ID: 915321334

View in Genome Browser
Species Human (GRCh38)
Location 1:155057966-155057988
Sequence CACAGCTTGCCCGCCAGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915321334_915321340 28 Left 915321334 1:155057966-155057988 CCTGCGCTGGCGGGCAAGCTGTG 0: 1
1: 0
2: 0
3: 3
4: 95
Right 915321340 1:155058017-155058039 CCCAGCAGTGCCAGTCACTTTGG 0: 1
1: 0
2: 0
3: 19
4: 558
915321334_915321343 30 Left 915321334 1:155057966-155057988 CCTGCGCTGGCGGGCAAGCTGTG 0: 1
1: 0
2: 0
3: 3
4: 95
Right 915321343 1:155058019-155058041 CAGCAGTGCCAGTCACTTTGGGG 0: 1
1: 0
2: 0
3: 10
4: 206
915321334_915321342 29 Left 915321334 1:155057966-155057988 CCTGCGCTGGCGGGCAAGCTGTG 0: 1
1: 0
2: 0
3: 3
4: 95
Right 915321342 1:155058018-155058040 CCAGCAGTGCCAGTCACTTTGGG 0: 1
1: 0
2: 0
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915321334 Original CRISPR CACAGCTTGCCCGCCAGCGC AGG (reversed) Exonic
900226630 1:1536181-1536203 CACAGCTCACCCGCCCGCCCCGG + Intronic
904771692 1:32884675-32884697 CACAGCTGGCCCCCCAGGCCTGG + Intergenic
915321334 1:155057966-155057988 CACAGCTTGCCCGCCAGCGCAGG - Exonic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1062966597 10:1612025-1612047 CTCATCGTGCCCCCCAGCGCTGG - Intronic
1065725737 10:28666300-28666322 CGCAGCCAGCCCGCCAGCCCTGG + Intergenic
1070783149 10:79148977-79148999 CACACCCTGGCTGCCAGCGCAGG - Intronic
1074529355 10:114286472-114286494 CACAGCTTCCCCTGCAGCTCAGG - Exonic
1075754771 10:124801957-124801979 CCCGGCTTGGCCGCGAGCGCCGG - Intronic
1076690762 10:132222907-132222929 CACAGCACGCCGGCCAGCGCCGG + Exonic
1077075951 11:702266-702288 TAGAGCTTGCCCCCCAGGGCGGG + Intronic
1077339999 11:2021998-2022020 CACAGCTTGCACCCAAGGGCTGG - Intergenic
1080520996 11:33067780-33067802 CACAGCATGCCTGCCAGCATGGG + Intronic
1084125940 11:67099054-67099076 AACAGCTTGGCAGCCAGCACTGG - Intergenic
1202822984 11_KI270721v1_random:77187-77209 CACAGCTTGCACCCAAGGGCTGG - Intergenic
1095349093 12:41188495-41188517 CACAGTTTGCACTCCAGAGCCGG - Exonic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1110569869 13:76991963-76991985 CAGAGCTTGGCCCCAAGCGCAGG - Exonic
1114675884 14:24440209-24440231 GACAGCTTGCACCACAGCGCTGG + Exonic
1114782319 14:25551530-25551552 CACAGTTTGTCCTCCAGCTCTGG - Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1118220695 14:63852875-63852897 TAGAGCGCGCCCGCCAGCGCCGG - Intergenic
1121571489 14:94949863-94949885 CACTGCTTGCCAGGCAGAGCTGG + Intergenic
1128818373 15:70630413-70630435 CACAGCCTGTCCACCAGTGCAGG - Intergenic
1130763623 15:86847813-86847835 CACAGCTTTCCAGTCAGCTCAGG + Intronic
1131087475 15:89589010-89589032 CACTGCTTCCCCTGCAGCGCTGG - Intronic
1140258833 16:73359641-73359663 CACAGCTGGTCCGGCAGGGCTGG - Intergenic
1141667603 16:85474003-85474025 CACACCCTGCCCGCCTGTGCTGG - Intergenic
1142638730 17:1272685-1272707 CTCAGCGTGCCAGCCAGGGCTGG - Intergenic
1143137778 17:4721269-4721291 CACAGCTTGCCACCCACGGCGGG - Exonic
1146624687 17:34426307-34426329 CCCAGCTAGCCCACCAGCCCAGG - Intergenic
1153319016 18:3753269-3753291 CACAGCTAGCATGCCAGCACCGG - Intronic
1160519367 18:79495173-79495195 CACAGCCTGCACGCCACGGCGGG - Intronic
1160541634 18:79627218-79627240 CCCAGCTTGCTCGCTAGCCCCGG - Intergenic
1162914424 19:13866246-13866268 CCCAGCCTGCCCTCCAGGGCAGG - Intronic
1164955604 19:32380810-32380832 CTCAGCTTCCCAGCAAGCGCAGG - Intronic
1166089206 19:40497427-40497449 CCCTGCTTGCCCGCCGGCTCTGG + Intronic
1168265326 19:55220366-55220388 CCCAGCATGCCCCCCAGAGCTGG - Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
934680015 2:96276970-96276992 CACAACTGGCCCGCCACTGCAGG + Exonic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948060745 2:235041895-235041917 CTCAGCTTGACCTCCAGCACAGG - Exonic
1168790312 20:571899-571921 CACAGCTGGCCGGCCAGGGTGGG - Intergenic
1174404755 20:50295993-50296015 CCCAGCCTGCCCGCCTGCCCTGG - Intergenic
1175604391 20:60300126-60300148 CACACCTTGCACCCCAGCACCGG + Intergenic
1175868555 20:62195217-62195239 AACAGCTTTCCCTCCAGCGAGGG + Intronic
1175913326 20:62414735-62414757 CACAGCATGGCCTCCAGAGCTGG - Intronic
1179544649 21:42106059-42106081 CACAGCTGACCCCCCAGCTCAGG - Intronic
1180124377 21:45778986-45779008 CAGGGCTTGCCCCCCAGCCCTGG + Intronic
1180252216 21:46597184-46597206 CACAGCTTGGTGGCCAGCACAGG - Intergenic
1183386870 22:37519739-37519761 CACAGCGCGCCCGCCCGTGCGGG + Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953652092 3:44815550-44815572 CACACCTTTCCCTCCAGAGCAGG - Intronic
953982933 3:47421760-47421782 CTCAGCTGGCCTGCCAGCCCTGG + Intronic
954875570 3:53800831-53800853 GACAGCTTGCTCCCCAGCTCAGG + Intronic
956754439 3:72371101-72371123 CCCATCTTGCCGGCCAGCACAGG + Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
963583345 3:147154265-147154287 CACTGCCAGCCCCCCAGCGCCGG + Intergenic
974147678 4:57967227-57967249 CAGTGCTTGCAGGCCAGCGCGGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
984548422 4:181133279-181133301 CACAGCCAGCCTGCCAGAGCGGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
993670981 5:90761147-90761169 GACAGCTTGCCTGCAAGGGCTGG + Intronic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
996093525 5:119374576-119374598 CTCAGCTTGGTTGCCAGCGCAGG + Intronic
996978171 5:129459957-129459979 CACAGCTCTCCTGCCCGCGCCGG + Intergenic
1002372587 5:178767120-178767142 CACAGCTTGCCTGCAAGCCAGGG + Intergenic
1002707292 5:181170383-181170405 CGCACCTTGACAGCCAGCGCAGG + Intergenic
1003645210 6:7909408-7909430 CACAGCTTTCCTGCCAGTGCCGG - Intronic
1004587444 6:17016005-17016027 CACTGCCGGCCCGCCCGCGCCGG - Intergenic
1006807425 6:36797731-36797753 CACAGCTTGTAGGCCAGAGCTGG - Intronic
1008417533 6:51260240-51260262 CACATCTTCCCTGCCATCGCCGG + Intergenic
1012245717 6:96924267-96924289 CTCAGATTGCCCGCCAGCCCTGG + Intergenic
1015526155 6:134176478-134176500 CGCAGCCTGACCGCCGGCGCGGG + Intronic
1018048009 6:159981679-159981701 CACAGCTTGTTAGTCAGCGCTGG + Intronic
1018696224 6:166393673-166393695 CAGTGCTTGCAGGCCAGCGCAGG - Intergenic
1018734177 6:166675140-166675162 CCCAGCTTGCCAGCAAGCGGAGG + Intronic
1026428699 7:70322752-70322774 CAGAGCTTGCCTGCAAGCTCAGG + Intronic
1028515202 7:91670697-91670719 CACAGCTGTACCTCCAGCGCTGG + Intergenic
1030161064 7:106509003-106509025 CACAGGCTGCCCGCCAGCCAGGG + Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035122308 7:156578917-156578939 CACTGCGTGGCGGCCAGCGCGGG - Intergenic
1036739565 8:11348078-11348100 CACAGCTTGTCCACCTGCCCAGG + Intergenic
1036847612 8:12180524-12180546 CACTGCTTCCCCGTCAGCGGTGG - Intergenic
1036868980 8:12422839-12422861 CACTGCTTCCCCGTCAGCGGTGG - Intergenic
1039589524 8:38734885-38734907 CACAGCTGGCTCTCCAGGGCCGG + Intronic
1045305273 8:100952206-100952228 CTCCGCTCGCCCTCCAGCGCGGG - Intronic
1048508050 8:135038494-135038516 CAGAGCTTTCCGGCCACCGCAGG - Intergenic
1049065372 8:140309417-140309439 CACAGCCTGCCAGGCAGCCCTGG - Intronic
1049761054 8:144332174-144332196 CCCATCTTGCCCGCCGACGCCGG - Exonic
1050394926 9:5185768-5185790 CAAGGCTTTCCCGCCAGCTCAGG + Intergenic
1057181847 9:93034803-93034825 CTCAGTTTCCCCGGCAGCGCAGG + Intronic
1061492489 9:130953625-130953647 CACAGATTGCCAACCAGAGCAGG + Intergenic
1190053706 X:47170173-47170195 CACAGACTGCCCCCCAGGGCTGG - Intronic
1190789612 X:53686552-53686574 CAGAGCTCGCCCTCCAGCCCAGG + Intronic
1192177056 X:68892764-68892786 CACCGCCTGCCCGCCTGCCCGGG - Intergenic
1195894647 X:109733206-109733228 AACCGCGTGCCCGCTAGCGCTGG + Exonic