ID: 915324750

View in Genome Browser
Species Human (GRCh38)
Location 1:155075640-155075662
Sequence GAGGCTAGGGCCTGGGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915324750_915324760 9 Left 915324750 1:155075640-155075662 CCCCTTCCCCAGGCCCTAGCCTC No data
Right 915324760 1:155075672-155075694 TTGAACACAGCTCAGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915324750 Original CRISPR GAGGCTAGGGCCTGGGGAAG GGG (reversed) Intergenic
No off target data available for this crispr