ID: 915314893

View in Genome Browser
Species Human (GRCh38)
Location 1:155022940-155022962
Sequence CTGTGTCAGCACCGTGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915314893_915314895 -10 Left 915314893 1:155022940-155022962 CCTGGGCCACGGTGCTGACACAG 0: 1
1: 0
2: 1
3: 14
4: 187
Right 915314895 1:155022953-155022975 GCTGACACAGAGCAGCCGCTTGG 0: 1
1: 0
2: 3
3: 18
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915314893 Original CRISPR CTGTGTCAGCACCGTGGCCC AGG (reversed) Intronic
900503605 1:3018416-3018438 CACTGGCAGCACAGTGGCCCTGG - Intergenic
900787028 1:4655616-4655638 CTGGAGCAGCACCGCGGCCCTGG + Intronic
903138915 1:21326940-21326962 CTGTGTTTGCACAGTGGCTCTGG + Intronic
903375165 1:22861212-22861234 CTGTGTGAGCAGTGTGGCCTCGG - Intronic
906666130 1:47623353-47623375 CTGTTCCACCACCTTGGCCCCGG - Intergenic
907915643 1:58866433-58866455 GTGTGCCTGCACGGTGGCCCTGG - Intergenic
913100095 1:115555776-115555798 CTGTGTTAGCACTGTGACCAAGG - Intergenic
913277744 1:117155644-117155666 CTGTGTAAGTACAGTGGCCTGGG - Intronic
914244393 1:145874930-145874952 CCGCGTCAGCTCCGTGGCTCAGG + Exonic
915142889 1:153777902-153777924 CTGTGTCAGCAGCTCTGCCCAGG - Intronic
915314893 1:155022940-155022962 CTGTGTCAGCACCGTGGCCCAGG - Intronic
919666509 1:200297893-200297915 CAGTGTCACCACCCTGGTCCAGG + Intergenic
920969379 1:210730092-210730114 CTGTGTCATCACAGTTGCTCTGG - Intronic
921185439 1:212665711-212665733 CTGTGGGAGCGCAGTGGCCCAGG - Intergenic
921261632 1:213389595-213389617 CAGTGTCACCCCCGAGGCCCGGG + Intergenic
922174190 1:223182304-223182326 CTGTGTCAGCACCCTGGAAGAGG - Intergenic
922413409 1:225397415-225397437 CTGTGTCAACAAGCTGGCCCAGG + Intronic
922440830 1:225653545-225653567 CGGTCTCCGCACCGTGGCCGTGG - Intergenic
922728541 1:227937944-227937966 CTGAGTCACCAGCGTGGTCCCGG - Intronic
924638024 1:245807205-245807227 CTGTGTAAGGAGAGTGGCCCTGG - Intronic
1062856328 10:781235-781257 CTCAGCCAGCTCCGTGGCCCTGG + Intergenic
1063586570 10:7358133-7358155 CTGTGACATCAACATGGCCCTGG + Intronic
1066616707 10:37302118-37302140 CTGTGTCAGCGCAGTGCCTCAGG + Intronic
1066802519 10:39207022-39207044 CTGTTTCAGAAGCCTGGCCCAGG + Intergenic
1075542411 10:123325964-123325986 CTGGCTCAGTTCCGTGGCCCAGG + Intergenic
1083855053 11:65389216-65389238 CTGTCTCAGGAGCGTAGCCCTGG + Intronic
1084661857 11:70550753-70550775 CTGGGAGAGCCCCGTGGCCCAGG - Intronic
1085270830 11:75268946-75268968 CTGTTTCAGCGACGTGGCCGTGG - Exonic
1089695345 11:120212782-120212804 CAGTGCCAACTCCGTGGCCCTGG - Intronic
1090393582 11:126405246-126405268 CAGTGACTGCAGCGTGGCCCTGG + Intronic
1090995249 11:131860292-131860314 CTGTGTCCTCACCATGGCACAGG - Intronic
1091457487 12:618608-618630 GTCTGACAGCACTGTGGCCCAGG + Intronic
1093877115 12:24361912-24361934 CTGTGTCATCAGCGTAGCTCTGG - Intergenic
1096840010 12:54374381-54374403 CTGAGTCAGCAGCCAGGCCCTGG - Intronic
1097316753 12:58180038-58180060 ATATGTCAGCACTGTGGCCTAGG + Intergenic
1101998847 12:109544252-109544274 CTGTGGCAGCAACGTGGGCTGGG - Intergenic
1102509680 12:113405914-113405936 CTTTTTCACCACCGTGGCCTGGG + Intronic
1102766808 12:115440567-115440589 ATGTGTCAGCTCGGGGGCCCAGG - Intergenic
1104765632 12:131328278-131328300 CCGTGTCAGCAGCATTGCCCCGG + Intergenic
1104800838 12:131554449-131554471 CAGTGGCAGCACCGGGGCCCAGG + Intergenic
1104813689 12:131633774-131633796 CCGTGTCAGCAGCATTGCCCCGG - Intergenic
1104918462 12:132278454-132278476 CCGTGTCAGCACCGGCTCCCGGG - Intronic
1106487793 13:30188009-30188031 CTGTGCAGGCACCATGGCCCTGG + Intergenic
1107291650 13:38861433-38861455 CTTTGTCAGCCCCGTGTACCTGG + Exonic
1112780544 13:102895967-102895989 CTCTATCAGCACCCAGGCCCTGG + Intergenic
1117859238 14:60072988-60073010 CTGTGGCAGCAGCATGGCACTGG - Intergenic
1117986850 14:61395317-61395339 CTGTGGCAGCAACCTGGACCTGG + Intronic
1118690239 14:68331621-68331643 CTGTCTCAGCGATGTGGCCCAGG - Intronic
1119435405 14:74594957-74594979 CTGTGCCAGGACCATGGCTCAGG + Intronic
1122965145 14:105120008-105120030 CTCTGTCAGCTCTGTGGCCATGG + Intergenic
1123704094 15:22938552-22938574 CTGTGTCCGCACCATTGCACTGG + Intronic
1124338109 15:28872456-28872478 ATGTGCCAGCACCTTGGCCTTGG + Intergenic
1124861266 15:33444179-33444201 CTGTGACAGCCTCTTGGCCCTGG - Intronic
1128783776 15:70379972-70379994 CTGGGTCAGGACCATGGCTCAGG + Intergenic
1130095984 15:80856655-80856677 CTGTCACAGCTCCCTGGCCCTGG + Intronic
1130225728 15:82057046-82057068 ATCTGTCAGCACATTGGCCCTGG - Intergenic
1131977527 15:97961086-97961108 CTCGGCCAGCACCGCGGCCCTGG + Exonic
1132701542 16:1224308-1224330 CAGCGTCCCCACCGTGGCCCTGG - Intronic
1134490324 16:14691352-14691374 CTGTGGCAGCTCCCGGGCCCTGG + Intronic
1134495705 16:14730469-14730491 CTGTGGCAGCTCCCGGGCCCTGG + Intronic
1134501252 16:14770780-14770802 CTGTGGCAGCTCCCAGGCCCTGG + Intronic
1134579328 16:15358254-15358276 CTGTGGCAGCTCCCAGGCCCTGG - Intergenic
1134723254 16:16399300-16399322 CTGTGGCAGCTCCCAGGCCCTGG + Intergenic
1134944174 16:18312570-18312592 CTGTGGCAGCTCCCAGGCCCTGG - Intergenic
1135002634 16:18789986-18790008 CTGAGGCAGCGCCTTGGCCCCGG - Intronic
1136165598 16:28450912-28450934 CTGTGGCAGCTCCCGGGCCCTGG - Intergenic
1136197374 16:28664097-28664119 CTGTGGCAGCTCCCGGGCCCTGG + Intergenic
1136213713 16:28778244-28778266 CTGTGGCAGCTCCCGGGCCCTGG + Intergenic
1136258447 16:29058168-29058190 CTGTGGCAGCTCCCGGGCCCTGG + Intergenic
1136320048 16:29478148-29478170 CTGTGGCAGCTCCCGGGCCCTGG - Intergenic
1136434619 16:30217489-30217511 CTGTGGCAGCTCCCGGGCCCTGG - Intergenic
1137056262 16:35747974-35747996 CTGTGCCCCCACCATGGCCCGGG + Intergenic
1137056620 16:35749247-35749269 CTGTGCCCCCACCGCGGCCCGGG + Intergenic
1137382835 16:48014546-48014568 CTGTGTCAGCACCTTGGAGAGGG + Intergenic
1138093407 16:54194402-54194424 CTGTGACAGCGACGTGGGCCGGG + Intergenic
1140315380 16:73891348-73891370 ACGTGTCAGCAACGCGGCCCAGG + Intergenic
1141294887 16:82758392-82758414 CTGTGTCACCACCTTGGCCCAGG + Intronic
1142903525 17:3027610-3027632 CTGGGTCAGCCCCGGGCCCCGGG + Intronic
1143405490 17:6674801-6674823 CTGGCTCAGCCCCGAGGCCCAGG - Intergenic
1143724436 17:8835746-8835768 CTCTCTCAGCATCCTGGCCCAGG + Intronic
1148125019 17:45231944-45231966 CTGTGTCAGGGCTGTGGCCTGGG + Intronic
1148670404 17:49405747-49405769 TTGTGACAGCTCTGTGGCCCAGG - Intronic
1148719188 17:49738620-49738642 CTGTGCCAGCACCCTGTGCCAGG - Intronic
1149667361 17:58374737-58374759 CTGTGTGGGCACCGTAGCCATGG - Intronic
1152392574 17:80011440-80011462 CTGTGTGAGCCCAGCGGCCCAGG + Intronic
1152852247 17:82644278-82644300 CTGTGGCATCCCCATGGCCCAGG + Intronic
1152855922 17:82664406-82664428 CCCTGTCAGCACAGTGCCCCGGG - Intronic
1153109071 18:1561952-1561974 CAGTGACAGCACCTTGACCCTGG + Intergenic
1160794294 19:937353-937375 GTGCATCAGCACCGTGGCCTGGG + Intronic
1161317688 19:3625816-3625838 CTGAGCCAGCACTGGGGCCCCGG + Intronic
1161465687 19:4429015-4429037 CTGAGCCAGCACCGAAGCCCAGG - Intronic
1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG + Intergenic
1161594210 19:5142916-5142938 CCGAGCCAGCACCGGGGCCCTGG - Intronic
1162502951 19:11064936-11064958 CTGAGTCAGCACCTCTGCCCGGG + Intronic
1163415045 19:17181212-17181234 CTCTGTCTGCACTGTGGCCCAGG + Intronic
1163658605 19:18562826-18562848 CTGTGTCTGCACAGTGCCCAGGG + Intronic
1168153272 19:54460396-54460418 CTGGGTCCCCACGGTGGCCCTGG + Intronic
1168245852 19:55112885-55112907 CTGTCCTAGCACCGTGTCCCTGG - Intronic
1168629673 19:57947222-57947244 CTGTGTCACCTCTGTGCCCCAGG + Intronic
925535395 2:4911170-4911192 ATGTGCCAGCACCTTGGCCTTGG - Intergenic
927790037 2:26002633-26002655 GTGTGTCAGCAGGGTGGGCCTGG + Intergenic
929643769 2:43607460-43607482 CTGTATAAGCAGCATGGCCCTGG + Intergenic
930878903 2:56249796-56249818 CTGTGTCTACACCTGGGCCCTGG + Intronic
932455913 2:71849903-71849925 CTGTGACAGCCCCATAGCCCTGG - Intergenic
932595909 2:73093364-73093386 ATCTGGCAGCACCGTGCCCCAGG + Intronic
934993213 2:98935938-98935960 CTGGGACAGGAGCGTGGCCCGGG + Exonic
946826688 2:223686359-223686381 CTGTTTCAGCACCGTGGCAAGGG - Intergenic
947220400 2:227786303-227786325 CTGGGTAAGCACCCTTGCCCAGG - Intergenic
947968374 2:234301487-234301509 TTGTGTCAGCACGGAGGCCCCGG - Intergenic
948042808 2:234917047-234917069 CTTTCTGAGCACTGTGGCCCTGG - Intergenic
948628325 2:239284364-239284386 CTGGGTCAGCACAGTGGCTCAGG - Intronic
949045155 2:241869527-241869549 CTGTGGCAGCACCGTGGTGGTGG - Intergenic
1168961899 20:1875820-1875842 CTGTGTCAGAACCCAGGCCTTGG + Intergenic
1172599877 20:36176263-36176285 CTGTGTCACCACCATGGGGCAGG - Intronic
1174054692 20:47789923-47789945 CTGTGTCAGCGTGCTGGCCCAGG - Intergenic
1176264355 20:64201057-64201079 CTTTGTCTCCACCGTGTCCCTGG - Intronic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1179716431 21:43291082-43291104 CAGTGTCAGCACCCGGGCACGGG - Intergenic
1180190081 21:46158776-46158798 CTGGGGCAGCACCCGGGCCCTGG - Intergenic
1182147430 22:28005304-28005326 CCCTGTCATCACCGTGCCCCAGG - Intronic
1182413592 22:30206859-30206881 CAGTTGCAGCACAGTGGCCCTGG - Intergenic
1183363714 22:37396331-37396353 CTGTGTCCCCACCATGTCCCCGG + Intronic
1183875247 22:40774951-40774973 CAGTGCCACCACCGTGGTCCAGG + Intronic
1184661482 22:45967504-45967526 CTGGCTCCGCACCCTGGCCCTGG + Intronic
1185004399 22:48267242-48267264 CTGTCTCAGCACTGTGTGCCAGG - Intergenic
1185222182 22:49634640-49634662 CTGGGTCTCCACGGTGGCCCCGG - Intronic
1185222677 22:49636827-49636849 CTGTGTCAACACCGAGGGGCGGG - Intronic
950413307 3:12853233-12853255 CTGTGTCAGCAGGATGGCCTTGG - Intronic
951045541 3:18033860-18033882 TTGTATCAGCACAGTGCCCCAGG - Intronic
953246621 3:41199517-41199539 CTGTGGCAGCAGCGTTGGCCCGG + Exonic
954600416 3:51863307-51863329 CTGTGACCACACAGTGGCCCTGG - Exonic
954960210 3:54557971-54557993 CTGTGTCTGCCCACTGGCCCTGG + Intronic
955393390 3:58537135-58537157 CTGTGTCCGCACTGTAGGCCGGG + Exonic
956195482 3:66649892-66649914 CTGTGTCATCCTCCTGGCCCAGG - Intergenic
956718394 3:72098218-72098240 CTGCCTCAGCACCATGGCTCAGG - Intergenic
956865635 3:73366220-73366242 CCGTGTCTGCAGCGTGGCCCTGG + Intergenic
960038643 3:113127133-113127155 CTGTGTCAGCACCTGGGGCATGG - Intergenic
961200848 3:125043954-125043976 CTGTGTGGACACCGGGGCCCGGG - Intronic
962369305 3:134807603-134807625 CTGAGACAGCACTGTTGCCCTGG - Intronic
969726167 4:8919746-8919768 CTGTGTGAGCACCTTGACCTGGG + Intergenic
974047383 4:56908698-56908720 TTGAGTCAGCCCCGGGGCCCGGG + Intronic
977203260 4:94140968-94140990 CTGTGAAAGCACAGTGGCCTGGG - Intergenic
983940325 4:173529714-173529736 CGGTGCCAGGACCGCGGCCCGGG - Exonic
984698885 4:182806058-182806080 CTGAGTCATCAACGTCGCCCTGG - Intergenic
984909684 4:184661678-184661700 CTGAGTCAGCTCTGTTGCCCAGG - Intronic
985586973 5:745524-745546 CTGAGTCAGCACCGTTCCCCAGG - Intronic
992694108 5:79267694-79267716 CTGGGTGGGCACTGTGGCCCAGG - Intronic
992897540 5:81258572-81258594 CTGTACCAGGTCCGTGGCCCCGG - Intronic
996811482 5:127520345-127520367 CTCTGTCTGCCCAGTGGCCCAGG + Intronic
1001072823 5:168601503-168601525 CTCTGTCAGCACCTTGATCCTGG - Intergenic
1002765202 6:233293-233315 CTCTGCCAGCACCGTGGTCTGGG + Intergenic
1002940670 6:1712952-1712974 TTGTGTCTGCCCCGTGTCCCTGG - Intronic
1004476869 6:15981467-15981489 TTGTGTCAGCACCTTGGGGCAGG + Intergenic
1007145738 6:39628445-39628467 CTGTGTCTTCACTGTGGCTCTGG - Intronic
1007918726 6:45586679-45586701 CAGTGTCAGCAACTTGACCCTGG + Intronic
1008718471 6:54318817-54318839 CTGTGTCAACACCTTGACCGGGG + Intronic
1009057765 6:58358644-58358666 CTGAGTCAGCACAGTGACTCTGG - Intergenic
1012290533 6:97450369-97450391 CTGTGTCAGCTCCAGGGCCCAGG - Intergenic
1018206929 6:161445142-161445164 CTGTGTCAGCGCCGCGGCTTTGG - Intronic
1018415692 6:163600550-163600572 CTGTGTGAGCGCCGTGCCCCAGG + Intergenic
1018920401 6:168168359-168168381 CGGTGGCTGCAGCGTGGCCCTGG + Intergenic
1019109109 6:169695646-169695668 CTCTGTCACCACCGTGCCCCGGG - Intronic
1019180036 6:170180978-170181000 CGGTGCCAGCGCAGTGGCCCAGG - Intergenic
1023908056 7:44536174-44536196 CTGTGTCCCCATCCTGGCCCTGG - Intronic
1023983100 7:45080921-45080943 CTGAGTCAGCACCCAGGCCCCGG - Exonic
1034275186 7:149820916-149820938 CTGTGACTGCACCGATGCCCAGG + Intergenic
1034364649 7:150535990-150536012 CTGTGTCTGCAAGGTGGCCCTGG - Intergenic
1035248561 7:157581368-157581390 CTGTGCCAGCTCTGTGGGCCTGG + Intronic
1035601454 8:899365-899387 CCTTCTCAGCAGCGTGGCCCAGG - Intergenic
1035716987 8:1763124-1763146 CTGTGTCCTCACCGAGCCCCGGG + Intronic
1039620505 8:38992865-38992887 CTGTGTCAGCACAGTGGATAAGG - Intronic
1040016759 8:42706485-42706507 CTGTGCCCTCAGCGTGGCCCCGG + Intronic
1041714791 8:60923252-60923274 CTGTGTCTGCAGAGGGGCCCGGG - Intergenic
1043519236 8:81026503-81026525 GTGTGTCATCATCGTGGCTCGGG - Intronic
1047619263 8:126589624-126589646 CTGTGTAAGCCCTGTGGCCACGG + Intergenic
1049203682 8:141353641-141353663 CTCTGTGGGCACCGAGGCCCAGG - Intergenic
1049216519 8:141410799-141410821 CTGTGTGAGGACAGTGGCCATGG + Intronic
1049345094 8:142134458-142134480 CTGTGTCAGAGCCGTGGTGCAGG + Intergenic
1049422801 8:142524362-142524384 ATGAGACAGCACCGAGGCCCAGG - Intronic
1049455127 8:142682774-142682796 CTGTGTCTGGACCAGGGCCCTGG + Intergenic
1052851879 9:33383570-33383592 ATGGGTCAGCACCGTGGGCGTGG - Intergenic
1053309928 9:37011466-37011488 CTATTCCAGCACCGTGGCCAAGG - Intronic
1053679985 9:40480105-40480127 ATGGGTCAGCACCGTGGGCATGG - Intergenic
1053929981 9:43108415-43108437 ATGGGTCAGCACCGTGGGCGTGG - Intergenic
1054283727 9:63144830-63144852 ATGGGTCAGCACCGTGGGCGTGG + Intergenic
1054293066 9:63315615-63315637 ATGGGTCAGCACCGTGGGCGTGG - Intergenic
1054504636 9:65896218-65896240 ATGGGTCAGCACCGTGGGCGTGG + Intergenic
1057239546 9:93396675-93396697 CTGTGCCTGCACCTTTGCCCAGG + Intergenic
1058824483 9:108762489-108762511 CTGACTCAGCACCCAGGCCCGGG + Intergenic
1061478710 9:130885776-130885798 GTGAGTCAGCACCTTGGCCCAGG + Intronic
1061713891 9:132506540-132506562 CTGTGTCTTGACTGTGGCCCAGG - Intronic
1062050926 9:134446688-134446710 CTGTGGAAGAACCGTAGCCCAGG + Intergenic
1062207114 9:135343269-135343291 CAGTGTGGGCACCGCGGCCCGGG + Exonic
1062282754 9:135759312-135759334 CTGTGTCATCAGCGTGGGCTTGG - Intronic
1062350730 9:136137470-136137492 CTGTGCCAGAACCATGACCCTGG - Intergenic
1062427182 9:136511422-136511444 CTGTGCCAGGACCCTGACCCAGG + Intronic
1062431530 9:136528763-136528785 CTGTGGCAGGACAGTGGGCCGGG - Intronic
1190234000 X:48602135-48602157 CTGGGTCAGCCGCGAGGCCCGGG + Exonic
1190265813 X:48826744-48826766 CGGTGTGAGCAGCGTCGCCCGGG - Intergenic
1200344489 X:155435264-155435286 GTGTGTCAGCCCCAAGGCCCTGG - Intergenic
1200832823 Y:7704253-7704275 CTGTGTCACCATGGTGCCCCTGG - Intergenic
1201479767 Y:14427253-14427275 CTGTGACATCATCGTGGCCTGGG + Intergenic
1202115261 Y:21465659-21465681 CTGAGACACCACCGAGGCCCAGG + Intergenic