ID: 915314225

View in Genome Browser
Species Human (GRCh38)
Location 1:155018831-155018853
Sequence GGATCTGAACAGATGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 293}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915314225_915314234 24 Left 915314225 1:155018831-155018853 CCCTGCCCCATCTGTTCAGATCC 0: 1
1: 0
2: 1
3: 21
4: 293
Right 915314234 1:155018878-155018900 CCTGCTCTCTCAGGCCCACGAGG 0: 1
1: 0
2: 2
3: 24
4: 241
915314225_915314232 15 Left 915314225 1:155018831-155018853 CCCTGCCCCATCTGTTCAGATCC 0: 1
1: 0
2: 1
3: 21
4: 293
Right 915314232 1:155018869-155018891 TGAGCAACTCCTGCTCTCTCAGG 0: 1
1: 0
2: 1
3: 16
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915314225 Original CRISPR GGATCTGAACAGATGGGGCA GGG (reversed) Intronic
900175884 1:1291191-1291213 GGCCCTGCACAGAAGGGGCACGG + Intronic
900722519 1:4186608-4186630 GGTCCTGCACAGATGGGACACGG + Intergenic
900812571 1:4818275-4818297 GGAAGTGCACAGATGGGCCAAGG + Intergenic
902333307 1:15741487-15741509 GGAGCTGAACAGGTGGACCACGG - Intergenic
902705044 1:18198900-18198922 GCATCTGGGCAGAGGGGGCAGGG - Intronic
903396003 1:23002323-23002345 GGTCCTGCACAGATGGGACACGG + Intergenic
903981929 1:27195019-27195041 GGCTGTGGTCAGATGGGGCAGGG - Intergenic
904807714 1:33143439-33143461 GGATCTGAGAGGATGGGGGAGGG + Intergenic
905257694 1:36695585-36695607 GGAGGGGAACAGATGGGGAAGGG + Intergenic
905429310 1:37909986-37910008 GGTCCTGCACAGATGGGACACGG - Intronic
905909860 1:41646315-41646337 GGATCTGAACACAGGGTGCCTGG - Intronic
906080942 1:43087843-43087865 GGTCCTGCACAGATGGGACACGG - Intergenic
906744501 1:48212365-48212387 GGTCCTGCACAGATGGGACACGG + Intergenic
908525949 1:64987482-64987504 GGATCTGAACAGAAGTGCAAAGG + Intergenic
909477778 1:76100929-76100951 GGCTGTGCACGGATGGGGCAAGG - Intronic
910002722 1:82358235-82358257 GGTCCTGCACAGATGGGACATGG + Intergenic
911645753 1:100335711-100335733 GGAAGTGAAGAAATGGGGCAAGG - Intergenic
911728215 1:101264748-101264770 GCATCTGGAGAGAGGGGGCAGGG - Intergenic
915314225 1:155018831-155018853 GGATCTGAACAGATGGGGCAGGG - Intronic
918104477 1:181404791-181404813 GAATCTGACCAGAAGGGGCCAGG + Intergenic
918518531 1:185389007-185389029 GGATCTAATCAGAAGGGGAATGG - Intergenic
919476419 1:198037128-198037150 GGTCCTGCACAGATGGGACATGG - Intergenic
920916191 1:210259932-210259954 GGAGCTCCAGAGATGGGGCAGGG + Intergenic
921453028 1:215332557-215332579 GGAATTGAGCAGATGGGGGAGGG + Intergenic
921957604 1:221000448-221000470 GAATGAGGACAGATGGGGCAGGG - Intergenic
922598995 1:226835602-226835624 GGGCCTGCACAGATGGGACATGG - Intergenic
922687977 1:227662558-227662580 GGATGTGAGCAGATGACGCAGGG + Intronic
922816588 1:228453515-228453537 GGAACTGACCAGCTGGGGCTGGG + Intergenic
923738645 1:236635515-236635537 GTATGGGAACCGATGGGGCAGGG + Intergenic
924180676 1:241436306-241436328 GGTCCTGCACAGATGGGACATGG - Intergenic
1062930777 10:1351083-1351105 GGTCCTGCACAGATGGGACACGG - Intronic
1063464822 10:6236308-6236330 GCATCTCTGCAGATGGGGCAGGG + Intergenic
1066103376 10:32137032-32137054 GGTCCTGCACAGATGGGACATGG + Intergenic
1066437190 10:35405856-35405878 GGTCCTGCACAGATGGGACACGG + Intronic
1067828008 10:49593361-49593383 GAATCTGGACAGAAGGGCCATGG + Intergenic
1069573176 10:69506810-69506832 GGAACTGAGAAGAAGGGGCAGGG - Exonic
1070314476 10:75296741-75296763 AGATATGAAAACATGGGGCAGGG + Intergenic
1070700007 10:78595118-78595140 GTCTCTGACCACATGGGGCAGGG + Intergenic
1071187256 10:83059483-83059505 GGTCCTGCACAGATGGGACATGG - Intergenic
1073321841 10:102620408-102620430 GGGTCTGGACTGATGGGGGAAGG - Intronic
1073453566 10:103623360-103623382 GGGTCTGAGCAGAGGGTGCAGGG - Intronic
1074206667 10:111288697-111288719 GCAACTGAACACATGGAGCAGGG + Intergenic
1076083658 10:127606169-127606191 GGATGTCAAAAGATGAGGCAGGG + Intergenic
1076338647 10:129727884-129727906 GGATTTGAACACATGGAGTAAGG + Intronic
1077063838 11:629732-629754 GGAGCTGAAGGGATGGGGGAAGG - Intergenic
1077766360 11:5163661-5163683 GGTCCTGCACAGATGGGACACGG + Intronic
1079027887 11:16963142-16963164 GGAGCTGCACAGAAGTGGCATGG - Intronic
1079470346 11:20772062-20772084 GAATCTGAGTAGATGTGGCAAGG + Intronic
1079727052 11:23890559-23890581 GGTCCTGCACAGATGGGACATGG + Intergenic
1081719942 11:45281360-45281382 GGATATGGACAGAAGGGGCCTGG + Intronic
1081855152 11:46298339-46298361 GGGTCAGAAGAGATGGGGGATGG - Intronic
1082197740 11:49324810-49324832 GGTCCTGCACAGATGGGACATGG + Intergenic
1083883727 11:65560576-65560598 GGAGCTGGAAACATGGGGCAGGG + Intergenic
1084613258 11:70217684-70217706 GGTCCTGTACAGATGGGACATGG + Intergenic
1084715405 11:70870354-70870376 GGTTCTGGACAGATGGGAAAAGG + Intronic
1085371067 11:76005917-76005939 TGATGTGCACAGACGGGGCATGG - Intronic
1085570216 11:77552267-77552289 GGTCCTGCACAGATGGGACATGG - Intronic
1086134810 11:83434961-83434983 GGTCCTGCACAGATGGGACATGG + Intergenic
1086136246 11:83446278-83446300 GGTCCTGCACAGATGGGACATGG + Intergenic
1086305006 11:85470363-85470385 GGATTTGCACAGTTGGGGTAGGG + Intronic
1086550237 11:88045526-88045548 GGTCCTGCACAGATGGGACATGG - Intergenic
1087127838 11:94643951-94643973 GGTCCTGCACAGATGGGACACGG - Intergenic
1087749958 11:101996412-101996434 GGATCAGAGTATATGGGGCAAGG - Intronic
1088554984 11:111052527-111052549 GGTCCTGCACAGATGGGACATGG - Intergenic
1088619730 11:111669855-111669877 GGAGCTGAAAATATGGAGCAGGG - Intronic
1090526786 11:127546109-127546131 GGTCCTGCACAGATGGGACATGG + Intergenic
1090546466 11:127772453-127772475 GGTCCTGCACAGATGGGACATGG + Intergenic
1090871936 11:130756887-130756909 GGTCCTGCACAGATGGGACATGG + Intergenic
1092122457 12:6054069-6054091 GGATTTGAACAGAGAGGGGAAGG - Intronic
1092148991 12:6234038-6234060 GGATTTGAAAAGGTGGGGCTGGG + Intronic
1092275870 12:7060663-7060685 TGATCTAAACAGAGGGGGCTGGG - Intronic
1092474506 12:8807271-8807293 GGTCCTGCACAGATGGGACACGG - Intergenic
1092995686 12:13948287-13948309 GCATTTAAACATATGGGGCAGGG - Intronic
1093358459 12:18197285-18197307 GGTCCTGTACAGATGGGACATGG - Intronic
1093812814 12:23509389-23509411 GGTCCTGCACAGATGGGACACGG + Intergenic
1095310658 12:40693106-40693128 AGATCTTAACAGAGGGGTCAGGG - Intronic
1098919926 12:76293794-76293816 GGTCCTGCACAGATGGGACATGG - Intergenic
1099836078 12:87910768-87910790 GGTCCTGCACAGATGGGACACGG + Intergenic
1100505930 12:95220162-95220184 GAAACGGGACAGATGGGGCATGG + Intronic
1102454323 12:113062549-113062571 GGTTCAGAACATGTGGGGCAGGG - Intronic
1102688553 12:114742610-114742632 GGACCCACACAGATGGGGCAGGG + Intergenic
1104076095 12:125391471-125391493 GGATCTGAGTAGATGGGACATGG + Intronic
1105590785 13:21791080-21791102 GGATGTCCAAAGATGGGGCATGG - Intergenic
1106449707 13:29869250-29869272 GGATCTGAAAAGATGGTGATGGG + Intergenic
1107723821 13:43277337-43277359 GGATCTTAACAGCAGGGTCAGGG - Intronic
1109499313 13:63215458-63215480 GGTCCTGCACAGATGGGACACGG - Intergenic
1110650464 13:77936697-77936719 GGTCCTGCACAGATGGGACATGG + Intergenic
1113274425 13:108712718-108712740 GGTTCTTACCAGATGGAGCAGGG - Exonic
1116703268 14:48265751-48265773 GGTCCTGCACAGATGGGACATGG + Intergenic
1117252170 14:53948873-53948895 GGATCCCAACAGATTGGGCTGGG - Intergenic
1118640776 14:67790375-67790397 GTATCTGAACAGCCTGGGCAAGG + Intronic
1121193277 14:92048086-92048108 GGTCCTGCACAGATGGGACATGG + Exonic
1122507656 14:102241963-102241985 GGTCCTGCACAGATGGGACATGG - Intronic
1124116642 15:26849565-26849587 GGATGTGGACACATGGGACATGG + Intronic
1126437254 15:48648047-48648069 GGATCTGAGCAGAGGGACCATGG + Intergenic
1127167641 15:56263708-56263730 GGATCTGAGGATATGGGGAAGGG - Intronic
1127237628 15:57072107-57072129 TGATCTGAAAAGATGGTACATGG + Intronic
1127647772 15:60974994-60975016 GGATCTGGGCAGGTGGGCCAAGG + Intronic
1129252286 15:74315674-74315696 GGATCTGCAGAGATGGGGGAAGG + Intronic
1129259456 15:74356264-74356286 GGTCCTGCACAGATGGGACATGG - Intronic
1129656054 15:77526506-77526528 GGTTCTGAGAAGATGGGGGAAGG - Intergenic
1130781089 15:87041986-87042008 GGTCCTGCACAGATGGGACACGG - Intergenic
1131062300 15:89411467-89411489 TGAACTGAACAGATGGAGCGTGG - Intergenic
1131486576 15:92825836-92825858 GGATCTGAACAGACAGGTCTTGG - Intergenic
1131684203 15:94753109-94753131 GGACCTGCACAGATGGGACATGG - Intergenic
1132313862 15:100877159-100877181 GGATGTGAGCAGAAGGGGCTGGG + Intergenic
1132591572 16:728466-728488 GGGTCAGAGCAGATGGGGCGGGG - Intronic
1137917464 16:52448447-52448469 GGATATGATCAGATGGGGTTAGG - Intronic
1137959207 16:52864532-52864554 GGATGTGCAGTGATGGGGCAGGG - Intergenic
1138237915 16:55401155-55401177 AGAACTGAACAGCTGGGGCATGG - Intronic
1143794042 17:9321910-9321932 GGATAAGAAGAGATGGGGCAGGG + Intronic
1145791887 17:27632519-27632541 GGACCTGCACAGAGGGGGCTGGG + Intronic
1147160886 17:38568913-38568935 GGATCAGGATGGATGGGGCAGGG + Intronic
1147925083 17:43941108-43941130 GGAGCTGGACAGACAGGGCAGGG + Intronic
1148123091 17:45223639-45223661 TGAGCTGAGCAGATGGGGGAGGG + Intronic
1149319589 17:55470135-55470157 GGACCTGCACAGATGGGACATGG - Intergenic
1150306906 17:64093380-64093402 GAAACTGAACAGATGGGGCCAGG - Intronic
1152798001 17:82317347-82317369 GGCTCTGAGCTCATGGGGCAGGG + Intronic
1156237381 18:35218105-35218127 GGTACTGCACAGATGGGACATGG - Intergenic
1156886079 18:42138089-42138111 GATTCTAAACAGATGGGGAAAGG + Intergenic
1157307825 18:46529853-46529875 TGACCTGAACCGCTGGGGCAGGG - Intronic
1158394623 18:57070000-57070022 GGTCCTGCACAGATGGGACACGG + Intergenic
1160493153 18:79354713-79354735 CGAGGTGAACAGAGGGGGCAAGG + Intronic
1160672582 19:373357-373379 GGCTCCGAGGAGATGGGGCAAGG + Intronic
1161712062 19:5854446-5854468 GGTCCTGCACAGATGGGACACGG - Intergenic
1162038919 19:7957668-7957690 GGGTCTGAACACCTGGGGGATGG + Intergenic
1162602505 19:11679612-11679634 GAATCTGAACAGACAGGGCTTGG - Intergenic
1163372454 19:16908978-16909000 GGATCTGCACAGCTGGGGCCGGG - Intronic
1164010531 19:21199757-21199779 GGATTTGAACATATGCAGCATGG + Intergenic
1164258785 19:23551600-23551622 GGTCCTGCACAGATGGGACACGG - Intronic
1165496986 19:36158791-36158813 GGTCCTGCACAGATGGGACACGG + Intergenic
1165835380 19:38751947-38751969 GGTCCTGCACAGATGGGACACGG - Intronic
1166453303 19:42919244-42919266 GGAACAGGACAGATGGAGCAGGG + Intronic
1166905772 19:46107423-46107445 GGGTCCGCACAGATGGGACATGG + Intergenic
1167898014 19:52597667-52597689 GGACCTGATTAGAAGGGGCAGGG + Intronic
1168514505 19:57000520-57000542 GGAGAGGAGCAGATGGGGCAGGG - Intergenic
927371408 2:22359355-22359377 AGATCTGAACAGATGGGGAATGG + Intergenic
927972467 2:27314533-27314555 GTATCTGTGCAGTTGGGGCAAGG - Intronic
929204132 2:39271028-39271050 AGAGCTGAACACATGGGGAAAGG + Intronic
930166960 2:48212337-48212359 GGATCTGAACTGATGAGACAAGG - Intergenic
931123917 2:59252570-59252592 GCACCTGAACAGATGGTGCCTGG - Intergenic
931608905 2:64078543-64078565 GGTCCTGCACAGATGGGACACGG + Intergenic
931948278 2:67333934-67333956 GGTCCTGCACAGATGGGACACGG - Intergenic
932910337 2:75799925-75799947 GGCTCAGAGCAGATGGGGCTGGG + Intergenic
933633480 2:84682191-84682213 GGATCTGAGCAGATGGAGATGGG - Intronic
933805783 2:85997320-85997342 GGATCTGTGCAGATGGGCCTTGG - Intergenic
934141283 2:89050256-89050278 GGTCCTGCACAGATGGGACACGG - Intergenic
937892132 2:126946891-126946913 GGATATGAAGAATTGGGGCAGGG - Intergenic
938206251 2:129426721-129426743 AGAACTGAACAGATGGAGGAAGG - Intergenic
940910583 2:159206307-159206329 GGATCAGAACTGAGGGGGCTGGG + Intronic
941935871 2:170981012-170981034 GGTCCTGCACAGATGGGACACGG + Intergenic
942153921 2:173107298-173107320 GGCTCTGGACAGAGGAGGCAAGG + Intronic
943806670 2:192132759-192132781 GGTCCTGCACAGATGGGACATGG - Intronic
943865364 2:192920396-192920418 GGTCCTGCACAGATGGGACATGG - Intergenic
945301459 2:208219610-208219632 GGTCCTGCACAGATGGGACATGG + Intergenic
946402033 2:219473223-219473245 GGAAGTGTACAGATGGGCCAAGG - Intronic
946886518 2:224227627-224227649 GGTCCTGCACAGATGGGACATGG - Intergenic
947018550 2:225648346-225648368 GGATCCGATCAGATGGAGCCAGG + Intronic
948877539 2:240837645-240837667 TGATCTGAAAAGGTGGGGCCAGG - Intergenic
1169981134 20:11385177-11385199 GAAACTGCTCAGATGGGGCAAGG - Intergenic
1170590220 20:17765861-17765883 GGCTGTGACCAGATGGAGCATGG + Intergenic
1171257133 20:23697939-23697961 GGGTCTTAACAGATGTGACAAGG - Intergenic
1171449887 20:25227970-25227992 GGATATGAACAGATGTTTCACGG - Intergenic
1173873077 20:46353754-46353776 GGTTTTGCAGAGATGGGGCATGG + Intronic
1174073853 20:47918262-47918284 GGATCTTAACAGAAGCAGCACGG - Intergenic
1175179349 20:57134480-57134502 GGAGCTGAAGAGATGGGGGGCGG + Intergenic
1176200750 20:63859231-63859253 GGATCTGAACTGAGGTGGCAGGG + Intergenic
1176265764 20:64208532-64208554 GCATCTGCACACCTGGGGCAGGG - Intronic
1178827416 21:36028426-36028448 GGACCTGGCCAGGTGGGGCAGGG - Intergenic
1179650344 21:42804400-42804422 GGTCCTGCACAGATGGGACATGG + Intergenic
1179994185 21:44966490-44966512 GGGTCTGGACAGAAGGGGTATGG - Intronic
1180070614 21:45434255-45434277 GCATCTGACCAGAGGGTGCAGGG + Intronic
1182785046 22:32900273-32900295 GGATCTGAAAAGATGGTGCTGGG - Intronic
1182872651 22:33662333-33662355 GCTCCTGAAAAGATGGGGCAGGG - Intronic
1182998625 22:34836650-34836672 GGTCCTGCACAGATGGGACACGG - Intergenic
1183635650 22:39060889-39060911 GGTCCTGCACAGGTGGGGCATGG + Intronic
1184389140 22:44192848-44192870 GGAGCAGAACAGGTGGGGCCTGG + Intronic
1184910833 22:47532885-47532907 GGAAGTGCACAGATGGGGCTAGG + Intergenic
949305797 3:2639306-2639328 GCATGTTAACAGGTGGGGCAGGG - Intronic
949313940 3:2730801-2730823 GAATCTGAATGGATGGGGCTGGG - Intronic
950575606 3:13830403-13830425 AAACATGAACAGATGGGGCATGG - Intronic
950812915 3:15666814-15666836 AGATTTGAACAGATGGAGAAGGG - Intergenic
951888959 3:27551502-27551524 GGTCCTGCACAGATGGGACATGG + Intergenic
951891772 3:27574342-27574364 GGAATAGAACAGATGGGGTACGG - Intergenic
952288782 3:31995078-31995100 GCATCTGAGGAAATGGGGCAAGG + Intronic
952343540 3:32464783-32464805 GGTCCTGCACAGATGGGACACGG + Intronic
952803115 3:37316343-37316365 AGATCTGAATAGATGAGGCTTGG + Intronic
953980871 3:47412426-47412448 GGATCTGGGCAGATGGGGCTGGG + Intronic
954792694 3:53144759-53144781 AGTCCTGGACAGATGGGGCAGGG - Intergenic
955153559 3:56393057-56393079 GGAGCTGATGAGATGGGGAAGGG - Intronic
956233480 3:67042054-67042076 GGTCCTGCACAGATGGGACATGG + Intergenic
958421976 3:93940137-93940159 GGTTCTGCACAGATGGGACATGG - Intronic
961350217 3:126295701-126295723 GGAAGTGCACAGATGGGTCAAGG - Intergenic
961533483 3:127554823-127554845 GCAGATGAGCAGATGGGGCAGGG - Intergenic
962022169 3:131512481-131512503 GGTCCTGCACAGATGGGACAAGG + Intergenic
962120966 3:132559473-132559495 GGAGATGGACAGATGGGGAATGG + Intronic
963521643 3:146364389-146364411 GGTCCTGCACAGATGGGACATGG - Intergenic
964940938 3:162157513-162157535 GGTCCTGTACAGATGGGACATGG + Intergenic
964983653 3:162714738-162714760 GGTCCTGCACAGATGGGACATGG - Intergenic
965105211 3:164345493-164345515 GGTCCTGCACAGATGGGACACGG + Intergenic
965336348 3:167433551-167433573 GGTCCTGCACAGATGGGACACGG - Intergenic
965553721 3:169998173-169998195 GGATCTGATTAGCTAGGGCAGGG - Exonic
965626291 3:170686698-170686720 GGTCCTGCACAGATGGGACATGG + Intronic
967086428 3:186098940-186098962 TGATCTGAACAGCCGAGGCATGG - Intronic
967302762 3:188031932-188031954 GGACTTAGACAGATGGGGCAGGG - Intergenic
967312721 3:188121326-188121348 GGGTGTGGCCAGATGGGGCATGG + Intergenic
968334227 3:197899945-197899967 GGATCTGAGCAGCTGTGGGAGGG + Intronic
969003792 4:4003590-4003612 GGTCCTGCACAGATGGGACATGG + Intergenic
969156301 4:5213380-5213402 GGCTTTGAACAAGTGGGGCATGG - Intronic
971238785 4:24868750-24868772 GTATCTGGACAGGAGGGGCACGG - Intronic
975853301 4:78595808-78595830 TGGTGAGAACAGATGGGGCACGG + Exonic
976405787 4:84659450-84659472 GAATCTGTAATGATGGGGCAGGG + Intergenic
979350608 4:119640530-119640552 GTATTTGAACAGATGGAGAAAGG - Intergenic
979597942 4:122555239-122555261 GTATCTGAACAGATGGGGGTGGG - Intergenic
980284967 4:130769693-130769715 GGTCCTGCACAGATGGGACACGG - Intergenic
980611759 4:135170668-135170690 GGTCCTGCACAGATGGGACACGG + Intergenic
980860076 4:138488500-138488522 GTATCTGTGCAGATGGGGAAAGG - Intergenic
981815768 4:148829403-148829425 GGAAGAAAACAGATGGGGCATGG + Intergenic
982325660 4:154126175-154126197 GGAGCTGAACAGAGTGGGGATGG - Intergenic
983659590 4:170118787-170118809 GGTCCTGCACAGATGGGACACGG - Intergenic
983707692 4:170679825-170679847 GGTCCTGCACAGATGGGACACGG - Intergenic
983883739 4:172959747-172959769 GGTCCTGCACAGATGGGACATGG + Intronic
984134011 4:175913698-175913720 GGAGATGAAGGGATGGGGCAGGG - Intronic
984165339 4:176298226-176298248 GGTCCTGCACAGATGGGACATGG + Intergenic
985166997 4:187107255-187107277 GGATTTGAACAGAGGAGGCAGGG - Intergenic
985435739 4:189928186-189928208 GGTCCTGCACAGATGGGACATGG - Intergenic
986404096 5:7408163-7408185 AGAACTGAACAGAAGGGGCCAGG - Intronic
986502657 5:8416429-8416451 GGTCCTGCACAGATGGGACATGG - Intergenic
986555023 5:9001923-9001945 GGTCCTGCACAGATGGGACACGG + Intergenic
992165188 5:74042819-74042841 TGATCTAAACAGTTGGGGCTTGG - Intergenic
992552579 5:77873161-77873183 GCATCTGGACAGAGGAGGCAAGG + Intergenic
994295165 5:98081398-98081420 GGTCCTGCACAGATGGGACACGG - Intergenic
995859972 5:116630381-116630403 GGATCTGGACTGACGGGGCAGGG + Intergenic
996358605 5:122622245-122622267 GGTCCTGCACAGATGGGACATGG + Intergenic
996366276 5:122704326-122704348 GGTTCTGAATAGATGAGGAAAGG + Intergenic
996509920 5:124306125-124306147 GGTCCTGCACAGATGGGACACGG - Intergenic
996528072 5:124499387-124499409 GGTCCTGCACAGATGGGACACGG - Intergenic
998207792 5:140171687-140171709 TGATCTGAGCAGCCGGGGCAGGG - Intergenic
1000606951 5:163336357-163336379 GGTCCTGCACAGATGGGACATGG - Intergenic
1000809970 5:165849137-165849159 GGATCTGAACAGATGGCTCCCGG + Intergenic
1001129116 5:169048828-169048850 GCAGCTGAACCAATGGGGCAAGG - Intronic
1002692753 5:181061802-181061824 GGATGGGAACGGATGGGGCAGGG + Intergenic
1003637484 6:7846207-7846229 GGAAGTGAACATATGGGGGAGGG + Intronic
1004366057 6:15013672-15013694 GAGTCTGAAAAGATGGGTCAGGG - Intergenic
1004521310 6:16363628-16363650 GGACCAGTACAGAGGGGGCATGG + Intronic
1004837022 6:19541237-19541259 GGTCCTGCACAGATGGGACACGG - Intergenic
1005262155 6:24072418-24072440 GGATCAGCACAGATTGGGAAGGG - Intergenic
1005660484 6:27993735-27993757 TGATCTGAACAGTCTGGGCACGG - Intergenic
1005786554 6:29250584-29250606 GGACCTGCACAGATAGGACACGG + Intergenic
1005949350 6:30619945-30619967 TGATCTCGACAGATGGGGCAGGG - Exonic
1006324872 6:33346165-33346187 GGTCCTGCACAGATGGGACACGG - Intergenic
1010349062 6:74850312-74850334 GAATCTGATCAGATAGGGGATGG - Intergenic
1010829672 6:80513683-80513705 GGGTCTGCACAGATGGGACGTGG + Intergenic
1013418933 6:109948970-109948992 GGAAAGGAACAGATGAGGCAGGG + Intergenic
1014058444 6:117043698-117043720 GGGACAGAACACATGGGGCAAGG - Intergenic
1014115321 6:117663063-117663085 GGTCCTGCACAGATGGGACATGG + Intergenic
1014161776 6:118178121-118178143 GAATTTGAACAGAAGGGACATGG - Intronic
1014235969 6:118955134-118955156 GTATCTGAACAGAAGGTGCTTGG - Intergenic
1014433280 6:121394260-121394282 TGATGTGAACAGATGTGACATGG + Intergenic
1016204555 6:141455162-141455184 GGTCCTGCACAGATGGGACACGG - Intergenic
1017779315 6:157704025-157704047 GGTCCTGCACAGATGGGACACGG + Intronic
1018016048 6:159713297-159713319 GGGTTTGAAAAGATGAGGCAGGG - Intronic
1018077615 6:160230826-160230848 GGTCCTGCACAGATGGGACATGG - Intronic
1018767662 6:166946381-166946403 GGATCTGCACAGGTCTGGCATGG + Intronic
1020243410 7:6412667-6412689 GAATCTGATCAGATGGTGGAAGG + Intronic
1020323927 7:6960045-6960067 GGTCCTGCACAGATGGGACATGG + Intergenic
1021660643 7:22915451-22915473 GGTCCTGCACAGATGGGACATGG - Intergenic
1021913589 7:25409984-25410006 GAATCTGAACAGATGCAGAAGGG + Intergenic
1022447421 7:30481564-30481586 GGTCCTGCACAGATGGGACATGG - Intergenic
1022658615 7:32345070-32345092 TGATCATAACAGAAGGGGCATGG - Intergenic
1022854692 7:34303270-34303292 GGTCCTGCACAGATGGGACACGG + Intergenic
1023144111 7:37132359-37132381 GGATATGAATAAATGGGGCAGGG - Intronic
1024159979 7:46664057-46664079 GATTCTGAAAAGATGGGCCAGGG + Intergenic
1024263463 7:47588871-47588893 GGACCTGAGCATATGGGGCCAGG - Intergenic
1026545200 7:71316283-71316305 GGATCTGATCAGAGGGAGAATGG + Intronic
1029813586 7:103072834-103072856 GTATCTGAAGTGATGGGCCAAGG - Intronic
1030445763 7:109645496-109645518 GGTCCTGCACAGATGGGACACGG + Intergenic
1030516313 7:110542989-110543011 GAAGCTGAAAATATGGGGCAAGG + Intergenic
1031364727 7:120888990-120889012 GGTCCTGCACAGATGGGACACGG + Intergenic
1033528778 7:142243248-142243270 GGATCTGACCAGATCTGGGATGG + Intergenic
1034495301 7:151417324-151417346 GGATAAGAACACATGGGGCCGGG + Intergenic
1035703617 8:1656624-1656646 AGAGCTGAATAAATGGGGCAGGG - Intronic
1037500707 8:19483061-19483083 GGATCAGAACCCATGGGGCTTGG - Intronic
1038708762 8:29921460-29921482 GGTTCTGAGAAGCTGGGGCAGGG + Intergenic
1039862370 8:41469694-41469716 GGATCTGAAGAGACAGGGCGAGG - Intergenic
1041917515 8:63151675-63151697 GGGTCTGCACAGATGGGACACGG + Intergenic
1043837756 8:85065305-85065327 GGTCCTGCACAGATGGGACACGG - Intergenic
1048833848 8:138499937-138499959 GGCCCTGAACAGCTGGGGCCTGG + Intergenic
1049091794 8:140520540-140520562 GAAACTGAACAGATGGGGAGTGG - Intergenic
1049661427 8:143821273-143821295 GGCTGTGCACAGCTGGGGCAGGG + Intronic
1052720622 9:32167889-32167911 GGTCCTGCACAGATGGGACATGG + Intergenic
1054807469 9:69408130-69408152 GGTCCTGCACAGATGGGACACGG + Intergenic
1054813432 9:69452611-69452633 GGATCTGTGAAGATGGTGCAGGG - Intronic
1056435150 9:86568724-86568746 GGGTCTCAACAGCTGGGGGATGG + Intergenic
1057378009 9:94542160-94542182 GGTCCTGCACAGATGGGACACGG - Intergenic
1057812561 9:98269188-98269210 GGTCCTGCACAGATGGGACACGG + Intergenic
1057820099 9:98323604-98323626 GGAGCTGGACAGCTTGGGCAGGG - Intronic
1058612419 9:106790530-106790552 GGTCCTGCACAGATGGGACACGG - Intergenic
1059546140 9:115177997-115178019 GGTCCTGCACAGATGGGACATGG + Intronic
1059574638 9:115475692-115475714 GGTCCTGCACAGATGGGACACGG - Intergenic
1187099939 X:16182534-16182556 GGTCCTGCACAGATGGGACACGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187994952 X:24916148-24916170 GGATTTGAACAGAAGGTTCAAGG - Intronic
1188463357 X:30452471-30452493 GGTCCTGCACAGATGGGACACGG + Intergenic
1190478808 X:50854119-50854141 GGAAATGAAGAGATGGGGAAGGG - Intergenic
1191014175 X:55791683-55791705 GGTCCTGCACAGATGGGACATGG + Intergenic
1191805794 X:65133011-65133033 GGTCCTGTACAGATGGGACATGG + Intergenic
1192149979 X:68706139-68706161 GCATCTGAACAGGTGCAGCAGGG + Intronic
1192344789 X:70292740-70292762 GAATCTGACCAGATAGTGCAGGG - Intronic
1192454612 X:71266516-71266538 GGTCCTGCACAGATGGGACATGG - Intergenic
1192591430 X:72363150-72363172 GGATCAGCAGTGATGGGGCAAGG - Intronic
1195918982 X:109963752-109963774 CCATCTGAACAGAAGGAGCAGGG - Intergenic
1196715806 X:118810057-118810079 GGATCTGCATAGATGGTGTATGG + Intergenic
1197236564 X:124072607-124072629 GGATATGAAAAGATGAGACAAGG + Intronic
1197470982 X:126865437-126865459 GGTCCTGCACAGATGGGACATGG - Intergenic
1199972241 X:152870008-152870030 GGAGCTGAACAGATGAAACAGGG - Intergenic