ID: 915323501

View in Genome Browser
Species Human (GRCh38)
Location 1:155069034-155069056
Sequence CAAGATCCCCTGGAGGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 285}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915323489_915323501 7 Left 915323489 1:155069004-155069026 CCCTCTCATCCCAAGGAGCCAGA 0: 1
1: 0
2: 5
3: 21
4: 207
Right 915323501 1:155069034-155069056 CAAGATCCCCTGGAGGAGGAGGG 0: 1
1: 0
2: 3
3: 28
4: 285
915323492_915323501 -3 Left 915323492 1:155069014-155069036 CCAAGGAGCCAGAGTCCTCCCAA 0: 1
1: 0
2: 3
3: 24
4: 228
Right 915323501 1:155069034-155069056 CAAGATCCCCTGGAGGAGGAGGG 0: 1
1: 0
2: 3
3: 28
4: 285
915323488_915323501 11 Left 915323488 1:155069000-155069022 CCTTCCCTCTCATCCCAAGGAGC 0: 1
1: 0
2: 2
3: 23
4: 368
Right 915323501 1:155069034-155069056 CAAGATCCCCTGGAGGAGGAGGG 0: 1
1: 0
2: 3
3: 28
4: 285
915323486_915323501 20 Left 915323486 1:155068991-155069013 CCAAGCAGACCTTCCCTCTCATC 0: 1
1: 1
2: 2
3: 26
4: 253
Right 915323501 1:155069034-155069056 CAAGATCCCCTGGAGGAGGAGGG 0: 1
1: 0
2: 3
3: 28
4: 285
915323490_915323501 6 Left 915323490 1:155069005-155069027 CCTCTCATCCCAAGGAGCCAGAG 0: 1
1: 0
2: 1
3: 21
4: 268
Right 915323501 1:155069034-155069056 CAAGATCCCCTGGAGGAGGAGGG 0: 1
1: 0
2: 3
3: 28
4: 285
915323491_915323501 -2 Left 915323491 1:155069013-155069035 CCCAAGGAGCCAGAGTCCTCCCA 0: 1
1: 0
2: 2
3: 16
4: 216
Right 915323501 1:155069034-155069056 CAAGATCCCCTGGAGGAGGAGGG 0: 1
1: 0
2: 3
3: 28
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915323501 Original CRISPR CAAGATCCCCTGGAGGAGGA GGG Exonic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
900440096 1:2650536-2650558 GATGATCCCCTGGGGGTGGAGGG - Intronic
901439236 1:9267466-9267488 CAAGTACCCCTGCAGGATGAAGG + Exonic
901878685 1:12181430-12181452 CAAGAACCCCTGGAGGAGACAGG + Intronic
902991723 1:20192374-20192396 TTAGAACCTCTGGAGGAGGAGGG + Exonic
903825978 1:26146049-26146071 CTAGAACCAATGGAGGAGGAGGG - Intergenic
903952478 1:27004433-27004455 TCAGATCCCCTGGATGGGGAGGG - Intergenic
904695470 1:32328399-32328421 CAAGATCGCCTGGAGGCGGGAGG - Intronic
905036037 1:34918851-34918873 CCAGATCCCCTGGGGCAGGGTGG - Intronic
908020620 1:59894367-59894389 GAAGAACCACTGAAGGAGGAAGG - Intronic
910210062 1:84783354-84783376 CAAGGTCCCCTGGGAGAGGTGGG - Intergenic
910900403 1:92114652-92114674 CCAGACCCCCTGAAGAAGGAGGG - Intronic
915323501 1:155069034-155069056 CAAGATCCCCTGGAGGAGGAGGG + Exonic
917587776 1:176445280-176445302 CAACAACCCCTGGAGGAGGTGGG - Intergenic
920184393 1:204151370-204151392 TAAGAGCCCCGGGAGGAGGGGGG + Intronic
920986847 1:210898650-210898672 CAAGACCCCTTGGAGGGGGCAGG + Intronic
923005158 1:230043759-230043781 AAAGATCAGCTGGAGGAGGCAGG + Intergenic
923102237 1:230825995-230826017 CAAGAGCCCCTGTTGGAGGAGGG + Intergenic
924587652 1:245374274-245374296 CAAGCGCCCCTGCAGGAGGAAGG + Intronic
1063046182 10:2394435-2394457 CAGAATCCGCTGGAGGAGGAAGG + Intergenic
1064115521 10:12574271-12574293 AAAGATCCCCTAGGGAAGGAGGG - Intronic
1066701767 10:38137266-38137288 CAACAAGCCCTGGAGGAAGAGGG - Intergenic
1067427214 10:46219482-46219504 CTGGTTCCCCTGGATGAGGACGG + Intergenic
1067444420 10:46331731-46331753 CTAGAGCCCCTGGGGGTGGACGG + Intergenic
1067830208 10:49607361-49607383 CAAGACCCATGGGAGGAGGAAGG - Intergenic
1068634990 10:59338811-59338833 CCAGTTCCCCTGGAGCAGCAAGG + Intronic
1069496093 10:68904499-68904521 GAGCATCCACTGGAGGAGGAAGG + Intronic
1069848864 10:71392058-71392080 CAAGATGCCCTGGATATGGAAGG + Intergenic
1070519067 10:77236046-77236068 CCTGCTCCCCTGGAGGTGGATGG - Intronic
1070669630 10:78368955-78368977 CAAGAGCACGTGGAGCAGGACGG + Intergenic
1073177417 10:101565031-101565053 GAAGTTCCCCTGGCGGAGCAGGG - Intergenic
1073947020 10:108762933-108762955 CAAGATGCCCTATCGGAGGAAGG - Intergenic
1075474427 10:122721227-122721249 CAAGTTCCCCTGCTGGAGGTGGG - Intergenic
1075988746 10:126814242-126814264 CAACATCTCCTGGTGGAGAATGG - Intergenic
1076188206 10:128464933-128464955 TAAGTACCCCTGGAGAAGGAGGG - Intergenic
1077136779 11:1003541-1003563 AAACAGCCACTGGAGGAGGACGG - Intronic
1078348621 11:10573917-10573939 CCAGACCCCCTGGAAGAGGCCGG + Exonic
1079030958 11:16986368-16986390 CAAGACCCCATGGAGAAGGGAGG + Intronic
1079708208 11:23648238-23648260 GAAGATCCCCAGGATTAGGAGGG - Intergenic
1080905669 11:36542504-36542526 CAAGATGCCCAAGAGGAAGAGGG + Intronic
1081671205 11:44943612-44943634 CAAGATAGCCTGGAGGAACAAGG - Intronic
1086738290 11:90334791-90334813 CAAGATCCAGTGGAGGAGTTAGG - Intergenic
1087137378 11:94734647-94734669 CATGCTCCCCTGGGAGAGGAGGG + Intronic
1087745161 11:101935904-101935926 AAAGATCCACTTGAGGGGGAAGG + Intronic
1090669661 11:128937435-128937457 CAGGATTCCGAGGAGGAGGAGGG + Intronic
1091402219 12:188199-188221 CAGGAGCCCATGGAGGGGGAGGG + Intergenic
1092044252 12:5417525-5417547 CAAGATTCACTGAAGGAGAAGGG - Intergenic
1092782365 12:11999066-11999088 CATGGTCCCCTGGGGAAGGAAGG + Intergenic
1096844817 12:54400677-54400699 CAAAATCCTCTGGAGGAAAAAGG - Intronic
1100726328 12:97412865-97412887 CAAGGTCACCTGGAGAAGAATGG - Intergenic
1100895066 12:99172337-99172359 AAACATCCCCTGGAGGATGTGGG + Intronic
1101985715 12:109445024-109445046 CAAGATCCCAGGGATGAAGACGG - Intronic
1102214061 12:111147709-111147731 CAAGGTCACCTGGCAGAGGAGGG + Intronic
1103759978 12:123241920-123241942 CAAGCTCTCCAGGAGGATGAGGG + Intronic
1104071535 12:125350084-125350106 CAGTGTCCTCTGGAGGAGGAAGG + Exonic
1106928347 13:34636421-34636443 CAAGATACTTTGGAGGTGGATGG - Intergenic
1112368475 13:98774846-98774868 CCAGATGCCCTGAATGAGGAGGG - Intergenic
1113788601 13:113015785-113015807 CAAGTGGCCCAGGAGGAGGAAGG + Intronic
1114483104 14:23047469-23047491 CAACATCCCCTGCAGGAGGGTGG + Exonic
1114654842 14:24309974-24309996 TAAGATTCCCTGGTGGTGGAAGG - Intronic
1117881426 14:60316773-60316795 CAAGTTCCCCTGGCAGGGGAGGG - Intergenic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1119627563 14:76193017-76193039 CAATATCGCCTAGAGGAGCAGGG + Intronic
1120266810 14:82261195-82261217 CCAGAGCACCTGGATGAGGATGG - Intergenic
1120994587 14:90407093-90407115 CAGCATTCCCTGGAGGGGGAGGG - Exonic
1121835545 14:97088867-97088889 GAGGATGACCTGGAGGAGGAAGG + Intergenic
1121866418 14:97366620-97366642 GAAGACTTCCTGGAGGAGGAGGG - Intergenic
1122624956 14:103079862-103079884 CAAGTTCTCCAGGAGGAAGATGG - Intergenic
1122722558 14:103730434-103730456 CAGGCTCCCCAGGAGGAGGCAGG - Intronic
1123026130 14:105425121-105425143 CAAGTTCAGCAGGAGGAGGAAGG - Intronic
1123100304 14:105793263-105793285 CAAGACACCCTGGAGGTGAAGGG - Intergenic
1124141311 15:27079607-27079629 CAAGAACCCCTGAAGGAGTCTGG + Intronic
1124402027 15:29356958-29356980 CAAGATACCTGTGAGGAGGAAGG - Intronic
1127905725 15:63374351-63374373 GAAGGCCTCCTGGAGGAGGAGGG - Intronic
1128806037 15:70532023-70532045 GAAGAACCCATGGAGGTGGAAGG + Intergenic
1129060497 15:72856904-72856926 CAGGAGCCCCTGGTGGAGGGAGG - Intergenic
1129107657 15:73320559-73320581 CAAGATCCCATCTGGGAGGAGGG + Exonic
1129850405 15:78790588-78790610 GAAGAAGCCCTGGTGGAGGAGGG - Intronic
1130251860 15:82304935-82304957 GAAGAAGCCCTGGTGGAGGAGGG + Intergenic
1132218221 15:100083823-100083845 CTAGAGCCACTGGAGGGGGAAGG - Intronic
1132416506 15:101623997-101624019 TATGATCACCTTGAGGAGGATGG + Intronic
1132804453 16:1769170-1769192 CCAGCACCCCTGGAGGAGGCAGG + Exonic
1133260367 16:4545571-4545593 AAATATCACCTGGAGGATGATGG - Intergenic
1136192280 16:28623597-28623619 CAGGAGCTCCTGGAGGAGGCAGG - Intronic
1137694910 16:50455113-50455135 CAAGATCCCCACAAGGTGGAGGG - Intergenic
1138160917 16:54753432-54753454 CAATATACCCTAGAGGAGGATGG + Intergenic
1139260602 16:65589873-65589895 GGAGATCCCCTGGGGGTGGAAGG + Intergenic
1139305823 16:65985555-65985577 GAAGATACCCTGTAGTAGGATGG - Intergenic
1139390440 16:66604249-66604271 AAAGAGGCCCTGGAGGAGGGTGG + Exonic
1140941400 16:79724764-79724786 CAAGATCTCCAGGTGGTGGAAGG - Intergenic
1141465711 16:84204697-84204719 CAGGATCCCATGGAGGGGGTGGG + Intergenic
1141466034 16:84206383-84206405 CAAGAATTCCTGGAGGAGGGAGG - Intergenic
1141679578 16:85536413-85536435 CTAGTTCCCAGGGAGGAGGAGGG + Intergenic
1142434101 16:90046416-90046438 CAAGACCCCATGGAGGCTGAGGG + Intergenic
1143014143 17:3882823-3882845 CAAGTTCCCATGGAGGGTGAGGG - Intronic
1143145681 17:4773658-4773680 CAAGAATCCATGCAGGAGGAGGG - Intronic
1144256574 17:13474432-13474454 AAAGTTCCCCTGGAGTTGGAGGG + Intergenic
1144285748 17:13772325-13772347 CAAGATCACCTGTAGGAGAGTGG + Intergenic
1144566622 17:16364623-16364645 CAACATCAGCTGGAGGATGATGG + Intergenic
1144678465 17:17176837-17176859 CAGGAGTCCCTGGAGGAGGCTGG - Intronic
1144742217 17:17590352-17590374 CAAGATTCCCCAGAGGAGGGAGG - Intronic
1144814997 17:18027733-18027755 TAAGATCCACTGGAGGCAGATGG - Intronic
1146647255 17:34583475-34583497 CAGGCAGCCCTGGAGGAGGAGGG - Intronic
1148706181 17:49634880-49634902 CCAAATCCCCTGGAGCAGGTGGG - Intronic
1151231747 17:72690065-72690087 CACGCTCCCCAGAAGGAGGAAGG - Intronic
1151933470 17:77247467-77247489 CACCATCGCCCGGAGGAGGAGGG - Intergenic
1152348609 17:79770233-79770255 TAGGATGCCCTGGAGGAGAAGGG - Intergenic
1152701344 17:81821454-81821476 CCAGATTCCCAGGAGGAGGAGGG - Intergenic
1152703590 17:81831926-81831948 TTGGGTCCCCTGGAGGAGGAAGG - Intronic
1153285057 18:3449584-3449606 GAAGAGCCCCGGGAGGAGAAGGG + Intronic
1153469749 18:5430643-5430665 CTTGAGCCCCTGGAGGTGGAGGG - Intronic
1153969874 18:10216266-10216288 AAAGATCCCCTGGAGGAGTCCGG + Intergenic
1156311038 18:35922293-35922315 CAAGATATCCTGGAGCTGGAGGG - Intergenic
1156912667 18:42429035-42429057 CTAGATCACCAGGGGGAGGAAGG + Intergenic
1157046374 18:44105709-44105731 CAAGATTCCCTTGAGGGGGTGGG + Intergenic
1158305169 18:56097369-56097391 AAAGAGCCACTGGAGGAGAATGG - Intergenic
1159087251 18:63807811-63807833 CAGGAGCCCCTGGTGGAGGTGGG - Intergenic
1160610764 18:80083336-80083358 GAAGATCCCCTGAGGGATGAGGG + Intronic
1160750930 19:734117-734139 CAGCATCCCCGGGAAGAGGAAGG - Intronic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1160761105 19:784928-784950 GAAGATGACCAGGAGGAGGAAGG + Intergenic
1160872596 19:1283957-1283979 CGAGATCCCTTGAAGCAGGAGGG + Intergenic
1160887267 19:1355634-1355656 CAAGATTTCATGGCGGAGGAAGG - Intronic
1161146789 19:2683725-2683747 AGAGAGACCCTGGAGGAGGAGGG + Intronic
1161895442 19:7076084-7076106 CATGATCCCCTGGAGACTGAGGG + Intronic
1162066039 19:8126091-8126113 CAAGTTGTCCTTGAGGAGGAAGG + Intronic
1162174546 19:8821628-8821650 CATGATCCCCTGGAGATTGAGGG - Intronic
1162376983 19:10310597-10310619 CGAGTTCTCCTGGAGGAGGGGGG + Exonic
1162632668 19:11941377-11941399 CAGGAGCCCATGGAGGAGGTGGG + Intronic
1163142825 19:15362036-15362058 CCGGATCCCTTGAAGGAGGAAGG - Intronic
1163598069 19:18231955-18231977 CCTGCTCCCCTGTAGGAGGAAGG - Intronic
1164702718 19:30297096-30297118 GAAAATCTCTTGGAGGAGGAGGG - Intronic
1165153142 19:33772501-33772523 CAAGATACCCTGGCGGTCGAAGG - Exonic
1165635106 19:37334009-37334031 AAAGATCCCCTGGTGGTGGTGGG - Intronic
1167049297 19:47068854-47068876 CCTGATCCCATGGAGTAGGATGG - Intronic
1168050179 19:53824030-53824052 CAAGATCCCCTGGGGAAGCATGG - Exonic
1168344745 19:55644674-55644696 GGAGATCCGATGGAGGAGGAAGG - Exonic
925162301 2:1694477-1694499 CAAGTTCTCCTGGAGGAGAAGGG + Intronic
925481264 2:4276964-4276986 CAAGAACTCCTGGAGGGGAAAGG - Intergenic
927151815 2:20200572-20200594 CAAGAGCCCCGGGAGGAGGAAGG + Intergenic
927484867 2:23481607-23481629 CAAGATCCCGTAGAAGAGGCTGG + Intronic
927896892 2:26788536-26788558 CAAGACCCCATGTAGAAGGAAGG - Intronic
927903481 2:26840465-26840487 CAAGATTCCCAGGAGAGGGATGG + Intergenic
928244746 2:29617462-29617484 CACCATCCCCTGAAGTAGGAAGG - Intronic
930641995 2:53862772-53862794 CAAGATTTACTAGAGGAGGAGGG - Intergenic
931868956 2:66439464-66439486 CAGGATCCGGTGGAGGAGAAAGG - Intronic
931872925 2:66481106-66481128 CCTGATCCCCTGCAGCAGGAGGG + Intronic
932136212 2:69231309-69231331 CAAGGTCCCCAGGAGAAAGATGG - Intronic
935223170 2:101032233-101032255 CCAGATACACAGGAGGAGGAAGG + Intronic
936117406 2:109713078-109713100 CAAGAGACCCAGGTGGAGGAAGG - Intergenic
937339860 2:121084286-121084308 CTAAATCCCCGGGAGGAGAAGGG + Intergenic
940377871 2:152977184-152977206 CAAGATTCTCTGGAGGAGAAGGG - Intergenic
941281781 2:163560961-163560983 CCAGATCCCCTGAAGAAGCATGG - Intergenic
944408226 2:199409813-199409835 CATTATCCCCTGCAGTAGGAAGG - Intronic
945050741 2:205821913-205821935 CAAGCTCAGCTGGAGGAGGAAGG + Intergenic
946087013 2:217184033-217184055 CAAGTTCCTCTGGAGCAGGCTGG + Intergenic
946107837 2:217387718-217387740 CAAGGCCACCTGGAGCAGGATGG + Intronic
947167004 2:227272972-227272994 CAGGATCCCCTGGAGGACCTTGG - Exonic
947740069 2:232480929-232480951 CACGGTCCACTGGAAGAGGAAGG - Intronic
948403457 2:237701109-237701131 CAGGATCCCCTGAAGGAGTGTGG + Intronic
948420403 2:237856573-237856595 CTGGAGCCCCTGGAGGAAGATGG - Intergenic
948553869 2:238794246-238794268 CAGAATCCCCGGGAGGAGGGGGG + Intergenic
948642058 2:239381827-239381849 AAATGTCCCCTGGGGGAGGAGGG + Intronic
948654612 2:239468960-239468982 CCAGGTCCCCAGGAGGAGGTGGG - Intergenic
1168894225 20:1312754-1312776 AAAGAGCCCCTGGGGGAGGCAGG + Exonic
1169797581 20:9481326-9481348 CAAGATCTCCTGAATGGGGAGGG - Intergenic
1170763531 20:19272282-19272304 CAACATCCCCAGGACCAGGAAGG - Intronic
1173122530 20:40307016-40307038 CAAGATCAGCTGGAGCAGCAGGG - Intergenic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1173601630 20:44299413-44299435 CAGGAGCCCATGGAGGAGGTGGG - Intergenic
1174540545 20:51285882-51285904 CAAGATTGCTTTGAGGAGGAAGG - Intergenic
1175012393 20:55752840-55752862 CAAGATCACCTGGGGCAGGAGGG - Intergenic
1175290088 20:57869829-57869851 CCAGATCCCCTGGGGTGGGAGGG - Intergenic
1175311160 20:58012407-58012429 CCAGGACCCCTGGAGCAGGATGG + Intergenic
1175490156 20:59374879-59374901 TGATATCACCTGGAGGAGGAGGG - Intergenic
1177434736 21:21036694-21036716 CAAGTTTCCCTGGAGGTGGGTGG + Intronic
1177752198 21:25298325-25298347 CAAGTTCCCCTGTGGTAGGATGG + Intergenic
1178022984 21:28431112-28431134 CAACATGCCCTGGTGGAGGAAGG + Intergenic
1178172152 21:30053416-30053438 CATGACCACCTGGAGGAGGAAGG - Intergenic
1180148754 21:45936867-45936889 GAAGATCCCCAGGAGGAGGATGG - Intronic
1180335026 22:11569689-11569711 AAAGATCCACGGGAGAAGGATGG + Intergenic
1180921124 22:19522243-19522265 ACACAGCCCCTGGAGGAGGAAGG + Intergenic
1181623372 22:24105983-24106005 AAAGATCCTGTGGAGGAGGTAGG + Intronic
1181760746 22:25057243-25057265 CAGGATCCCCAGGTGGAAGAAGG + Intronic
1183087003 22:35492483-35492505 AAAGACCTCCTGGAGGAGGTGGG - Intergenic
1183433875 22:37782185-37782207 CAAGATCCCCTAGATGGGGATGG + Intergenic
1184036814 22:41922303-41922325 TAAGAGCACCTGGAGGAGGGGGG - Intergenic
1184951186 22:47843646-47843668 GAGGCACCCCTGGAGGAGGACGG + Intergenic
1184978904 22:48082163-48082185 CATCATCCCCTGCGGGAGGAAGG - Intergenic
1185000131 22:48240380-48240402 CGAGCTCCTCTGGAGGAGTATGG + Intergenic
950948893 3:16979246-16979268 CAAAATACCCTGGGGGATGAAGG - Intronic
951371862 3:21859199-21859221 CACCATCCCCTGGAGCAGAAAGG - Intronic
952705172 3:36370033-36370055 CCAGATCCTCTAGGGGAGGATGG + Intergenic
954131698 3:48564360-48564382 CAGCATCCCCTGGAGGAGTCGGG - Exonic
954876705 3:53807109-53807131 CAACACTCTCTGGAGGAGGAGGG - Intronic
955654721 3:61232492-61232514 CACCACCCCTTGGAGGAGGAGGG + Intronic
955716166 3:61832577-61832599 CAAGATCCACTGGGGGAAGAGGG - Intronic
960738892 3:120811083-120811105 TAAGACTCCCTGGAGAAGGAAGG + Intergenic
962231671 3:133670961-133670983 CAAGATCCCATTGAGAAGGGAGG + Intergenic
962350112 3:134650496-134650518 GAAGATACCCTGGAGGAAGGCGG - Intronic
962837151 3:139199545-139199567 CCAAGTCCCCTGGGGGAGGAGGG - Intronic
962866874 3:139454392-139454414 TTAGATGCCCTGGAGGAGGGTGG - Intronic
962989455 3:140565236-140565258 GAAGATTCCTTGGAGGAGGTTGG + Intronic
963474671 3:145789876-145789898 CAACCTCCCCTGAAGGAAGAGGG - Intergenic
965078029 3:164003247-164003269 CAGGAGCCCATGGAGGAGGTGGG - Intergenic
966940114 3:184740931-184740953 GCGGCTCCCCTGGAGGAGGAGGG + Intergenic
967057703 3:185844129-185844151 CAAGAACCTCAGCAGGAGGAGGG - Intergenic
967844399 3:194032605-194032627 CAACTGCCCCTGGAGGAGGGAGG - Intergenic
968466562 4:754479-754501 CCAGAGCCCCTGGAGGTAGAAGG + Intronic
968491607 4:893254-893276 CCAGATCCCCTGCAGAAGGGAGG - Intronic
968594856 4:1477073-1477095 TAAGAGCCCCTGGAGGGGCACGG - Intergenic
969017731 4:4115633-4115655 CAGGAGCCCATGGAGCAGGAAGG - Intergenic
969240703 4:5895124-5895146 CAAGATAGCCTGGAGGCTGATGG - Intergenic
969357084 4:6634960-6634982 CAAGAACACCTGGAGGAGTGGGG + Intergenic
970723372 4:19014183-19014205 CAAGTTTACCTGGGGGAGGAAGG + Intergenic
970842042 4:20485057-20485079 CAAGTTCCTCTGAAGGAGGTAGG - Intronic
971990193 4:33882490-33882512 CAAGAAACCCTGAAAGAGGATGG - Intergenic
972234065 4:37109593-37109615 CAAAATCACCTGGAGGAGAATGG - Intergenic
972716615 4:41652805-41652827 CATGATCACATGGAGAAGGATGG + Intronic
973002014 4:44962554-44962576 CCAGATCCCAGGGAGGATGAAGG - Intergenic
973936175 4:55849184-55849206 CTTGAACCCCTGAAGGAGGAAGG - Intergenic
973981824 4:56314301-56314323 CAGGAGCTCTTGGAGGAGGAGGG + Exonic
975754011 4:77553655-77553677 CCAGATCCCAGGGAGGAGAAGGG - Intronic
976019141 4:80598733-80598755 CAATGTCACCTAGAGGAGGAAGG - Intronic
976217554 4:82729324-82729346 CAAGGACTTCTGGAGGAGGAGGG + Intronic
977180335 4:93866196-93866218 CAACATTGCCTGGGGGAGGAGGG - Intergenic
977614573 4:99073839-99073861 CAAGATCCCCTGGATCAGCCAGG + Intronic
983907750 4:173202578-173202600 TAAGATTTCCTGGAGGAGGCAGG - Intronic
984202085 4:176736071-176736093 CTAGATTCCATGGAGGAGGTGGG - Intronic
986019492 5:3787890-3787912 CAAGGTCAACTGGAGGAGAAAGG + Intergenic
986140636 5:5026475-5026497 TAAGCTCCCTGGGAGGAGGAAGG + Intergenic
986774532 5:11001967-11001989 CAAGAAGCACTGGAGGTGGAGGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
989564606 5:42889603-42889625 CATGATCTCCTAGAAGAGGAAGG - Intergenic
990753928 5:59047109-59047131 GAAGATACAATGGAGGAGGAAGG - Intronic
992845857 5:80746602-80746624 CATCATCCTCGGGAGGAGGACGG + Intronic
992939539 5:81750133-81750155 CGGGATCCGCTGGAGGAGGCTGG - Intronic
994198547 5:96946096-96946118 CAAGATCACCTGCAGGAGTTTGG + Intronic
994318406 5:98360852-98360874 CAAAACCACCTGGAGGAGCATGG + Intergenic
997187890 5:131900597-131900619 TAAAATCTCCTAGAGGAGGAAGG - Intronic
997208867 5:132066219-132066241 GCAGATGCCCTGGGGGAGGAGGG + Intergenic
998183483 5:139961616-139961638 GAAGTTCCCCAGGAGGAGGGAGG - Intronic
998527259 5:142854021-142854043 CAAGATCTCCAGGATGATGAAGG - Intronic
998676418 5:144413592-144413614 CAAGACCCCCTTGAAGGGGAAGG + Intronic
999395430 5:151223967-151223989 CGGGAGCCCCCGGAGGAGGATGG - Exonic
999481135 5:151949175-151949197 CAAGACTTCCTGAAGGAGGAAGG + Intergenic
1001658649 5:173373828-173373850 CAACATCCACTGCAGGGGGAAGG + Intergenic
1001855298 5:175005340-175005362 TAAGAACCCCTGGAAGTGGAGGG + Intergenic
1002415143 5:179116415-179116437 CAACTGCCCCTGAAGGAGGAAGG - Intronic
1003064881 6:2895333-2895355 GAAGAGCCGCAGGAGGAGGACGG + Intronic
1003727821 6:8785873-8785895 CCAGTCCCCCTGGGGGAGGAGGG + Intergenic
1004312851 6:14560998-14561020 CAATATCCCAGGGAGGGGGAGGG + Intergenic
1004630117 6:17412912-17412934 CAAGATCTCTTGGAGGAGCTGGG + Intronic
1004760166 6:18657003-18657025 GAATGTCCCCTGGTGGAGGAGGG - Intergenic
1005913576 6:30331685-30331707 TAAGATCCTATGGTGGAGGATGG - Intronic
1006271823 6:32971097-32971119 CGAGCTCGCCTGGAGGGGGAGGG + Exonic
1006669308 6:35719877-35719899 CAAGACTCACTGGAGGAGGCCGG - Intronic
1008290232 6:49705953-49705975 CAAGAACCACTGCAGGAGCATGG - Intronic
1011371367 6:86640404-86640426 CATGATATCCTTGAGGAGGAAGG - Intergenic
1012976321 6:105784473-105784495 AAAGAGCCCATGGAGGATGAGGG - Intergenic
1017698369 6:157042132-157042154 GAATACACCCTGGAGGAGGAGGG - Intronic
1017927422 6:158922378-158922400 CAACATCCCCTCCAGGAGGCAGG - Intergenic
1017989379 6:159472820-159472842 CAAGATCCACAGGAAGAGCAAGG + Intergenic
1019027818 6:168985927-168985949 CTTGATCACCTGGCGGAGGAGGG - Intergenic
1021809167 7:24386657-24386679 GAAGACCGCCTGGAGGAGGGGGG - Intergenic
1021906870 7:25343296-25343318 GAAGATGCCTTGGAGGAAGAGGG + Intergenic
1022314843 7:29236149-29236171 TAAGCTTCCCTGGAGGAGAAAGG + Intronic
1023856136 7:44185498-44185520 CAAGACCCCCAGGAGGAGAGGGG - Intronic
1026398309 7:69982441-69982463 CAGGATAGCCTGGAGCAGGAGGG - Intronic
1027186935 7:75977992-75978014 CAACAGCTGCTGGAGGAGGAGGG + Intronic
1028871410 7:95774370-95774392 CACAGTCCCCTGGAGGAGGAGGG + Intronic
1028925664 7:96354702-96354724 CAAGATACCTTGAAGGGGGAAGG + Intergenic
1029293224 7:99518519-99518541 CAAGATCCCCTAGGGGATGTAGG + Intronic
1029331495 7:99859998-99860020 GATGATCCCCTGGAGAAGGAGGG + Intronic
1030685240 7:112479691-112479713 TAACTTCCCCTGAAGGAGGAAGG - Intronic
1032092690 7:128919253-128919275 TATGATCCCCAGGAGCAGGAGGG + Intergenic
1032369897 7:131338266-131338288 CAAGATCCCCTAGTGAAAGAAGG - Intronic
1032665090 7:134028082-134028104 TAGAATCCTCTGGAGGAGGAGGG + Intronic
1033399948 7:141013203-141013225 CAAGATAGCCAGGAGGAGGAAGG + Intronic
1034684601 7:152959025-152959047 CAAGATCCCCTGCATCAGGAGGG + Intergenic
1036644941 8:10607184-10607206 GAGGATGCTCTGGAGGAGGAAGG + Exonic
1037794864 8:21984656-21984678 GAAGATCCCCTGGAGGATACGGG + Exonic
1037883889 8:22586201-22586223 CCAGAGGCTCTGGAGGAGGAAGG + Intronic
1038035444 8:23682785-23682807 CAGGATGTCCTGGATGAGGAAGG + Exonic
1038038323 8:23704602-23704624 CACAATCTCCTGGAGGGGGATGG + Intronic
1038983004 8:32779698-32779720 CAAGATCCCCTGGGGAAGCCAGG + Intergenic
1040597437 8:48852998-48853020 CATAATACCCTGGAGGGGGATGG + Intergenic
1045282334 8:100759839-100759861 CAAAATCACCTGGAGGCGGCTGG - Intergenic
1046115583 8:109779644-109779666 CCAGATGCACTGGAGGAGGCAGG - Intergenic
1049029352 8:140023010-140023032 CAGGGCCCACTGGAGGAGGAGGG + Intronic
1049213036 8:141395513-141395535 CCAGTTCCCCTCCAGGAGGAAGG - Intronic
1049800535 8:144515619-144515641 CTAGCTCCCCTGAAGGAGGGTGG - Intronic
1049864485 8:144925135-144925157 AAAGATCCCCTAGAGGTTGAGGG - Intergenic
1050883324 9:10732265-10732287 CATGATCCACTGGAGTAGGGTGG - Intergenic
1053123362 9:35561664-35561686 CAAGTCCCCCTGGAGGCGGGTGG + Exonic
1053471972 9:38353020-38353042 CAAACTCCCCTGGCAGAGGAGGG - Intergenic
1056395605 9:86178670-86178692 CAACATCCCATGGTGGAAGACGG + Intergenic
1056574615 9:87845803-87845825 CATGTTCCCCAGGAGAAGGATGG + Intergenic
1057832403 9:98417382-98417404 CAAGATGCCCTGGAGGCTGCTGG + Intronic
1057927748 9:99168138-99168160 CAAGCCCTCCTGGGGGAGGAGGG - Intergenic
1058626478 9:106938902-106938924 CATGCTCACCTGGAAGAGGATGG - Exonic
1060027885 9:120188323-120188345 CAAGAGCCCAGGGAGGAGGCTGG - Intergenic
1061235951 9:129342740-129342762 CAACATCCCCGGGAGGGGGGTGG + Intergenic
1061236249 9:129344236-129344258 CAACATCCCCGGGAGGGGGGTGG + Intergenic
1061378652 9:130241221-130241243 CCTGAGCCCTTGGAGGAGGAGGG - Intergenic
1061714428 9:132509940-132509962 AAAGCTCCCATGAAGGAGGAAGG - Intronic
1061924722 9:133800359-133800381 CAAGACCGCCTGGAGGCGGGAGG + Intronic
1062500798 9:136851211-136851233 CAAGATGCCCTGGAGGACGATGG - Intronic
1185623009 X:1464935-1464957 CCAGAACCCCTGGAGGAGAATGG + Exonic
1186030461 X:5363670-5363692 CAAAATACCCTTCAGGAGGAAGG - Intergenic
1186174473 X:6910624-6910646 GAAGGCTCCCTGGAGGAGGAAGG + Intergenic
1186747201 X:12582506-12582528 CAAACTCCCCTGTGGGAGGAGGG + Intronic
1187269255 X:17765046-17765068 AAAACTCCCCTGGAGGAGCAGGG + Intergenic
1196758669 X:119180087-119180109 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196758948 X:119182359-119182381 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1199930092 X:152509154-152509176 CAAGATCCCCTAGGGAAAGAAGG + Intergenic
1200035117 X:153321631-153321653 CTAGAGGCCCTGGAGCAGGAGGG + Intergenic