80183961 GAGTGCCTGGCTGGGGCCATCGG + Exonic
1153881772 18:9427483-9427505 AAGGCCAAGGAAGGGGCCATGGG - Intergenic
1154138615 18:11802860-11802882 AAGGGCACGGCAGTGGCCCAAGG + Intronic
1154412271 18:14147923-14147945 AAGGGCCCGGCAGGGTGCAGGGG + Intergenic
1156475101 18:37400990-37401012 TTGGGCCTGGCAGGGGCCCTGGG + Intronic
1160217072 18:76941405-76941427 AGGGGCCAGGCAGGAGCCAGAGG - Intronic
1160386602 18:78500657-78500679 TAGGGCCTGGCAGGCGCCACAGG - Intergenic
1160882089 19:1325522-1325544 AAGGGCCCGGCCGTGGGCTTGGG + Intergenic
1161067347 19:2245302-2245324 AGGGGCCTGGGAGGGGCCCTGGG - Intronic
1161380239 19:3960982-3961004 GAGGGGCCGGCAGGGGGCACGGG - Intronic
1162322517 19:9978581-9978603 AAGGGCCCCCCAGGGCCCGTGGG - Exonic
1162502388 19:11061309-11061331 AAGGGCCAGGCAGGTGACATGGG + Intronic
1162833475 19:13301389-13301411 CAGTGCATGGCAGGGGCCATCGG - Intronic
1163085882 19:14979593-14979615 AAGCGCCCGGCCGGGGCCGCGGG + Intronic
1163125793 19:15243526-15243548 AAAGGCCAGGCTGGGGCCACAGG - Intronic
1163314975 19:16535549-16535571 ATGGGCGCGGCGGGGGCCAGCGG + Exonic
1163655508 19:18543122-18543144 GAGGGCCCGGCCGGGGCTGTGGG - Intronic
1163688377 19:18725176-18725198 AGGGGCCAGGCAGGGGCACTAGG - Intronic
1165040472 19:33064706-33064728 CCGGGCCCTGCAGGGGCCGTGGG - Intronic
1165094700 19:33403722-33403744 AAGTGCCCGGCTGGGGACTTTGG - Intronic
1166046417 19:40233320-40233342 CAGGGGCAGGCAGGGGCCCTTGG - Exonic
1167113090 19:47473409-47473431 AAGGGCCAGGCAGGTGGCCTGGG + Intergenic
925494018 2:4426163-4426185 CAGGGCTGGGCAGGGGCCAAAGG - Intergenic
930155681 2:48105554-48105576 AAGGGGCAGGCAGGGTCCCTGGG + Intergenic
932773392 2:74513944-74513966 AAGGGGACGGCAGGGGCTAAGGG - Intronic
932856674 2:75241330-75241352 AATGGCCAGGCAGGGGTCCTGGG - Intergenic
934056039 2:88252600-88252622 GAGGCCCTGCCAGGGGCCATGGG - Intergenic
934079040 2:88452261-88452283 AAGGGCCCGGCCGCGGCCCCGGG + Exonic
937983790 2:127629596-127629618 GAGGGCTCTGCAGGGGCCAGAGG - Intronic
941182684 2:162279729-162279751 AAGGGACAGTGAGGGGCCATGGG - Intronic
942455686 2:176136775-176136797 GAGGGCCTGGAAGGGGCCCTGGG + Intergenic
944412203 2:199456561-199456583 AATGGCCAGGCAGGAGCCAAAGG + Intronic
946308171 2:218867993-218868015 AGGGGCGTGGCAGGGGGCATTGG - Intronic
947576441 2:231278683-231278705 AGGGGCCCGGCACAGGCCAGTGG - Intronic
948187436 2:236032511-236032533 AAGGAACAGCCAGGGGCCATGGG - Intronic
948225119 2:236303296-236303318 AAGTACCTGGCAGAGGCCATTGG + Intergenic
948274025 2:236694746-236694768 AAGGGCTGGGCAGTGGCCTTAGG - Intergenic
948479202 2:238239805-238239827 AAGGTGCGGGCCGGGGCCATGGG - Exonic
948853890 2:240721214-240721236 AGGGGCCGGCCAGGGGCCACAGG - Intronic
949047241 2:241877700-241877722 AAGGGCGGGGTAGGGGCCCTGGG - Intergenic
1169141766 20:3230672-3230694 CAGGGCCCGGCAGGAACCAGGGG + Intronic
1169305328 20:4484870-4484892 AAGGGCTCCCCAGGGACCATAGG - Intergenic
1169490459 20:6067226-6067248 CGGGGCCGGGGAGGGGCCATGGG - Intergenic
1171481333 20:25458015-25458037 TTGGGCCCGGCAGGTGCCGTGGG - Intronic
1173190953 20:40875278-40875300 CAGGCCCAGGGAGGGGCCATGGG - Intergenic
1175522553 20:59611486-59611508 AGGGGCCAGGCAGGAGTCATGGG + Intronic
1175624763 20:60481240-60481262 AAGGAGGCCGCAGGGGCCATGGG + Intergenic
1175859497 20:62142887-62142909 ACGCGCCCGGCCGGGGCCAGGGG + Intronic
1175922375 20:62456165-62456187 AAGGGCCCCGCAGGTCCCAGGGG - Intergenic
1175930336 20:62490771-62490793 AAGGGCAGGGCAGGTGCCAGGGG - Intergenic
1175940624 20:62536018-62536040 GAGGGCACAGGAGGGGCCATGGG - Intergenic
1176092902 20:63326758-63326780 CAGGGCATGGCAGGGGCCAGGGG + Exonic
1176194697 20:63831615-63831637 AAGGGCGCAGCGGGGGCCAGGGG - Intergenic
1176860737 21:14010334-14010356 AAGGGCCCGGCAGGGTGCAGGGG - Intergenic
1178513965 21:33230420-33230442 CAGGGCCCGGGAGGGGTCCTGGG - Intronic
1178806898 21:35846816-35846838 AGGGGCCAGGCAGGGGGCAGGGG - Intronic
1180832346 22:18912579-18912601 AAGGACCCAGCAGGGCCCATGGG - Intronic
1181067497 22:20313763-20313785 AAGGACCCAGCAGGGCCCATGGG + Intergenic
1181952131 22:26562120-26562142 AGCGGCCCGGCGGGGGCCACAGG + Intronic
1182420866 22:30247995-30248017 AAGGGCTGGGAAGGGGCCACAGG - Intergenic
1183977824 22:41523457-41523479 AAGGGCCCTGCAGAGGCACTGGG + Intronic
1184365162 22:44046499-44046521 TAGGCCCCCTCAGGGGCCATGGG - Intronic
1184663683 22:45976815-45976837 CAGGGCCGGGCAGGGGCCAGGGG + Exonic
1184689282 22:46110146-46110168 GGGGGCCAGGCTGGGGCCATTGG + Intronic
1203282432 22_KI270734v1_random:137884-137906 AAGGACCCAGCAGGGCCCATGGG - Intergenic
949842053 3:8330421-8330443 GAGGGCCCGTCAATGGCCATGGG + Intergenic
950305773 3:11914705-11914727 ATGGGACCTGAAGGGGCCATCGG - Intergenic
953188444 3:40660732-40660754 AAGGGACAGGCAGAGGCCACTGG - Intergenic
953852006 3:46471650-46471672 CAGGGCGAGGTAGGGGCCATCGG - Intronic
961818644 3:129564144-129564166 CAGGGCCTGGGAGGGGCCATTGG - Intronic
962843108 3:139252887-139252909 ACAGCCCCGGCAGGGTCCATGGG + Intronic
963956986 3:151264883-151264905 AAGGGCAAGGCAGTGGCCACAGG - Intronic
967956891 3:194884297-194884319 AAGGGCCCTGCAGGGGATAAAGG + Intergenic
968605571 4:1533571-1533593 AAGGGGCCGGCAGGGGGCTGTGG + Intergenic
968705010 4:2073612-2073634 AAGGCCTGGGCAGGGGCCAGAGG + Intronic
968804147 4:2761855-2761877 AGGAGCCCCACAGGGGCCATGGG - Intergenic
972870935 4:43296973-43296995 AAGTGACAGGCTGGGGCCATGGG - Intergenic
973792896 4:54394826-54394848 GAGGCCCTGGCAGGGGCCAGTGG - Intergenic
981981604 4:150799594-150799616 AAGGGCCCATCAGGGCCCAATGG - Intronic
982325356 4:154124117-154124139 AAGGGCCAGGGAGGGGCCTTAGG - Intergenic
983259776 4:165443152-165443174 AAGGGGCAGGCAGTAGCCATTGG + Intronic
985607132 5:863874-863896 AGGGGCCTCGCAGGGGCCATTGG - Intronic
999257603 5:150218381-150218403 AGGGGCCAGGCAGGAGCCACTGG + Intronic
1000350629 5:160349718-160349740 AAGGGCAAAGCCGGGGCCATTGG - Exonic
1001954927 5:175842646-175842668 GAGGGCCTGGCTGGGGCCAGGGG - Intronic
1002446084 5:179290938-179290960 AAGGGAACGGCAGGGCCCACAGG - Intronic
1002564048 5:180100132-180100154 AAGGGCCCGGCAGAGGCATGGGG - Intergenic
1002767266 6:253353-253375 AAGGGCCGTGCATGGGCCAGTGG - Intergenic
1003867358 6:10375642-10375664 AAGGCCCTGTCTGGGGCCATGGG - Intergenic
1004000678 6:11594335-11594357 ATGGGCATGGCAGGGGCCAGGGG - Intergenic
1006923545 6:37641366-37641388 AAGGGACAGGGAGGGGGCATTGG + Intronic
1015066327 6:129033367-129033389 AAGGACCAGGGAGGGCCCATGGG + Intronic
1017906518 6:158760521-158760543 CAGGGCCTTGCAGGGGCCAGGGG + Intronic
1018226757 6:161636313-161636335 AAAGGGCTGGCAGGGGCCAGAGG + Intronic
1019140094 6:169937558-169937580 CAGGGCTCGGCAGGGTCCAAAGG - Intergenic
1019711125 7:2518828-2518850 AGGGGCCCGGAAGTGGCCAAGGG - Intronic
1020084960 7:5305280-5305302 AAGGGCCCGGCATGGGCTCTGGG - Exonic
1022966992 7:35483144-35483166 GAGGGGCTTGCAGGGGCCATGGG - Intergenic
1024323417 7:48090505-48090527 AAAGGCCAGGCAGGGGACAGTGG - Intronic
1025662616 7:63565022-63565044 AAGGGCCCGGCGTGGGCTCTGGG - Intergenic
1025728151 7:64087136-64087158 GAGGTCCAGGAAGGGGCCATGGG + Intronic
1029114407 7:98229913-98229935 AAGGGCCCGGCAGGGGACATGGG - Intronic
1031975961 7:128093662-128093684 AAGAGCCAGGGAGGGGCCATGGG + Intergenic
1033345996 7:140526151-140526173 AAGGACAAGGCAGGGGCCCTAGG - Intronic
1033883471 7:145916409-145916431 ATGGGGCAGGGAGGGGCCATGGG - Intergenic
1035027753 7:155836890-155836912 GAGGGGCCGGCAGCGGCCAGGGG + Intergenic
1035460809 7:159037359-159037381 AGGGGCCCTGCAGGGGCCCAGGG + Intronic
1036434805 8:8723434-8723456 AGGGGCGCGGCAGGGGCCGGCGG - Intergenic
1037817854 8:22121163-22121185 AAGGACAAGGCAGGGGCCCTCGG + Exonic
1047507498 8:125491503-125491525 AAGTGACCGGCAGGGGACAGAGG + Intergenic
1048440541 8:134456278-134456300 AAGGGGCCGGCAGGTGCAAAGGG + Intergenic
1048574068 8:135677475-135677497 AAGGGCCTGGCAGAGGCTAAGGG - Intergenic
1049278397 8:141731533-141731555 CGGGGCCAGCCAGGGGCCATGGG - Intergenic
1049400328 8:142423854-142423876 CAGGACCTGGCAGGGGCCAGTGG - Intergenic
1049531858 8:143159125-143159147 GGGGGCCAGGGAGGGGCCATAGG - Intronic
1049682776 8:143927121-143927143 AGGGGCTGGGCAGGGGCCATCGG - Intronic
1051343814 9:16134602-16134624 AAGAGCCAGGCAGTAGCCATAGG + Intergenic
1053210582 9:36224037-36224059 AGGGGCCCGGCCGGGGGCAGTGG - Intronic
1059452021 9:114376623-114376645 AGGGGCCTGGCAGGGGCCTGAGG + Exonic
1059463046 9:114447257-114447279 AAGGGCCGTGCAGTGGCCACAGG + Intronic
1060221459 9:121766223-121766245 AAGGGCCGGGCAGGTGGGATGGG - Intronic
1060518850 9:124282603-124282625 AAGGGCCAGGCTGGGGCCACAGG + Intronic
1061144144 9:128787369-128787391 AAGAGCCGGTAAGGGGCCATGGG + Exonic
1061791451 9:133061335-133061357 AAGGGCCCAGCCGAGGCCCTGGG - Intergenic
1062048720 9:134436424-134436446 GAGGGCCGGGCAAGGGGCATGGG - Intronic
1062262937 9:135671834-135671856 AAGGGGGCGGCAGCGGGCATGGG + Intergenic
1062275549 9:135728668-135728690 GAGGGCCGGGCAGGGGTCCTGGG + Intronic
1062502324 9:136856891-136856913 AAGTGGCCTGCAGGGGGCATGGG - Exonic
1062547150 9:137069032-137069054 CAGGGACCGGCAGGAGCCACCGG + Intronic
1197146221 X:123175543-123175565 AAGGACCCTGCAGGGTCCACAGG - Intergenic
1200073976 X:153542241-153542263 GAGGTCCCGTCAGGTGCCATGGG - Intronic
1200128904 X:153830620-153830642 CAGGGGCCGTCAGGGGCCGTGGG + Intergenic
1200142008 X:153907069-153907091 AAGGACCAGGCTGGGGCCAGGGG + Exonic