ID: 915313913

View in Genome Browser
Species Human (GRCh38)
Location 1:155017596-155017618
Sequence CGCAGCGAAGGGTGTGGGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 121}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915313897_915313913 8 Left 915313897 1:155017565-155017587 CCGCCCCTGACTCACGCCGCCCC 0: 1
1: 0
2: 1
3: 27
4: 383
Right 915313913 1:155017596-155017618 CGCAGCGAAGGGTGTGGGACAGG 0: 1
1: 0
2: 0
3: 7
4: 121
915313904_915313913 -8 Left 915313904 1:155017581-155017603 CCGCCCCCGGGCTGGCGCAGCGA 0: 1
1: 0
2: 1
3: 9
4: 152
Right 915313913 1:155017596-155017618 CGCAGCGAAGGGTGTGGGACAGG 0: 1
1: 0
2: 0
3: 7
4: 121
915313896_915313913 14 Left 915313896 1:155017559-155017581 CCGCTGCCGCCCCTGACTCACGC 0: 1
1: 0
2: 1
3: 16
4: 260
Right 915313913 1:155017596-155017618 CGCAGCGAAGGGTGTGGGACAGG 0: 1
1: 0
2: 0
3: 7
4: 121
915313902_915313913 3 Left 915313902 1:155017570-155017592 CCTGACTCACGCCGCCCCCGGGC 0: 1
1: 0
2: 2
3: 13
4: 160
Right 915313913 1:155017596-155017618 CGCAGCGAAGGGTGTGGGACAGG 0: 1
1: 0
2: 0
3: 7
4: 121
915313895_915313913 17 Left 915313895 1:155017556-155017578 CCACCGCTGCCGCCCCTGACTCA 0: 1
1: 0
2: 1
3: 42
4: 541
Right 915313913 1:155017596-155017618 CGCAGCGAAGGGTGTGGGACAGG 0: 1
1: 0
2: 0
3: 7
4: 121
915313892_915313913 29 Left 915313892 1:155017544-155017566 CCGGAGCCGCCGCCACCGCTGCC 0: 1
1: 2
2: 48
3: 366
4: 2484
Right 915313913 1:155017596-155017618 CGCAGCGAAGGGTGTGGGACAGG 0: 1
1: 0
2: 0
3: 7
4: 121
915313898_915313913 5 Left 915313898 1:155017568-155017590 CCCCTGACTCACGCCGCCCCCGG 0: 1
1: 0
2: 0
3: 8
4: 135
Right 915313913 1:155017596-155017618 CGCAGCGAAGGGTGTGGGACAGG 0: 1
1: 0
2: 0
3: 7
4: 121
915313893_915313913 23 Left 915313893 1:155017550-155017572 CCGCCGCCACCGCTGCCGCCCCT 0: 1
1: 5
2: 48
3: 549
4: 3469
Right 915313913 1:155017596-155017618 CGCAGCGAAGGGTGTGGGACAGG 0: 1
1: 0
2: 0
3: 7
4: 121
915313900_915313913 4 Left 915313900 1:155017569-155017591 CCCTGACTCACGCCGCCCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 101
Right 915313913 1:155017596-155017618 CGCAGCGAAGGGTGTGGGACAGG 0: 1
1: 0
2: 0
3: 7
4: 121
915313894_915313913 20 Left 915313894 1:155017553-155017575 CCGCCACCGCTGCCGCCCCTGAC 0: 1
1: 0
2: 10
3: 96
4: 853
Right 915313913 1:155017596-155017618 CGCAGCGAAGGGTGTGGGACAGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915313913 Original CRISPR CGCAGCGAAGGGTGTGGGAC AGG Exonic