ID: 915319323

View in Genome Browser
Species Human (GRCh38)
Location 1:155047641-155047663
Sequence ACAGGGCAGTTCTGCAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 239}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915319317_915319323 6 Left 915319317 1:155047612-155047634 CCACATTGGGCCCAGCGGCTACA 0: 1
1: 0
2: 0
3: 7
4: 86
Right 915319323 1:155047641-155047663 ACAGGGCAGTTCTGCAGTGAGGG 0: 1
1: 0
2: 1
3: 24
4: 239
915319318_915319323 -4 Left 915319318 1:155047622-155047644 CCCAGCGGCTACAGTACTGACAG 0: 1
1: 0
2: 1
3: 4
4: 53
Right 915319323 1:155047641-155047663 ACAGGGCAGTTCTGCAGTGAGGG 0: 1
1: 0
2: 1
3: 24
4: 239
915319319_915319323 -5 Left 915319319 1:155047623-155047645 CCAGCGGCTACAGTACTGACAGG 0: 1
1: 0
2: 1
3: 1
4: 68
Right 915319323 1:155047641-155047663 ACAGGGCAGTTCTGCAGTGAGGG 0: 1
1: 0
2: 1
3: 24
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915319323 Original CRISPR ACAGGGCAGTTCTGCAGTGA GGG Intronic
900076332 1:820753-820775 ACAGGGTAGTTCTGCTGTATAGG - Intergenic
900462339 1:2807686-2807708 ACAGGGCTGTTCTGCAGGTGGGG - Intergenic
900788365 1:4663884-4663906 AAAGGGCAGTTTTGCAGTACTGG - Intronic
901127836 1:6941724-6941746 TCTGGGCAGTCCTGCAGTGCAGG + Intronic
901335785 1:8447877-8447899 ACAGGGTAGTTCTGCTGTCTGGG + Intronic
901336526 1:8454067-8454089 ACAGAGCATGGCTGCAGTGATGG + Intronic
901416003 1:9117351-9117373 ACAGGGCAGTTCTCCAGCCAGGG + Intronic
902377887 1:16038642-16038664 TCAGGGCGGTTCTGCAGATATGG - Intergenic
903847971 1:26289773-26289795 CCTGGGCACTTGTGCAGTGAGGG - Intronic
903861545 1:26367689-26367711 ACCGGGCAGGTCTGCACTGCTGG - Exonic
904334944 1:29790861-29790883 ACAGGGCAGCTCTGAAGAGGAGG - Intergenic
912232103 1:107806178-107806200 GCAGGGCAGGTCTCCTGTGAGGG + Intronic
915319323 1:155047641-155047663 ACAGGGCAGTTCTGCAGTGAGGG + Intronic
915822871 1:159043911-159043933 ACATGGCAGATCTGAAGAGAGGG + Intronic
915823236 1:159048068-159048090 ACATGGCAGATCTGAAGAGAGGG + Intronic
917008343 1:170441687-170441709 CCAAGGCAATTCTGCAGAGAAGG + Intergenic
917540611 1:175910271-175910293 CCAAGGCAGTTCTATAGTGAAGG + Intergenic
918207008 1:182318378-182318400 ACATGGCAGCCCTCCAGTGAAGG - Intergenic
918263860 1:182821917-182821939 ACTGAGCAGTACTGCAGAGAAGG - Intronic
918378869 1:183935177-183935199 TCAGGGCAGCTCTGCTGAGAAGG - Intronic
920003660 1:202816707-202816729 ACTGGGCAGTACTCCAGAGAAGG - Intergenic
921898318 1:220424095-220424117 CCAGGGCAGTCCTGCGGTAAGGG + Intergenic
922152335 1:223017107-223017129 ACTGGGCAGATCTGCAGGGCTGG - Intergenic
922221881 1:223614628-223614650 GCAGGTCAGATCTGCTGTGATGG - Intronic
923312333 1:232747156-232747178 ACAGGGGAGGCCTGCAGTGATGG + Intergenic
924567439 1:245210337-245210359 ACAGGCCCACTCTGCAGTGAGGG + Intronic
1065867603 10:29927378-29927400 AGAGGGCAGTAATGCAGTGGAGG - Intergenic
1067031216 10:42879682-42879704 ACAGGGCAGGGCTGAAGTGCAGG + Intergenic
1067726214 10:48773223-48773245 GGAGGGCAGTTCTGCAGAGAAGG + Intronic
1068926069 10:62540005-62540027 ACAGGGAATTTTGGCAGTGATGG + Intronic
1070646005 10:78203015-78203037 CAGGGGCAGTTCTGCAGGGATGG + Intergenic
1071865167 10:89721617-89721639 AGAGTGCAGTAGTGCAGTGATGG - Intronic
1072004140 10:91226656-91226678 ACAGGGCAGCCCAGCAGTGCTGG - Intronic
1072257541 10:93634377-93634399 ACAGGACAGTCTTGTAGTGATGG + Intronic
1073102124 10:101011911-101011933 GCAGGGCAGGTCAGCAGTGGGGG - Intronic
1073342659 10:102757477-102757499 ACAGTACTGTGCTGCAGTGAGGG + Intronic
1074916378 10:117960006-117960028 ACAGTGCAGATGAGCAGTGAAGG + Intergenic
1076454306 10:130578758-130578780 GCAGGGTAGTCCTGGAGTGACGG + Intergenic
1077434459 11:2532131-2532153 ACAGGGCAGGTCGGCGGGGATGG - Intronic
1077712914 11:4554043-4554065 ACAGGGCAGTTCCTCAGCAAAGG + Intergenic
1078361700 11:10674465-10674487 ACTGGGAAGCTCTGGAGTGAGGG - Intronic
1079106334 11:17574708-17574730 ACAGGACAGTGCTGCAGTGAGGG - Exonic
1079602282 11:22324350-22324372 ACAAGGCTGTTCTGTAGTAAAGG - Intergenic
1080621136 11:33988077-33988099 GCAGGGGAGTTTTGCAGAGAAGG - Intergenic
1081300625 11:41446575-41446597 CCAGGGCAGTTCTCCAATGGAGG + Intronic
1084360353 11:68664998-68665020 TGAGGGCAGTTCTGCAGAAAGGG + Intergenic
1085370278 11:75997149-75997171 AAAAGGCATTTCTGCAGGGAAGG + Intronic
1085388617 11:76171064-76171086 ACAGGGCAGCTCTGCAGGTGAGG + Intergenic
1085703113 11:78762796-78762818 ATATGGCTGTTCTACAGTGAGGG + Intronic
1086956822 11:92942245-92942267 AAAGGGCAGTGCATCAGTGAAGG - Intergenic
1087399919 11:97652112-97652134 ACAGAGCAGTTGTGCTGTAATGG + Intergenic
1089384103 11:118056778-118056800 ACAGGCCAATTCTGCAGAGAAGG + Intergenic
1089403685 11:118180365-118180387 ACAGGGCAGAATTGCAGGGAAGG + Intergenic
1089560760 11:119341974-119341996 ACAGGCCAGCTCTGCAGGGGTGG + Exonic
1090399328 11:126438920-126438942 GCAGGGCAGTTGTGCAGGGAGGG - Intronic
1090722151 11:129485569-129485591 ACAAGCCCGTTCTGCAGAGAAGG + Intergenic
1091387087 12:102481-102503 CCACTGCAGTGCTGCAGTGAAGG - Intronic
1091404840 12:202768-202790 CCAGGGCAGCTCAGAAGTGAAGG + Exonic
1093464347 12:19434828-19434850 ACAGGGAAACTCTCCAGTGATGG + Intronic
1099012671 12:77310216-77310238 ACAGGATAGTTCTTTAGTGAAGG + Intergenic
1099356453 12:81641725-81641747 ACAGGGCAGTTCTGCTGATGTGG - Intronic
1100411321 12:94322444-94322466 ATAGAGCAGTTGTGCTGTGAGGG + Intronic
1101052110 12:100874246-100874268 ACAAGGCAGTGCCCCAGTGAAGG - Intronic
1101446063 12:104737768-104737790 ACCAGGCAGTTTTGCAGGGAGGG + Intronic
1101602885 12:106225734-106225756 AGAGGGCAGTGCTGCCGTCATGG + Intergenic
1102037110 12:109777311-109777333 CCAGACCACTTCTGCAGTGAAGG - Intergenic
1102278651 12:111601030-111601052 ACAGGCCAGGGCTGCTGTGAGGG + Intergenic
1102741235 12:115209309-115209331 ACAGGGCAGTCCTCCAATGCTGG - Intergenic
1105699878 13:22927600-22927622 AGTGGCCAGTTGTGCAGTGATGG - Intergenic
1109200265 13:59422927-59422949 ACAGGGCAGGACTGCAGAGGAGG + Intergenic
1110373153 13:74762015-74762037 ACATTGTTGTTCTGCAGTGAAGG + Intergenic
1113158639 13:107354198-107354220 ACAGGGCAGTGCTGAAGGAAAGG + Intronic
1115742622 14:36404194-36404216 ATAGGGCAGGGCTACAGTGAGGG - Intergenic
1119281932 14:73416821-73416843 AGAGGGCAGTTCTCCAGCAAAGG + Intronic
1121104712 14:91272785-91272807 CCGGGGCAGGGCTGCAGTGAGGG - Exonic
1121432812 14:93899549-93899571 ACAGGTCAGTACCGCAGTGGTGG - Intergenic
1121452366 14:94017143-94017165 ACAGGACAGTTCAGTAGTAAAGG + Intergenic
1121729019 14:96173541-96173563 ACAGGGCAGCTCTGTAGAGGTGG + Intergenic
1122841378 14:104465533-104465555 AGTGGGCAGTTGTGCAGTGATGG - Intergenic
1125168976 15:36744111-36744133 ACAGAGGAATTCTGCAATGAGGG + Intronic
1125520054 15:40343506-40343528 AAAGGGCAGTTCTGGAGGGGTGG - Intergenic
1127283758 15:57514967-57514989 ACAGGGCAGTACTGGCATGAGGG - Intronic
1127509143 15:59623185-59623207 GGAGTGCAGTGCTGCAGTGATGG + Intronic
1128662566 15:69513066-69513088 ACAGAGCAGAGCTGGAGTGATGG + Intergenic
1130003052 15:80064689-80064711 AGAGGGCAGTGGTGCAGTCATGG + Intronic
1132326294 15:100973298-100973320 CCAGGGCAGGTCTGGAGTGAGGG + Intronic
1132677826 16:1127888-1127910 TCCGGGCAGTTCTGCAGTTAGGG + Intergenic
1134303506 16:13012306-13012328 CCAGGTCACTTCTGCAGAGAGGG - Intronic
1135325593 16:21523554-21523576 GGAGCACAGTTCTGCAGTGATGG - Intergenic
1135828933 16:25755759-25755781 AGAGGGCAGTTTTGCTTTGATGG - Intronic
1137830285 16:51537693-51537715 CAAAGGCAGTTCTTCAGTGAGGG - Intergenic
1138377128 16:56571974-56571996 ACAGAGCAGTACTGCAGTCAGGG + Intergenic
1139186320 16:64810061-64810083 TAATGGCATTTCTGCAGTGAGGG - Intergenic
1140047286 16:71449605-71449627 AGAGGGCTGCTCTCCAGTGATGG + Exonic
1142038591 16:87878132-87878154 GGAGCACAGTTCTGCAGTGATGG - Intergenic
1142038628 16:87878320-87878342 GGAGCACAGTTCTGCAGTGATGG - Intergenic
1143928528 17:10395616-10395638 ATAGGGCAGCTCTGCAATAAAGG + Intronic
1144629661 17:16864540-16864562 ACAGGGCTGTGGTGGAGTGAAGG + Intergenic
1144651767 17:17011577-17011599 ACAGGGCTGTGGTGGAGTGAAGG - Intergenic
1146224589 17:31054588-31054610 AGAGGGCAGTGGTGCAATGACGG + Intergenic
1147586082 17:41654687-41654709 ACAGTGCAGGGCTGCAGTGGTGG + Intergenic
1150577964 17:66446674-66446696 ACAGGGCAGTGCTGCCTTGGAGG - Intronic
1153753582 18:8258390-8258412 TCAGGGCAGAGCTGCAGTCATGG - Intronic
1153839280 18:8991352-8991374 ATAGGGCAGATCTGCAAAGATGG - Intergenic
1155032645 18:21997526-21997548 ACTGGGCAGCTCTCCTGTGAGGG - Intergenic
1155601067 18:27548318-27548340 ACTGGGGACTTCTGCACTGATGG + Intergenic
1155619226 18:27757300-27757322 ACAGTGCATTTCTGCAGGCATGG - Intergenic
1155918223 18:31577022-31577044 ACAGGGCAGAACTTCAGGGATGG - Intergenic
1156711128 18:39947047-39947069 ACCCTGCAGTTGTGCAGTGATGG - Intergenic
1157414088 18:47487784-47487806 ATAGAGCAGGTCTGCAGTGAAGG - Intergenic
1158996263 18:62923258-62923280 ACAGGAGAGTTCTGGAGTAAAGG + Intronic
1161866370 19:6835370-6835392 ACAGTGCAGTTCTGGAGGGATGG - Intronic
1161943641 19:7420979-7421001 GGAGGGCAGTGGTGCAGTGATGG + Intronic
1162923989 19:13920548-13920570 ACAGGGCTGTTCTGCTGTAGAGG - Exonic
1166340455 19:42133878-42133900 ACAGGGCACGTGTGCAGTCAGGG - Intronic
1166748015 19:45151145-45151167 ACAGGGAAGTTGGGCAGAGATGG - Exonic
1168600082 19:57710506-57710528 ACAGGGCATTTCAGCATTGGAGG + Intronic
925270736 2:2605488-2605510 ACAGAACAGTGCTGCAGTCAAGG + Intergenic
926550722 2:14298045-14298067 ACATGGAAGTTCTGCATTGCTGG + Intergenic
927670169 2:25062497-25062519 CCAGGGCTGTTTTGCAGTGCTGG + Intronic
927872494 2:26632430-26632452 ACTGGACACTTCAGCAGTGATGG - Intronic
929036110 2:37693583-37693605 AAACGGCAGTCCTGCAGAGAAGG + Intronic
929416992 2:41753821-41753843 CAAGGGCAGTTCTCCAGGGAAGG - Intergenic
930984672 2:57570715-57570737 GCAGGTCTGTCCTGCAGTGAAGG + Intergenic
932851035 2:75187102-75187124 GCAGGGCAGTGCTGCTGAGATGG - Intronic
933409810 2:81910565-81910587 AGAGGGCAGTTCTCCAGCAAAGG - Intergenic
934615158 2:95765983-95766005 AGTGGGAAGTCCTGCAGTGATGG + Intergenic
935237113 2:101148903-101148925 ACAGGGCAGCTCTGTGGTGGTGG - Intronic
935320202 2:101879680-101879702 ACAGGGCAGTTTTGGGGTGCTGG - Intronic
935878422 2:107536537-107536559 ACAGTGCAGTGGTGGAGTGAAGG + Intergenic
935920784 2:108010905-108010927 ATAGGGTAGTTCTGGAGAGATGG + Exonic
936589414 2:113788854-113788876 ACATGGCTGGTCTGCAGAGAGGG + Intergenic
937574253 2:123399904-123399926 ACAGGGCTTTTCTTCAGTCAGGG + Intergenic
943096560 2:183436203-183436225 AAAGGGCAGGTCTGCTGGGAGGG - Intergenic
944221578 2:197309863-197309885 ACAGGGCAGCTCTGGAGTCCTGG - Intronic
944286423 2:197955289-197955311 ACACTGCAGCTTTGCAGTGATGG + Intronic
947628050 2:231633409-231633431 CCAGAGCAGCTCAGCAGTGAGGG + Intergenic
948091204 2:235297377-235297399 ACATGGCAGGTTTGCAGTGTGGG + Intergenic
948408659 2:237742330-237742352 AAAGGTCAGTCCCGCAGTGAGGG + Intronic
948607748 2:239146795-239146817 ACAGGGCAGTGGGGCTGTGATGG - Intronic
948889912 2:240902499-240902521 GCAGGGCAGCTCTGCAGAGAGGG + Intergenic
949048875 2:241886377-241886399 ACAGGGCGAATGTGCAGTGAAGG - Intergenic
1168995589 20:2130548-2130570 ACGGGGCAGCTCTCCAGTGTGGG + Intronic
1170963882 20:21049510-21049532 TGAGGACAATTCTGCAGTGAGGG - Intergenic
1173659670 20:44724666-44724688 TCTGGGCAGCTCTGCAGAGAAGG + Intronic
1174113926 20:48214272-48214294 ACAGGGCAGGTGTGCAGAGGCGG - Intergenic
1174167918 20:48598261-48598283 ACAGGGCAGGTGTGCAGAGGCGG + Intergenic
1175201476 20:57280820-57280842 ACAGGGCAGGGGTGCAGAGAGGG + Intergenic
1176510809 21:7746039-7746061 ACAGGGTATTTTTGCGGTGAAGG + Intronic
1177846136 21:26289566-26289588 AGAGGGCAGTGCTGCAATCACGG + Intergenic
1178644922 21:34376568-34376590 ACAGGGTATTTTTGCGGTGAAGG + Intronic
1178696749 21:34799311-34799333 ACTGGAAAGTTCTGCAGAGAGGG + Exonic
1179599032 21:42463543-42463565 ACAGGGCAGGTGTTCAGTGAGGG + Intergenic
1180606783 22:17064960-17064982 ACAGGCCAGTTCCGTAGTGTTGG - Intergenic
1182489834 22:30664192-30664214 GCTGGGTAGTTCTGCTGTGATGG - Intronic
1182685496 22:32119804-32119826 CCAGGGCAGTGCTGCAGCGGTGG - Intergenic
1183477737 22:38045172-38045194 TCACAGCAGTTCAGCAGTGAGGG - Intergenic
950206044 3:11081970-11081992 ACAGGGCATTTAGGCAGTGAAGG + Intergenic
950313888 3:11983422-11983444 ACAGAGCAGGTCTGAAATGATGG - Intergenic
951773171 3:26281321-26281343 TCAGGGAAGTTCTCCAGAGAAGG + Intergenic
952919369 3:38274573-38274595 ACAGGGCAGGTCTGTGGGGAGGG - Intronic
953377954 3:42444701-42444723 ACTGGGCAGTGCCCCAGTGAGGG - Intergenic
953785101 3:45905611-45905633 GCAGGGCGGCTCTGCAGTGGAGG - Intronic
954613873 3:51959778-51959800 GCAGGGCAGGGCTGCAGGGATGG - Intronic
956673460 3:71713316-71713338 AATGGGCAGCTCAGCAGTGAGGG - Intronic
959798613 3:110463168-110463190 ACAGGGCATTACTGCAGAGTAGG - Intergenic
960875724 3:122293301-122293323 ACAGGGCAGTTCAGTGGTGGTGG - Intergenic
963076054 3:141347143-141347165 GCATGGCATTTCTGCAGTCATGG + Intronic
963327889 3:143881907-143881929 ACATGGCAGGTTTGCAGAGATGG + Intergenic
963726841 3:148932385-148932407 AAAGGGCATTTCTGCAAGGAAGG - Intergenic
964154887 3:153573356-153573378 CCAGGGCAGTTTTACAGTGGTGG - Intergenic
964625923 3:158759873-158759895 ACAGGCCAATTCTGCAAGGAAGG + Intronic
966668461 3:182499565-182499587 ACAAGGCCATTCTCCAGTGAGGG + Intergenic
967269422 3:187720497-187720519 ACAGAGCACCTCTGCAGGGATGG + Intronic
968034766 3:195538104-195538126 ACATGGCAGATCTGCCATGATGG + Intronic
968706017 4:2078094-2078116 ACAGAGCAGTTCAGCAGGGCTGG - Intronic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
969237999 4:5880190-5880212 ACTGGGAATTTCTGCACTGAGGG + Intronic
969607143 4:8207995-8208017 ACAGGGTGGTTCAGCAGTGGCGG + Intronic
970568848 4:17359646-17359668 CCAGGGCAGTTCAGCTGTGCTGG - Intergenic
972411129 4:38795943-38795965 AAAGGGCAGTTCAGAAGTGCTGG - Intronic
972628354 4:40822212-40822234 ACAGGGTAGCCATGCAGTGATGG - Intronic
974610142 4:64206246-64206268 GCAGAGCAGTGCTGCAGAGAAGG - Intergenic
976132237 4:81896902-81896924 ACAAGGCAGTGTTGGAGTGAAGG - Intronic
976625042 4:87170960-87170982 ACAGAGAAGTTCTGCAGCGGAGG + Intronic
977925463 4:102695635-102695657 AGAGGGAAGTGCTGCAGTCAGGG - Intronic
979709991 4:123768195-123768217 AAAGGGTACTTCTGCACTGAGGG + Intergenic
979937802 4:126719547-126719569 ACAGGGAAGTTTGGGAGTGATGG - Intergenic
982646080 4:158026706-158026728 ACAGGGCAGCTGTGCTGTGCTGG - Intergenic
982971619 4:161995484-161995506 AAAGGGCATTTCTTCAGAGAAGG - Intronic
984471096 4:180175275-180175297 ACAGTGAAGTTTTCCAGTGAGGG - Intergenic
985580816 5:694255-694277 ACAGGGCGGTTCTGTGGTGCTGG + Intergenic
985595438 5:785587-785609 ACAGGGCGGTTCTGTGGTGCTGG + Intergenic
985958074 5:3279128-3279150 ACAGCACAGTTCTGCTGTAAAGG - Intergenic
989165906 5:38433445-38433467 CCAGGCCTGCTCTGCAGTGAGGG - Intronic
992111121 5:73495132-73495154 ACAGCCCAGTTCTGGAGTGCAGG + Intergenic
994254975 5:97581976-97581998 GGAGGGCACTTCTGCAATGAAGG + Intergenic
994332940 5:98528485-98528507 AAAGGGAACTTCTGCAGTGTGGG - Intergenic
994898784 5:105744121-105744143 ACAGGGCAGGTCCCCAGTGACGG + Intergenic
995935552 5:117507422-117507444 TCAGGACACTTCTGCAGTGGGGG + Intergenic
996039602 5:118795389-118795411 ACAGGGCAGGTGAGCAGTGCAGG + Intergenic
996095192 5:119391154-119391176 ACATGGCAGTTCTGGATTAAGGG + Intronic
996101563 5:119450310-119450332 AGAGGGCAGGTCCCCAGTGAGGG - Intergenic
997405408 5:133642350-133642372 TCAGTGCAGTTCTGCAGTGTGGG + Intergenic
1001073363 5:168605780-168605802 TGAGGGCAATTCTCCAGTGAAGG + Intergenic
1001246128 5:170106660-170106682 AGAGGGGAGCTCAGCAGTGAAGG + Intronic
1001246473 5:170108691-170108713 TCTGGGCAGTTCCGCAGTCATGG - Exonic
1002448724 5:179307171-179307193 CCGGGGCAGCTCTGCAGTGCGGG - Intronic
1002600267 5:180350448-180350470 TCAGGGCAGTGCTGCTGTGGAGG - Intronic
1006608258 6:35275350-35275372 ACAGGGCAGAGGGGCAGTGAGGG - Intronic
1006937600 6:37729173-37729195 CCAGGGCAGTTCTCCAAAGATGG + Intergenic
1009391913 6:63154734-63154756 ACTGGGAAGCTCTGAAGTGAAGG - Intergenic
1009748745 6:67855506-67855528 AGAGGGCATTTCTGCATTAATGG - Intergenic
1009755466 6:67933864-67933886 AAAGGATAGTTCTGCAGAGATGG + Intergenic
1012632646 6:101491436-101491458 AAAGGGCATTTTTCCAGTGAAGG - Intronic
1013845767 6:114449469-114449491 TCAGGACAGTTTTGGAGTGAAGG + Intergenic
1015113150 6:129616903-129616925 ACAGTGCAGTGGTGCAGTGACGG - Intronic
1015345336 6:132150326-132150348 AATGGGCAGCTCTGCAGTGGTGG + Intergenic
1016549007 6:145255857-145255879 AGAGGGCAGGTCCCCAGTGAGGG - Intergenic
1017690626 6:156960677-156960699 AAAGGGCAGTTCTAAAGTGAGGG + Intronic
1018509782 6:164512691-164512713 ACAGGGCACAACTGCAGTGTTGG + Intergenic
1021946788 7:25735583-25735605 TCTGGGCTGTTCAGCAGTGAAGG - Intergenic
1023865128 7:44234846-44234868 ACAGGGCTGTCCTGGGGTGATGG - Intronic
1024039743 7:45542877-45542899 ACAGTGCTGTTCTGGTGTGAAGG + Intergenic
1024837140 7:53534871-53534893 AAAGGGCAGATCTTCAGAGACGG - Intergenic
1026955075 7:74371976-74371998 GCAGGGCAGTTCTGAAGGGGCGG - Intronic
1028884128 7:95912369-95912391 GAAAGGCAGTTCTGGAGTGAAGG + Intronic
1029056801 7:97753632-97753654 ACAGGGCATTTCTGAAGTACTGG + Intergenic
1029677583 7:102081041-102081063 CCAGGGGAGTTCTGCTGTGATGG - Intronic
1029841111 7:103364372-103364394 AAATGGCACTTCTGCATTGAGGG + Intronic
1032248424 7:130232419-130232441 AAAGGGCAGGTCCCCAGTGAGGG - Intergenic
1032873812 7:136015449-136015471 ACAGGGAAATACTCCAGTGAGGG + Intergenic
1033507623 7:142021375-142021397 ACAGAGCACATCTGCAGAGATGG - Intronic
1035184061 7:157112066-157112088 GGAGGGCAGGTCTCCAGTGAGGG - Intergenic
1035535268 8:386223-386245 CAAGGGCAGGTCTGAAGTGAGGG - Intergenic
1036129841 8:6098800-6098822 ACAGGGTGGTTCTGCAGATATGG - Intergenic
1037007142 8:13796588-13796610 CCAGGGCAGTTGTAAAGTGAAGG + Intergenic
1037105410 8:15100923-15100945 ACAGTGCAGTAATGCAGTCATGG - Intronic
1038669004 8:29566487-29566509 GCAGTGCAGTTCTGCAGTGTGGG - Intergenic
1041268018 8:56083775-56083797 CCAGTGCAGTTCAGCAGTGAGGG + Intergenic
1041410663 8:57550667-57550689 ACAGGCCGGTTCTGCACTGAGGG + Intergenic
1041460671 8:58108439-58108461 TCAGGTCAGATCTGAAGTGAAGG - Intronic
1042700512 8:71607361-71607383 ACAGGGCAATTATGAACTGAAGG + Intergenic
1042733642 8:71963916-71963938 TCAGGGCAAGTCTTCAGTGATGG + Intronic
1042819764 8:72917057-72917079 AGAGGGTGGGTCTGCAGTGAGGG - Intronic
1043999834 8:86865737-86865759 AGAGGGCAGTTCCCCAGTAAAGG - Intergenic
1049611772 8:143559212-143559234 GCAGGGCTGTTCTGGAGGGAAGG + Intronic
1050074155 9:1846516-1846538 ACAGAGCAGATATGCAGTAAAGG + Intergenic
1050439978 9:5651195-5651217 ACAGAGCAGATCTCCAGTGTGGG - Intronic
1051875145 9:21785197-21785219 ACAGGGCAGGTCTGTGGTGCAGG - Intergenic
1053208715 9:36209645-36209667 ACAGGGCATGGCAGCAGTGATGG - Intronic
1054888198 9:70222238-70222260 ACAGAGCAGACCTGGAGTGAGGG + Intronic
1056925524 9:90830990-90831012 ACAGGGCTGCTTTGCATTGAGGG + Intronic
1057180976 9:93030145-93030167 ACAGGACAGTTTTGCACTCAAGG - Intronic
1057841043 9:98485837-98485859 TGAGGGCAGTTCTCCAGAGAAGG - Intronic
1060610548 9:124960404-124960426 ACATGGCAGTTGTACAGTGTTGG - Intronic
1188869821 X:35359744-35359766 AAAGAGCAGCTCTGCTGTGAAGG + Intergenic
1189294408 X:39908583-39908605 TCAGGGCAGTTCAGGAGTCATGG - Intergenic
1192738919 X:73874808-73874830 GCAGGGCAGTTGTGCTGTGCTGG - Intergenic
1194179312 X:90693411-90693433 AAAGGGCAGGTCTCCAATGAAGG - Intergenic
1195369592 X:104159748-104159770 AGAGTGCAATTCTGCAGAGAAGG - Intergenic
1199394008 X:147312637-147312659 ATAGGGCAGTTTTGCTGTGCTGG - Intergenic
1200525978 Y:4275584-4275606 AAAGGGCAGGTCTCCAATGAAGG - Intergenic
1202296938 Y:23368525-23368547 ACAGTGCAGTGGTGCAGTGATGG + Intergenic
1202573869 Y:26302072-26302094 ACAGTGCAGTGGTGCAGTGATGG - Intergenic