ID: 915322779

View in Genome Browser
Species Human (GRCh38)
Location 1:155064877-155064899
Sequence CCTGTTCTCCAGAGAGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915322779_915322783 7 Left 915322779 1:155064877-155064899 CCACAGACTCTCTGGAGAACAGG 0: 1
1: 0
2: 1
3: 21
4: 260
Right 915322783 1:155064907-155064929 AGGAGAGCCTGCATAAAGACAGG 0: 1
1: 0
2: 1
3: 17
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915322779 Original CRISPR CCTGTTCTCCAGAGAGTCTG TGG (reversed) Intronic
901777021 1:11567123-11567145 CTTGTTCTAAAGAGAATCTGAGG - Intergenic
902080710 1:13818772-13818794 ACTCTTGCCCAGAGAGTCTGTGG + Intronic
904465807 1:30707021-30707043 CCTGATTTTCAGAGACTCTGGGG - Intergenic
905417064 1:37811222-37811244 GCAGTTCTTCAGAGAGCCTGAGG + Exonic
905937493 1:41836403-41836425 CCTGGTCTCCAGAGCTGCTGAGG + Intronic
906320193 1:44810865-44810887 CGTGTTCTCCAGAGAGGGAGAGG + Intronic
907450715 1:54544061-54544083 CCTCCTCTCCAGAGAGTCCGTGG + Intronic
908823513 1:68112504-68112526 CCTGTTTAGCAGAGAGTCTGGGG - Intronic
910758535 1:90714434-90714456 CCTGGCCTCCAGAGACTCTAAGG - Intronic
912373887 1:109194573-109194595 CCTGGTTTCCACAGAGACTGAGG - Exonic
914912432 1:151798759-151798781 TCTGTTCCCCAGAGCGTCAGGGG + Intergenic
915322779 1:155064877-155064899 CCTGTTCTCCAGAGAGTCTGTGG - Intronic
916457517 1:164986239-164986261 ACAGATCTCCAGAGATTCTGTGG + Intergenic
917674418 1:177305357-177305379 CCTGTTCTCCAGAGCCCCAGGGG - Intergenic
917751975 1:178061793-178061815 GCTGTGCTCCAGAGAGTCTGGGG - Intergenic
918102887 1:181391691-181391713 CCAGTTCTCTAGGGAGTCTGGGG + Intergenic
919672719 1:200352441-200352463 TCTTTTCGTCAGAGAGTCTGTGG + Intergenic
919737601 1:200962889-200962911 CCTGTGCTGGAGAGTGTCTGGGG + Intergenic
920102435 1:203525738-203525760 CAGGTTCTCCAGGGAGGCTGGGG + Intergenic
920219307 1:204384864-204384886 CCTGTGCTCCAGAAGGGCTGAGG + Intergenic
921800841 1:219400080-219400102 CCTGGTCCCCAGTGACTCTGGGG - Intergenic
922236412 1:223725993-223726015 CCTGGTCTCCCGAGAGACGGAGG - Intronic
922892241 1:229071107-229071129 CTTGTTCTCCAGAGTAGCTGGGG - Intergenic
923481918 1:234393379-234393401 ACTGTTCTGCAGAGACACTGAGG + Exonic
1063847921 10:10151811-10151833 CCTGGTCTCAAGAGAAACTGGGG - Intergenic
1065801788 10:29358988-29359010 CCTGATCTCCAGAGGGCCAGCGG + Intergenic
1067693578 10:48519851-48519873 CCTTTTCTGCAGGCAGTCTGGGG + Intronic
1068966615 10:62918212-62918234 AGTGTTCTCCAGAGAGGCTGGGG + Intronic
1069180683 10:65354503-65354525 CCCGTGCTGTAGAGAGTCTGTGG - Intergenic
1070436250 10:76396872-76396894 CTTATTTTCCTGAGAGTCTGAGG + Intronic
1071293244 10:84202077-84202099 CATATTCTCCAGGGAGGCTGGGG + Intronic
1071379769 10:85046679-85046701 GCTATTTTCCAGAGAGTCTGTGG + Intergenic
1072312552 10:94170691-94170713 CCTTTTGTCCAGAGAGTCCTTGG + Intronic
1072567844 10:96632533-96632555 CATGTGCTCCACAGTGTCTGTGG - Intronic
1073088575 10:100912825-100912847 CGCCTTCTCCAGAGAGGCTGCGG + Intronic
1075260878 10:120963081-120963103 CCAGTTCTCCCGAGAGCCCGAGG + Intergenic
1075625199 10:123959107-123959129 TCTGCTTTCCAGAGAGACTGAGG - Intergenic
1076072826 10:127505351-127505373 ACCATTCTCCAGAGACTCTGTGG + Intergenic
1077536780 11:3128349-3128371 CCTGTTCCCCTGAGAGTAGGAGG - Intronic
1078008207 11:7548416-7548438 CCTGTTCTCCACAGCGTGTATGG + Intronic
1078446456 11:11408625-11408647 CCAGTTCCCCACAGAGACTGAGG - Intronic
1078467628 11:11561890-11561912 CCTGTTCTCCTGTGGATCTGTGG - Intronic
1078582072 11:12546484-12546506 AGTGTTCTCCAGAGAGACAGAGG - Intergenic
1078585093 11:12578353-12578375 CCTGCACGCCAGAGAGTGTGGGG - Intergenic
1081337335 11:41882815-41882837 CCTGTTCTCCAAACAGTAGGAGG + Intergenic
1084873581 11:72114360-72114382 GCTGTTCTCCAAATAGACTGGGG + Intergenic
1085040050 11:73321792-73321814 CCTGTGATCCTGAGACTCTGGGG + Intronic
1089169101 11:116500119-116500141 CCTGTGCACCAGTGAGTTTGGGG - Intergenic
1089711100 11:120315260-120315282 CCTGGTCTCTGTAGAGTCTGGGG + Intronic
1090409472 11:126497917-126497939 TCTGATCCCCAGAGAGTTTGTGG + Intronic
1092570747 12:9718956-9718978 CTTGTTCTCAAGAGTGTCTTGGG + Intronic
1092659705 12:10724192-10724214 CCTGTATTCCAGACAGTCTTTGG - Intergenic
1093319660 12:17698766-17698788 CCGATTCTCAAGACAGTCTGAGG + Intergenic
1093705272 12:22268172-22268194 GCATTTCTCCAGAAAGTCTGGGG - Intronic
1093903139 12:24659866-24659888 CCTGCTCTTAAGAGACTCTGAGG + Intergenic
1094638200 12:32247433-32247455 TCTGTACACCAGAGTGTCTGAGG - Intronic
1094807663 12:34107984-34108006 CCTGTCCTCCAGCGTGGCTGCGG + Intergenic
1096840670 12:54377926-54377948 CCTGCTCTCCAGAGGGGCTGAGG + Intronic
1099356726 12:81646326-81646348 CCTGTTCTCTAGAGGGTCTAGGG - Intronic
1101505956 12:105346282-105346304 CGTGTTCTCCAGACCTTCTGAGG + Intronic
1102125646 12:110478321-110478343 CCATTTCTCCAAAGAGCCTGTGG + Intronic
1102916883 12:116760717-116760739 CGTTTCCTTCAGAGAGTCTGTGG + Intronic
1103601755 12:122058923-122058945 CGTGGACTCCAGAGAGTTTGAGG - Intronic
1105024390 12:132838656-132838678 GCTGTCCTCCAGAAAGCCTGTGG + Intronic
1105348180 13:19592630-19592652 CCTGTGTTCCAGTGTGTCTGTGG - Intergenic
1108834296 13:54521810-54521832 ACTTATCTCCAGAGAGACTGAGG + Intergenic
1115530739 14:34324736-34324758 CTTGTTTTCCAGAGAGAATGTGG + Intronic
1118730294 14:68661255-68661277 CCTGTTCTGCAGTGTGTTTGTGG - Intronic
1118794594 14:69129735-69129757 CCGGTGCCCCAGAGAGGCTGGGG - Intronic
1118882825 14:69843304-69843326 CTTCCTTTCCAGAGAGTCTGTGG - Intergenic
1119310567 14:73642988-73643010 CCTGTTCACCAGAGAATGTGTGG - Intergenic
1119918169 14:78422025-78422047 CCTGAGCTTCTGAGAGTCTGGGG + Intronic
1124017165 15:25887055-25887077 CCTGGGCTCCAGAGGCTCTGTGG - Intergenic
1125602360 15:40922731-40922753 CCTTCTTTCCAGGGAGTCTGCGG + Intergenic
1125840201 15:42793423-42793445 TCTGTAGTCCAGAGAGGCTGAGG + Intronic
1126829167 15:52582234-52582256 CCTGTTCTCTAGAAAGTCAATGG - Exonic
1127538094 15:59909762-59909784 CCTGAACTCAAGAGAGTCTGTGG + Intergenic
1129717398 15:77860266-77860288 CCTGTTATCCTAACAGTCTGGGG + Intergenic
1132497248 16:269685-269707 CCTGTCCGCCGGAGACTCTGTGG - Intronic
1132645225 16:996389-996411 CCAGGTCTCCAGAGCGGCTGGGG + Intergenic
1132677676 16:1127394-1127416 CCTGTCCTCCTGAGACCCTGTGG + Intergenic
1132828054 16:1914663-1914685 CCTTCTCTCCAAAGAGTCAGAGG + Intronic
1136065117 16:27753554-27753576 CCTGGTCTTCAGAGAGTCAACGG - Intronic
1136074242 16:27805962-27805984 CCTATTCTGCAGGGAGCCTGGGG + Intronic
1137477773 16:48825384-48825406 ATTCTTCCCCAGAGAGTCTGGGG + Intergenic
1137810046 16:51343998-51344020 CCTGTTCTCCAGACATTCGTTGG - Intergenic
1138410628 16:56837046-56837068 ACTGTTCCCCAGTGTGTCTGTGG - Intronic
1139574325 16:67831694-67831716 CCTGTCCTCTGGAGAGGCTGAGG - Intronic
1142778063 17:2157237-2157259 ACTGTTCTCCTGGGAGTCTCAGG - Intronic
1142893593 17:2960541-2960563 CCTGCTGTCCACAGAGTGTGGGG + Intronic
1143964694 17:10748718-10748740 CCTCTTCTCCAGACTGTCTGGGG + Intergenic
1144322739 17:14145903-14145925 TCTTTTCTCCAGAAAGTCGGAGG - Intronic
1144686262 17:17228218-17228240 CCTGTGCTCCAGAGGGGCTGGGG - Intronic
1145241652 17:21243809-21243831 CCTGCTCTCCAGGCAGCCTGGGG + Intronic
1146591122 17:34128751-34128773 CCTTTTCTACAGAAAGTTTGGGG + Intronic
1147150656 17:38511721-38511743 CCTGTTCCCCAGACAGTTTTTGG + Exonic
1148992730 17:51680568-51680590 CCTGTTCCCCAGGGAGTGTTTGG + Intronic
1151581134 17:74979639-74979661 GCTGTTCTGCAGAGAGTAGGTGG - Intergenic
1151686527 17:75650305-75650327 CCTGTTGACCAGTGAGTCGGTGG - Intronic
1151990238 17:77570077-77570099 CCTGGCCCCCAGAGAGGCTGTGG + Intergenic
1153565210 18:6412415-6412437 TCTGTTCTCCAGAGAGCCGAAGG - Intronic
1157859973 18:51132788-51132810 CCTGTTTCCCAGGGTGTCTGGGG - Intergenic
1157968773 18:52241349-52241371 TCTGGCCTCAAGAGAGTCTGAGG - Intergenic
1160328467 18:77970590-77970612 ATTGTTATCCAGAGACTCTGTGG + Intergenic
1160338041 18:78060168-78060190 GCTGTTCTGCTGAGGGTCTGGGG - Intergenic
1160488085 18:79311737-79311759 CCTGTGATCCGCAGAGTCTGAGG - Intronic
1160774227 19:847787-847809 CCTGTCCTCCAGGGAGACTCAGG + Exonic
1160819946 19:1053260-1053282 CCTCTTCCCCAGGGAGACTGGGG + Intronic
1161595336 19:5148402-5148424 TCTGTGCTCCTGAGAATCTGGGG + Intronic
1162670379 19:12252216-12252238 CCTCTTCTCTAGAGTGGCTGGGG - Intronic
1164267325 19:23632225-23632247 CATTTTCTTCAGAGGGTCTGTGG - Intronic
1166026354 19:40089409-40089431 CCTGTTCTGTAGAGAGTCAAGGG + Intronic
1166872261 19:45877765-45877787 CCTGGTCACCAGTGAGTATGTGG - Intergenic
1167406605 19:49313390-49313412 CCTGTGCTCAAGTGAGTCTCCGG + Intronic
1168187269 19:54708295-54708317 CTTGTTCACCAGAGAGCCTCAGG + Intergenic
1168276004 19:55279194-55279216 TCAGATCTCAAGAGAGTCTGAGG - Intronic
1168654212 19:58115623-58115645 ATTGTTCTTCAGAGAGGCTGTGG - Intronic
925344687 2:3162550-3162572 CCTGTGATCCAGACAGTATGGGG + Intergenic
926012147 2:9416968-9416990 CAGGTTCTGCAGAGAGTTTGAGG - Intronic
926034264 2:9622914-9622936 CCTGATATCCAGAAAGTCAGTGG + Intronic
926122824 2:10254154-10254176 CCTGGTCTCCAGGCAGTCAGGGG - Intergenic
926343984 2:11928959-11928981 CCTGTTTTACAGACAATCTGAGG + Intergenic
928887428 2:36165741-36165763 CCTGTTCTGTAGAGAATATGGGG - Intergenic
929574201 2:43041944-43041966 CCTGGTCTCTAGGCAGTCTGTGG - Intergenic
930664431 2:54088186-54088208 CCTGTATTCCAGAGAGTGTTAGG + Intronic
932954775 2:76338027-76338049 CACTTTCTTCAGAGAGTCTGTGG + Intergenic
934559576 2:95306069-95306091 ACTGTTCTCCAGAGTGGCTAAGG + Intronic
935341791 2:102065399-102065421 CCTGTTCTCCAGCTTGTTTGAGG + Intronic
936093205 2:109513984-109514006 TCTGGTCCCCAGTGAGTCTGCGG + Intergenic
936282714 2:111156569-111156591 CATGTTCTCCCAAAAGTCTGAGG - Intronic
938324380 2:130388440-130388462 GCTGCTCTCCAGAGAGTGGGTGG + Intergenic
941183990 2:162298418-162298440 CCTGTTCTCCTGCGAGTCAGTGG + Intronic
942061236 2:172230433-172230455 TCTGTGCTCCAGAGACTTTGGGG - Intergenic
942386617 2:175449971-175449993 GCTGTTCACTACAGAGTCTGTGG - Intergenic
945514047 2:210740184-210740206 CCTCTTCTTCAGACAGTTTGGGG + Intergenic
946106152 2:217371737-217371759 CCTGTTCTCCAGGACCTCTGAGG + Intronic
946300240 2:218819319-218819341 CCTGAGCTCCTGAGAGTCTCGGG - Intergenic
946363519 2:219234168-219234190 ACTGTTTTCCAGTGTGTCTGAGG - Exonic
947739684 2:232479443-232479465 CCCCTTCTCCAGGGAGGCTGAGG + Intergenic
947855829 2:233323893-233323915 CTTGTTCTCCACAGCATCTGTGG - Intronic
1171235530 20:23521232-23521254 CATGTTCTCAAGACCGTCTGGGG - Intergenic
1171980268 20:31623121-31623143 CCTGTTAGCCAGACAGTGTGAGG + Intergenic
1172479653 20:35263612-35263634 CCTGCTCTGCAGAGAGGCTTGGG + Intronic
1172999077 20:39092491-39092513 CCTGTTTTCCTGAGAGGCAGTGG + Intergenic
1175191588 20:57215459-57215481 CCAGTTTTCCAGAAATTCTGGGG - Intronic
1175479688 20:59302155-59302177 CCTGGTCTCCAGGGAGTCTAAGG + Intronic
1176043412 20:63080112-63080134 CAGATTCTCCAGAGAGCCTGTGG + Intergenic
1176052242 20:63126031-63126053 CTTGTCCTCCTGAGAGCCTGGGG - Intergenic
1177596194 21:23246527-23246549 CATGTTCTCCAATGACTCTGGGG - Intergenic
1177932250 21:27299333-27299355 TCTGTTTTCCATAGAGCCTGAGG + Intergenic
1178674981 21:34623261-34623283 GCTGTTGACAAGAGAGTCTGGGG + Intergenic
1179536632 21:42057019-42057041 CCAGACTTCCAGAGAGTCTGCGG - Intergenic
1180844402 22:18973371-18973393 CCTGTTGTCCTGGGAGGCTGGGG + Intergenic
1182100225 22:27652603-27652625 CCTGTGGTCCACACAGTCTGGGG - Intergenic
1183018377 22:35008197-35008219 CCTTTTATTCACAGAGTCTGGGG - Intergenic
1183240938 22:36657916-36657938 CAAGCTCTCCAGAGTGTCTGAGG + Intronic
1183568383 22:38633073-38633095 CCTCTGCTTTAGAGAGTCTGGGG - Intronic
1183689137 22:39378399-39378421 TCTTCTCTCCAGAGAGTCAGGGG + Intronic
1184717373 22:46289728-46289750 CCTGCTCTCCAGGGAGACAGTGG - Intronic
1185334662 22:50266158-50266180 CCTCTCCCCCAGAGAGCCTGGGG + Intronic
1185389656 22:50552252-50552274 CCTGCTGTCCAGGTAGTCTGCGG - Intronic
949139725 3:617647-617669 CCTGTTCTCCTGATAGTGAGTGG - Intergenic
950216197 3:11161469-11161491 CCTGTGGTCTGGAGAGTCTGTGG + Intronic
954110897 3:48432378-48432400 CCCCTCCTCCAGAGGGTCTGAGG - Exonic
954645090 3:52126379-52126401 CCTGCTGTCCAGTGTGTCTGAGG - Intronic
955751887 3:62191757-62191779 CATGTTCACCAGACAGTGTGAGG - Intronic
959914805 3:111805045-111805067 ACTGTTCTCCAAAGTGACTGAGG - Intronic
960496526 3:118382379-118382401 TCAGTCCTCCAGAGAGACTGTGG - Intergenic
960951885 3:123004630-123004652 CCAGCTCTCCAGAGAAGCTGGGG - Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
962066128 3:131981955-131981977 CCCTTTCTTCAGAGGGTCTGTGG + Intronic
962147482 3:132855589-132855611 CCAGTTCTTCAAAGGGTCTGTGG + Intergenic
962915894 3:139903011-139903033 CCTGTGCAGCAGAGAGTATGGGG + Intergenic
963604203 3:147400228-147400250 CCTGGAGTCCAGAGAGTCAGTGG - Intronic
964290345 3:155171619-155171641 CCTAGTCTCCAATGAGTCTGAGG - Intronic
964338602 3:155684457-155684479 CCTGTTCTCAGGAGAGTCTCTGG - Intronic
964479642 3:157128567-157128589 CCTGCTCTTCTGAGAGTCTGAGG - Intergenic
966731650 3:183156469-183156491 CCAGCTCTCCTGAGAGTCTGTGG - Intronic
968468189 4:763626-763648 GCTGTTCTCCACAGGGCCTGCGG - Intronic
968532864 4:1104424-1104446 CCTGTTCTCCAGGGCTTCTGTGG + Intronic
970346716 4:15159473-15159495 CACTTTCTTCAGAGAGTCTGTGG + Intergenic
972541192 4:40040837-40040859 CCTGTTTACCAGAAAATCTGAGG - Intergenic
972588441 4:40460635-40460657 ACTGCACTCCAGAGAGGCTGAGG + Intronic
975201779 4:71598411-71598433 CCTTTTCTCCAGTAAGTCAGAGG - Intergenic
978872987 4:113603084-113603106 CTTGTTCTCCAGAGCCGCTGAGG + Intronic
979995340 4:127425474-127425496 CGCGTCCTTCAGAGAGTCTGTGG - Intergenic
981365707 4:143900326-143900348 CCTTTTCACCAGAGTGTATGAGG - Intronic
981375804 4:144014133-144014155 CCTTTTCACCAGAGTGTATGAGG - Intronic
981692739 4:147527853-147527875 CCTGGTCTCCAGTGAACCTGGGG - Intronic
981910886 4:149980584-149980606 CCGGTTCTCCAGAGACTGAGGGG - Intergenic
982671878 4:158330495-158330517 CCTGTACCCCAGAAATTCTGTGG - Intronic
984709869 4:182876098-182876120 CCTGAGCTCCAGAGACTCCGAGG - Intergenic
986462259 5:7983865-7983887 CCAGGACTCCTGAGAGTCTGAGG - Intergenic
986990846 5:13551294-13551316 TCTGTTGTACAGAGGGTCTGTGG + Intergenic
994707418 5:103223400-103223422 CACCTTCTCCACAGAGTCTGGGG - Intergenic
997568744 5:134909319-134909341 CCTGTAGTCCAGAGGATCTGTGG + Intronic
998485813 5:142501017-142501039 CATACTCTCCAGAGAATCTGAGG + Intergenic
998871916 5:146561202-146561224 ACTGTTCTTCAGAGTTTCTGAGG + Intergenic
998940709 5:147279873-147279895 CGTTTCCTTCAGAGAGTCTGTGG - Intronic
999119210 5:149196056-149196078 ACTGTTGTCCAGAGACTCAGTGG + Intronic
999462216 5:151767488-151767510 TCAGTGCTCCACAGAGTCTGAGG + Intronic
1001166477 5:169373834-169373856 CCATTTCTTCAGAGGGTCTGTGG - Intergenic
1001603473 5:172944088-172944110 CCTGGGCCCCAGTGAGTCTGAGG - Intronic
1001731384 5:173962962-173962984 CCTATTCTCAAGAGAATCAGCGG - Intergenic
1002098432 5:176845529-176845551 CCTGGGCTGCAGAGGGTCTGTGG - Intronic
1002568802 5:180128711-180128733 CCTTTTCTCCAGAGACCCTGAGG - Intronic
1002604709 5:180375733-180375755 TCTGTTGTCCAGAGACTCAGGGG + Intergenic
1002604730 5:180375828-180375850 TCTGTTGTCCAGAGAGACTCAGG + Intergenic
1002774602 6:318085-318107 CCTGTTCTACAGAGCTGCTGTGG + Intronic
1002776642 6:333630-333652 CCTGTTCTCCATCTATTCTGAGG - Intronic
1003007495 6:2395288-2395310 CAAGCTCTCCAGAGAGTCTCTGG - Intergenic
1004950570 6:20666297-20666319 CCAGTGCTCCTGAGAGTATGGGG + Intronic
1006241020 6:32679328-32679350 CCTCTTCTACAGAGTGGCTGTGG + Intergenic
1006813641 6:36836915-36836937 CATGTTCTCCAGAAAGCCAGAGG - Intronic
1007420329 6:41715304-41715326 CCTGTTGTCTTGAGAGTCTTGGG - Intronic
1010027751 6:71239651-71239673 CCAGTTCTTCAAAGGGTCTGTGG - Intergenic
1010328931 6:74598904-74598926 TCTTTTCTCCAGAGAGTTTGTGG + Intergenic
1012942330 6:105428382-105428404 CCTGTTGTGCTGAGAGTCAGAGG - Intergenic
1013221448 6:108081023-108081045 CGCTTTCTTCAGAGAGTCTGTGG + Intronic
1014125411 6:117771460-117771482 CCTGTGCTCCAGAGCCTCAGAGG + Intergenic
1014534923 6:122603592-122603614 CAGCTACTCCAGAGAGTCTGAGG - Intronic
1014793373 6:125700815-125700837 CTTGTTGTCTAGGGAGTCTGTGG - Intergenic
1015181320 6:130365579-130365601 CCAGTTCTCCGGAGCGGCTGGGG - Intergenic
1015617524 6:135092907-135092929 CGTGTTCTACAGAGAGTTAGAGG - Intronic
1019619019 7:1980463-1980485 CCTGTTCTCCAGGGAGGAGGCGG - Exonic
1019696751 7:2450590-2450612 CCTGTTCCCCAGGGAGTGGGGGG - Intergenic
1019712250 7:2523099-2523121 CCTGTTCTCCCGAGATTTGGTGG - Intronic
1019902055 7:4028659-4028681 CCTGTCCTCCAGAGAGCTAGAGG - Intronic
1021048141 7:15948806-15948828 ACTGTTTTCCAGAGCGGCTGCGG - Intergenic
1022476261 7:30712418-30712440 TCTCTTCTCCAGAGATTCTGAGG + Intronic
1022809745 7:33857182-33857204 TTTGTGCTCCAGAGAGTGTGTGG + Intergenic
1023823795 7:43995182-43995204 CCTGATCTGCAGTGAGGCTGCGG + Intergenic
1025710375 7:63902292-63902314 CTTGTTTTCAATAGAGTCTGTGG + Intergenic
1025888721 7:65624468-65624490 GCAATTCTCAAGAGAGTCTGTGG - Intergenic
1025950475 7:66141542-66141564 TCTCTTCTCCAGAGAGGCTCTGG - Intronic
1026851433 7:73725987-73726009 CCTGTCCTCCAGAACCTCTGGGG + Intergenic
1029752063 7:102548595-102548617 CCTGATCTGCAGTGAGGCTGCGG + Intronic
1029770015 7:102647689-102647711 CCTGATCTGCAGTGAGGCTGCGG + Intronic
1031853729 7:126897496-126897518 GCAATTCTCAAGAGAGTCTGTGG + Intronic
1032300402 7:130681089-130681111 CCAGTTCTCCAGTGAGACTAAGG - Intronic
1032844198 7:135738746-135738768 CCTGCTCCCCAGAGGGGCTGTGG - Intronic
1035347098 7:158208012-158208034 TCTGCTGTCAAGAGAGTCTGAGG - Intronic
1036059928 8:5305431-5305453 TCTGTTCTCTAAAAAGTCTGGGG - Intergenic
1038311287 8:26448366-26448388 CCTGCTGTTCAGAGAGGCTGGGG + Intronic
1038933229 8:32218607-32218629 CCTGGTCTCCAGAGAAGCAGCGG + Intronic
1039039615 8:33395045-33395067 CCAGTTGTCCAGGGAGCCTGAGG - Intronic
1039148557 8:34478310-34478332 CCTGTTCTCCTGATAGTGAGTGG - Intergenic
1040100604 8:43499219-43499241 CTGCATCTCCAGAGAGTCTGTGG + Intergenic
1042652969 8:71063219-71063241 GGTGTTCCCCAAAGAGTCTGGGG + Intergenic
1044974933 8:97655190-97655212 CCTGTACTCTTGAGAGTGTGAGG + Intronic
1045059909 8:98402585-98402607 CCTGCTGTCCTGGGAGTCTGGGG + Intronic
1045209864 8:100085857-100085879 CATGTTCTGCAGAGAGAGTGAGG - Intronic
1045493101 8:102685491-102685513 ACTGTTCTTCAGAGTTTCTGGGG - Intergenic
1045658356 8:104410381-104410403 CCTGGTCACCCTAGAGTCTGAGG - Intronic
1047541057 8:125767164-125767186 CCTGTTCTCCAGGAACTTTGGGG - Intergenic
1048176356 8:132155998-132156020 CCTCTAATCCAGTGAGTCTGAGG + Intronic
1048332321 8:133479267-133479289 CCTTTGCTCCACAGGGTCTGGGG - Intronic
1048726617 8:137392840-137392862 CGTGCTTTCCAGAGAGTTTGAGG - Intergenic
1050904611 9:10988160-10988182 CCACTGCCCCAGAGAGTCTGTGG + Intergenic
1052820757 9:33136434-33136456 TCTGGTCTGCAGAGAGTATGGGG - Intronic
1053425931 9:38010058-38010080 CCTGTGTTCCCCAGAGTCTGAGG - Intronic
1055263937 9:74474376-74474398 CTTGTACTCAAGAGGGTCTGAGG - Intergenic
1056198296 9:84249875-84249897 CTTGTTCTCCAGAGAGGGTCTGG + Intergenic
1056719755 9:89061504-89061526 CCTGTTCTCCAGAAAATCTTGGG + Intronic
1057081139 9:92175553-92175575 CATGTTCTCCAGAAGGTCAGGGG - Intergenic
1060907899 9:127324389-127324411 GCTCTTCCCCAGAGAGTCTTGGG + Intronic
1060945538 9:127568004-127568026 ACTGTTCTCCAGAGTCTGTGGGG + Intronic
1061217798 9:129231757-129231779 CTTGTTCTTCAGGGAGACTGAGG - Intergenic
1061373129 9:130209054-130209076 CCAGGTCTCCAGGGAGTGTGGGG + Intronic
1061394046 9:130333629-130333651 CCTGTTCCTCGGAGACTCTGTGG + Intronic
1062611104 9:137373834-137373856 CCTGTTCTCCAGGCAGACAGAGG + Intronic
1190037389 X:47038433-47038455 CCTTTTCTCCACAGTGTTTGAGG + Intronic
1190254438 X:48752099-48752121 CCTGTTCTTCAGAGATCCAGAGG - Intergenic
1190537472 X:51443691-51443713 CTTGTTCTCCAAAAAGTTTGAGG - Intergenic
1192200368 X:69062721-69062743 CCTGTTCACCACACAGGCTGGGG - Intergenic
1193791523 X:85821136-85821158 CACTTTCTTCAGAGAGTCTGTGG - Intergenic
1194375075 X:93122345-93122367 CTGGTTCCCCAGAGAGTCAGAGG - Intergenic
1195285592 X:103379523-103379545 CCTTTTCTCCAGACAGTTTCTGG + Intergenic
1196148618 X:112346940-112346962 ATTGTTCTCCAGAAAGTTTGAGG + Intergenic
1197691411 X:129504515-129504537 GCTGTTCTAGAGAGAGGCTGAGG + Intronic
1199861686 X:151806634-151806656 TCTGGTCTCAAGAGAGGCTGTGG - Intergenic
1200957941 Y:8970368-8970390 CCTGTGCACCAGAGAGTGTCTGG - Intergenic
1201605508 Y:15779899-15779921 CCTCTTCTCTTGACAGTCTGTGG + Intergenic