ID: 915325716

View in Genome Browser
Species Human (GRCh38)
Location 1:155080407-155080429
Sequence CCCACCCCCGAGGTTTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 96}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915325716_915325723 3 Left 915325716 1:155080407-155080429 CCCATGGAAACCTCGGGGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 96
Right 915325723 1:155080433-155080455 GTGGCCCCTCCCCCCCGGAGCGG 0: 1
1: 0
2: 0
3: 7
4: 208
915325716_915325735 21 Left 915325716 1:155080407-155080429 CCCATGGAAACCTCGGGGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 96
Right 915325735 1:155080451-155080473 AGCGGGACTCCAAGAACTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 107
915325716_915325724 4 Left 915325716 1:155080407-155080429 CCCATGGAAACCTCGGGGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 96
Right 915325724 1:155080434-155080456 TGGCCCCTCCCCCCCGGAGCGGG 0: 1
1: 0
2: 0
3: 23
4: 311
915325716_915325736 22 Left 915325716 1:155080407-155080429 CCCATGGAAACCTCGGGGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 96
Right 915325736 1:155080452-155080474 GCGGGACTCCAAGAACTCCGGGG 0: 1
1: 0
2: 1
3: 1
4: 52
915325716_915325722 -2 Left 915325716 1:155080407-155080429 CCCATGGAAACCTCGGGGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 96
Right 915325722 1:155080428-155080450 GGGACGTGGCCCCTCCCCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 256
915325716_915325740 30 Left 915325716 1:155080407-155080429 CCCATGGAAACCTCGGGGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 96
Right 915325740 1:155080460-155080482 CCAAGAACTCCGGGGGGCGCTGG 0: 1
1: 0
2: 0
3: 2
4: 106
915325716_915325737 23 Left 915325716 1:155080407-155080429 CCCATGGAAACCTCGGGGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 96
Right 915325737 1:155080453-155080475 CGGGACTCCAAGAACTCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 46
915325716_915325734 20 Left 915325716 1:155080407-155080429 CCCATGGAAACCTCGGGGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 96
Right 915325734 1:155080450-155080472 GAGCGGGACTCCAAGAACTCCGG 0: 1
1: 0
2: 0
3: 2
4: 81
915325716_915325738 24 Left 915325716 1:155080407-155080429 CCCATGGAAACCTCGGGGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 96
Right 915325738 1:155080454-155080476 GGGACTCCAAGAACTCCGGGGGG 0: 1
1: 0
2: 0
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915325716 Original CRISPR CCCACCCCCGAGGTTTCCAT GGG (reversed) Intronic
900223877 1:1523777-1523799 CCTTCCCCTGAGGCTTCCATGGG + Intronic
902535586 1:17117937-17117959 TCCACCTCTGAGGTTTACATGGG + Intronic
903359213 1:22766406-22766428 CCCACTCCAGAGGTTTCTTTGGG + Intronic
904935512 1:34127187-34127209 CCGACCCCCCAGGTCCCCATGGG + Intronic
915208057 1:154285835-154285857 ACCACTCTAGAGGTTTCCATTGG + Intergenic
915325716 1:155080407-155080429 CCCACCCCCGAGGTTTCCATGGG - Intronic
915605610 1:156948272-156948294 GCCACCCCTGAGATGTCCATGGG + Intronic
920020607 1:202953095-202953117 CCCATCCTCGAGGTTTTCATAGG - Intronic
922470678 1:225875256-225875278 TCCAGCCCTGAGGTTGCCATTGG - Intronic
1063949897 10:11212614-11212636 ACCTCTCCCGAGTTTTCCATTGG + Intronic
1067712025 10:48657122-48657144 CCCACACCCGGGGTCTCCAGGGG - Intergenic
1069798944 10:71070455-71070477 CCAATCTCCGAGGTTTCCAGCGG - Intergenic
1071878360 10:89866893-89866915 CCCACCCCCGAGGTATTTATAGG - Intergenic
1075589902 10:123683931-123683953 CACACACCCCAGGCTTCCATAGG + Intronic
1076833334 10:133007728-133007750 CCCACCCCCGCGGCCTCTATTGG + Intergenic
1077095092 11:795815-795837 CCCACCCCCAAGGCTTCCAGGGG - Intronic
1077139972 11:1020020-1020042 CCCACCCCAGAGGTGTACCTAGG + Intronic
1078766562 11:14303952-14303974 TCCACCTCTGGGGTTTCCATGGG + Intronic
1082092811 11:48103770-48103792 CCCAGGCCAGAAGTTTCCATTGG - Intronic
1084226075 11:67715559-67715581 CCCACCCCCGGAGTGTCCACAGG + Intergenic
1087168603 11:95027651-95027673 CCCTCCCCAAAGGTTGCCATAGG + Intergenic
1087171226 11:95051512-95051534 CCCACCCCAAAGGTTGCCGTAGG + Intergenic
1096716839 12:53496466-53496488 CCCTTCCCCGAGGCCTCCATGGG - Intronic
1105992107 13:25632407-25632429 CCTACCCCCTTGGTTTCCCTAGG - Intronic
1110277202 13:73653458-73653480 CCCCCCCATTAGGTTTCCATTGG - Intergenic
1113743871 13:112729308-112729330 CCCACCCCTGCTGTTTCCATGGG + Intronic
1116835932 14:49768873-49768895 CCCACCCCCGTTGTTGCCATTGG + Intronic
1117315341 14:54566805-54566827 CCCACCCGGGAGGTCTCCCTGGG - Intergenic
1118324845 14:64773835-64773857 GCCACCCCAGAGGTTTCCCTGGG - Intronic
1121219932 14:92277660-92277682 CCCACCCCTGAGATTTAGATAGG - Intergenic
1121302752 14:92885141-92885163 TCCTCCCCAGAGCTTTCCATGGG + Intergenic
1122517229 14:102317456-102317478 CCCACCCCCCACGTTTCCTGAGG + Intronic
1122895121 14:104752995-104753017 CCCACCCCCGATCTCTCCCTCGG + Intergenic
1125676191 15:41503732-41503754 CACACACCCCAGGTGTCCATGGG - Exonic
1130711374 15:86284978-86285000 CCCACCCCTGTGGCTTCCACAGG + Intronic
1132631065 16:917721-917743 CCCACCCCAGAGGTGTCCCAGGG + Intronic
1137250856 16:46739828-46739850 CCCAACCCCGAGGTGTTCAAGGG + Intronic
1141330221 16:83104185-83104207 CCCACATCTGAGGTTTCCCTGGG - Intronic
1143009909 17:3860483-3860505 CCTACCCCTGAGCTTTCCAAGGG + Intronic
1144573717 17:16416221-16416243 CCCACCTCCCATGTTTCCATGGG + Intronic
1146286144 17:31575300-31575322 CCCACCAGGGAGCTTTCCATGGG + Intronic
1147188441 17:38725425-38725447 CCCAGGCCAGAGGCTTCCATTGG + Intronic
1152083784 17:78205179-78205201 CCAACCTCAGAGGTTTCCATGGG + Exonic
1152390579 17:80001645-80001667 CCCACCTCCGAGGTCTCTCTGGG + Intronic
1152892849 17:82892228-82892250 GCCACCCCGGATGTTTCCCTGGG + Intronic
1157334709 18:46729402-46729424 CCCTCCCCAGAGGTCTCCTTAGG + Intronic
1163120920 19:15217257-15217279 CCCACCCCAGAAGCTTCCATTGG + Intergenic
1166597471 19:44062693-44062715 CCTACCCTGGAGCTTTCCATAGG + Intronic
1166852269 19:45766566-45766588 CCCACCCCCGGGGTATCCCACGG - Exonic
1168271304 19:55251262-55251284 CCTTCCCCCTAGGTTACCATGGG + Intronic
925290860 2:2747990-2748012 CTGACCCCTGAGATTTCCATGGG + Intergenic
927249033 2:20981683-20981705 CCCATCCCAGGGGTTTCCCTGGG + Intergenic
927513683 2:23659820-23659842 CCCACCCCTCAGGGTTCCCTGGG + Intronic
929450879 2:42036219-42036241 CCCAGGCCTGAGGTTTCCATGGG - Intergenic
932274883 2:70444223-70444245 CACAAGCCTGAGGTTTCCATTGG + Intergenic
932496365 2:72147671-72147693 CCCATCCCCAAGGGATCCATGGG - Exonic
937142192 2:119611533-119611555 TCCACCCACGACGTTCCCATTGG - Intronic
937993392 2:127675948-127675970 CCCAGCTCCCAGGTTTCCAGGGG + Intronic
939820821 2:146954966-146954988 CCCAGCTCAGAGATTTCCATAGG + Intergenic
1171493396 20:25537972-25537994 CCCACCCCAGCGGTATCCACGGG + Intronic
1173659767 20:44725039-44725061 CCCACCCCCTAGGTGGCCCTTGG - Intronic
1179584084 21:42364195-42364217 CCTACCCCCGTGGTTACCCTGGG - Intronic
1182743585 22:32587403-32587425 CCCACCCACGAGGTGTTCAGGGG - Intronic
1184684068 22:46088100-46088122 CCCCCCACCGTGGTTTCCATGGG - Intronic
1184810912 22:46831191-46831213 CCCACCCCTGACATTTCCATAGG + Intronic
1185100517 22:48838555-48838577 GCCAGCCCCGAGATTTCCAGGGG - Intronic
1185154246 22:49183669-49183691 ATCAGCCCCGAGCTTTCCATGGG - Intergenic
968505272 4:968442-968464 CCCACCCCCCAGGGCTCCCTGGG + Intronic
969860977 4:10035128-10035150 GCCACCCCGCAGGTTTCCAAGGG + Intronic
969909898 4:10434447-10434469 CCCACCCAAGATGTTTCCATTGG + Intergenic
985866344 5:2517305-2517327 CCCAGCCCCATGGTTTCCACGGG + Intergenic
990509929 5:56481014-56481036 CCCACCCCCCAAGTTTCCTTTGG + Intronic
992108647 5:73471683-73471705 CCCACCCCTGAGTTTTCTTTGGG + Intergenic
994103401 5:95918829-95918851 CCCACACCCTAGGGTACCATGGG - Intronic
995404569 5:111780099-111780121 CCCACCCCCGTGTTCTCCACGGG - Intronic
996385841 5:122909735-122909757 TCTATCCCTGAGGTTTCCATGGG + Intronic
1005040066 6:21593637-21593659 CCCTCCCCCGGGCTTCCCATTGG - Exonic
1006943061 6:37765666-37765688 CCCCAGCCCCAGGTTTCCATTGG - Intergenic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1021910609 7:25382539-25382561 CCCACCTCTCATGTTTCCATAGG - Intergenic
1023930263 7:44701077-44701099 CCCACCCCCGCGGTATCCCAGGG - Intronic
1024189658 7:46993185-46993207 CCCAGCCCCAGGGTTTCCACTGG - Intergenic
1024290407 7:47799784-47799806 CCCAACCCTGAGCCTTCCATAGG + Intronic
1036764836 8:11542950-11542972 TCCACCCCAGTGGTTTCCAGCGG + Intronic
1047406580 8:124590348-124590370 CCCACCCTCAAAGTCTCCATTGG - Intronic
1049442961 8:142617538-142617560 CCCACCACCTAGGTTCCCAGAGG + Intergenic
1049535350 8:143177954-143177976 CCCGCCCCCGCGGCTTCCCTGGG + Intergenic
1049809774 8:144561175-144561197 CGCACCCCAGCAGTTTCCATCGG + Intronic
1049809806 8:144561339-144561361 CACATCCCAGTGGTTTCCATCGG + Intronic
1049809849 8:144561563-144561585 CGGACCCCAGTGGTTTCCATCGG + Intronic
1049809878 8:144561703-144561725 CACACTCCAGTGGTTTCCATCGG + Intronic
1049809898 8:144561815-144561837 CACATCCCAGTGGTTTCCATCGG + Intronic
1049809922 8:144561939-144561961 CACACTCCAGTGGTTTCCATCGG + Intronic
1049809938 8:144562019-144562041 CACACTCCAGTGGTTTCCATCGG + Intronic
1049809965 8:144562179-144562201 CACATCCCAGTGGTTTCCATCGG + Intronic
1049810013 8:144562423-144562445 CGGACCCCAGTGGTTTCCATCGG + Intronic
1049810025 8:144562483-144562505 CGCACTCCAGTGGTTTCCATCGG + Intronic
1049810029 8:144562507-144562529 CTCACTCCAGTGGTTTCCATCGG + Intronic
1049810046 8:144562611-144562633 CTCACTCCAGTGGTTTCCATCGG + Intronic
1049810060 8:144562675-144562697 CTCACTCCAGTGGTTTCCATCGG + Intronic
1049810071 8:144562739-144562761 CGCACCCCAGTGGTTTCCATTGG + Intronic
1049810081 8:144562783-144562805 CTCACTCCAGTGGTTTCCATCGG + Intronic
1049810088 8:144562823-144562845 CACACTCCAGTGGTTTCCATCGG + Intronic
1049843707 8:144789736-144789758 CCCACCCCCATGGTTTCAAAGGG - Intergenic
1061786282 9:133030514-133030536 CCCGCCCCCGAGGTGTCATTGGG + Intergenic
1185656700 X:1691251-1691273 CCCACCCCCAAGTTTCCCTTCGG + Intergenic
1186812154 X:13200935-13200957 CCCACCCCAGGGCCTTCCATAGG + Intergenic
1189576476 X:42359123-42359145 ACCACCCCCAAGGTTTAAATTGG + Intergenic
1190312035 X:49123503-49123525 CCCACCGCAGAGATTTCCAAGGG + Intronic
1195174647 X:102304055-102304077 ACCACCCCCGGGTTTTCCAAAGG - Intergenic
1195184218 X:102383038-102383060 ACCACCCCCGGGTTTTCCAAAGG + Intronic
1198886031 X:141338576-141338598 CCTATCCCCGAGGTTTTGATAGG + Intergenic
1199649661 X:149939353-149939375 CCCACCCCAGAGGTTCCCCTCGG - Intergenic