ID: 915325830

View in Genome Browser
Species Human (GRCh38)
Location 1:155080760-155080782
Sequence GAGGACAGAAAGGAGGCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 481}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915325830_915325840 8 Left 915325830 1:155080760-155080782 CCGGGAGCCTCCTTTCTGTCCTC 0: 1
1: 0
2: 2
3: 50
4: 481
Right 915325840 1:155080791-155080813 GTGCGGGCCTGGGCCGGCAGAGG 0: 1
1: 0
2: 1
3: 30
4: 359
915325830_915325837 -2 Left 915325830 1:155080760-155080782 CCGGGAGCCTCCTTTCTGTCCTC 0: 1
1: 0
2: 2
3: 50
4: 481
Right 915325837 1:155080781-155080803 TCTCTACTCCGTGCGGGCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 70
915325830_915325843 15 Left 915325830 1:155080760-155080782 CCGGGAGCCTCCTTTCTGTCCTC 0: 1
1: 0
2: 2
3: 50
4: 481
Right 915325843 1:155080798-155080820 CCTGGGCCGGCAGAGGTAGGAGG 0: 1
1: 0
2: 2
3: 61
4: 1034
915325830_915325838 2 Left 915325830 1:155080760-155080782 CCGGGAGCCTCCTTTCTGTCCTC 0: 1
1: 0
2: 2
3: 50
4: 481
Right 915325838 1:155080785-155080807 TACTCCGTGCGGGCCTGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 106
915325830_915325848 28 Left 915325830 1:155080760-155080782 CCGGGAGCCTCCTTTCTGTCCTC 0: 1
1: 0
2: 2
3: 50
4: 481
Right 915325848 1:155080811-155080833 AGGTAGGAGGGGGCGCACACCGG 0: 1
1: 0
2: 0
3: 12
4: 156
915325830_915325844 16 Left 915325830 1:155080760-155080782 CCGGGAGCCTCCTTTCTGTCCTC 0: 1
1: 0
2: 2
3: 50
4: 481
Right 915325844 1:155080799-155080821 CTGGGCCGGCAGAGGTAGGAGGG 0: 1
1: 0
2: 2
3: 44
4: 490
915325830_915325834 -8 Left 915325830 1:155080760-155080782 CCGGGAGCCTCCTTTCTGTCCTC 0: 1
1: 0
2: 2
3: 50
4: 481
Right 915325834 1:155080775-155080797 CTGTCCTCTCTACTCCGTGCGGG 0: 1
1: 0
2: 2
3: 11
4: 155
915325830_915325833 -9 Left 915325830 1:155080760-155080782 CCGGGAGCCTCCTTTCTGTCCTC 0: 1
1: 0
2: 2
3: 50
4: 481
Right 915325833 1:155080774-155080796 TCTGTCCTCTCTACTCCGTGCGG 0: 1
1: 0
2: 1
3: 24
4: 171
915325830_915325841 12 Left 915325830 1:155080760-155080782 CCGGGAGCCTCCTTTCTGTCCTC 0: 1
1: 0
2: 2
3: 50
4: 481
Right 915325841 1:155080795-155080817 GGGCCTGGGCCGGCAGAGGTAGG 0: 1
1: 0
2: 4
3: 64
4: 557
915325830_915325836 -3 Left 915325830 1:155080760-155080782 CCGGGAGCCTCCTTTCTGTCCTC 0: 1
1: 0
2: 2
3: 50
4: 481
Right 915325836 1:155080780-155080802 CTCTCTACTCCGTGCGGGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 74
915325830_915325845 17 Left 915325830 1:155080760-155080782 CCGGGAGCCTCCTTTCTGTCCTC 0: 1
1: 0
2: 2
3: 50
4: 481
Right 915325845 1:155080800-155080822 TGGGCCGGCAGAGGTAGGAGGGG 0: 1
1: 1
2: 0
3: 36
4: 409
915325830_915325846 18 Left 915325830 1:155080760-155080782 CCGGGAGCCTCCTTTCTGTCCTC 0: 1
1: 0
2: 2
3: 50
4: 481
Right 915325846 1:155080801-155080823 GGGCCGGCAGAGGTAGGAGGGGG 0: 1
1: 0
2: 5
3: 59
4: 684
915325830_915325849 29 Left 915325830 1:155080760-155080782 CCGGGAGCCTCCTTTCTGTCCTC 0: 1
1: 0
2: 2
3: 50
4: 481
Right 915325849 1:155080812-155080834 GGTAGGAGGGGGCGCACACCGGG 0: 1
1: 0
2: 0
3: 15
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915325830 Original CRISPR GAGGACAGAAAGGAGGCTCC CGG (reversed) Intronic
900170895 1:1268247-1268269 GAGGACAGGAACGAGGCTTTGGG - Intronic
900255007 1:1693348-1693370 GAAGACACAAAGGCGCCTCCTGG + Intronic
900263750 1:1746614-1746636 GAAGACACAAAGGCGCCTCCTGG + Intergenic
900418059 1:2544044-2544066 GGGGACAGCCAGGAGGCTGCGGG - Intergenic
900658078 1:3770021-3770043 GCTGAGAGAAAGGAGGGTCCTGG - Intronic
901455795 1:9362090-9362112 GAGTGCAGGAAGGAGGCACCCGG - Intronic
901603382 1:10440072-10440094 GAGCACAGACAGGAGGCTGGGGG - Intronic
903395917 1:23001815-23001837 GAAGACACAAAGGAGGCTTTTGG + Intergenic
903638272 1:24835626-24835648 TAGGACAGAAAGGAGGTTAATGG + Intronic
903654588 1:24941640-24941662 AAAGACAGAACGGTGGCTCCAGG + Intronic
904253394 1:29239729-29239751 GAGGGCAGACAGGACGTTCCAGG - Intronic
904398558 1:30240495-30240517 GAGGAGAGATAGAAGGCTGCAGG - Intergenic
904997483 1:34642250-34642272 GAGGTCAGGAAGGAGGCTCTTGG - Intergenic
905260718 1:36716227-36716249 GAGGACAGAAATGAGGTTGGAGG - Intergenic
905350516 1:37343127-37343149 GAGGACATAAATGAGGTTCAGGG + Intergenic
905387446 1:37614341-37614363 GAGGACAGATTGGGGGCTTCTGG + Intronic
905734714 1:40317153-40317175 GAGGAGAACAAGGAGGCTGCGGG + Exonic
906105230 1:43287545-43287567 GAGGAAAGAAAGGATTATCCTGG + Intergenic
906280048 1:44546876-44546898 GAGGACCGCCAGGAGGCGCCTGG - Intronic
906660284 1:47577143-47577165 GAGGACACACAGGAGACCCCAGG + Intergenic
906661703 1:47587549-47587571 GAGAAGAGAGAGGAGGCACCTGG + Intergenic
906728392 1:48060569-48060591 GAGGACAGGAATGAGGCTCTAGG - Intergenic
907459138 1:54594770-54594792 GAGGCAGGAAGGGAGGCTCCGGG + Intronic
908007712 1:59743825-59743847 ATGGACAGAAAGGAGGCTGCAGG - Intronic
908607481 1:65814582-65814604 ATGGACAGCAAGGAGGCACCAGG - Intronic
909539606 1:76776440-76776462 CAGGACAGAATGGAGGCTTTGGG - Intergenic
910452574 1:87361980-87362002 GAGGACAGGAAGGAGGTGGCGGG - Intergenic
911043089 1:93607454-93607476 CAGGACAGATGGGAGGCTTCAGG + Intronic
911115225 1:94239192-94239214 GAGGAGACAAAGGAGTCCCCAGG + Intronic
913027016 1:114854117-114854139 GAGGAGAGAAAGGAGGCAGAGGG - Intergenic
915214473 1:154330653-154330675 GAGGAGAGAAGGGAGTCTCAAGG - Intronic
915325830 1:155080760-155080782 GAGGACAGAAAGGAGGCTCCCGG - Intronic
915545073 1:156592387-156592409 CAGGACAGTAGGGGGGCTCCTGG - Exonic
916930692 1:169575537-169575559 GAGAACAGATAGAAGACTCCAGG + Intronic
917750468 1:178048806-178048828 GAATACAGAAAGCAGCCTCCAGG + Intergenic
918140438 1:181715135-181715157 GAGAACAGAAAGGAAGCCTCGGG - Intronic
918185409 1:182122326-182122348 GAGGAATCAGAGGAGGCTCCTGG - Intergenic
918313399 1:183302886-183302908 GGGGCCAGCAAGGAGGCTCCAGG - Intronic
918714296 1:187768373-187768395 GAGGACGCAAAGGAGGCTTTGGG + Intergenic
920351049 1:205338291-205338313 GAGGACAGAAAGGCCACACCTGG + Intronic
921438882 1:215160445-215160467 GAAGAAAGAAAACAGGCTCCAGG + Intronic
922209389 1:223476046-223476068 CAGGGCATAAAGCAGGCTCCCGG - Intergenic
923032603 1:230262162-230262184 GAGCACAGCAAGGAGATTCCAGG - Intronic
1063913376 10:10854883-10854905 GCGGGCAGAAAGTGGGCTCCAGG + Intergenic
1065637620 10:27746373-27746395 GACATCAGAAAAGAGGCTCCTGG - Intergenic
1067177636 10:43961283-43961305 GAGGACTGGAAGGAGACTGCTGG + Intergenic
1068098588 10:52522707-52522729 GAAGAGAGAAAGGAAGTTCCTGG - Intergenic
1069546884 10:69335137-69335159 CAGGACAGAAACTAGGTTCCCGG + Intronic
1069657256 10:70099114-70099136 GGGGCCAGAAAGGAGTCTCAGGG + Intronic
1069725906 10:70578398-70578420 GAGGAGAGAAAGGTAGATCCTGG + Intergenic
1069839892 10:71333212-71333234 GAGGCCAGCAAGGAGGTCCCAGG - Intronic
1069878064 10:71575114-71575136 GAGGACAGCTAGCAGCCTCCAGG - Intronic
1070061000 10:72982337-72982359 GAGGACAGTATGGAGGCATCCGG - Intergenic
1071347485 10:84706605-84706627 AAGGCCACACAGGAGGCTCCAGG + Intergenic
1071463572 10:85920523-85920545 GATGGCAGAGATGAGGCTCCTGG - Intronic
1072236919 10:93461482-93461504 GAGGAAAGAAAGGTGACTTCAGG + Intronic
1072567838 10:96632486-96632508 GCAGACAGAAAGGAGGATCATGG - Intronic
1073137644 10:101228781-101228803 GAGGACGGCAAGGCGGCGCCGGG - Exonic
1073608168 10:104916407-104916429 AAGGAAAGAAAGGCAGCTCCTGG + Intronic
1074962009 10:118455401-118455423 GAGAAAAGAAAGGAGGCCCGTGG - Intergenic
1075528142 10:123203082-123203104 GAGGAGGGAAGGGATGCTCCTGG + Intergenic
1075531887 10:123236696-123236718 GAGGGCAGCATGGAGGCACCTGG - Intergenic
1075643735 10:124084261-124084283 GAAGACAGCCAGGAGGGTCCTGG - Intronic
1075746988 10:124734900-124734922 GAGGACAGAGGGAAGGGTCCAGG - Intronic
1076907371 10:133369776-133369798 GAGGCAGGAAAGGAGGCTGCTGG + Intronic
1077010487 11:377107-377129 GAGGACAGCGAGGAGGCCGCGGG + Exonic
1077078604 11:712638-712660 GAGGACAGCAAGGGGGAACCAGG - Intronic
1077095904 11:799023-799045 GAGGACCCACAGGAGGCCCCAGG + Exonic
1077320080 11:1937172-1937194 CAGGAGAGGGAGGAGGCTCCGGG - Intronic
1077722601 11:4643470-4643492 GAGGACAGAAAGAACACTTCAGG + Exonic
1078023092 11:7671588-7671610 GGGAACAGCAAGGAGGCTCAGGG + Intronic
1078369107 11:10730436-10730458 GGGGACAAAAATGAGGCTGCAGG - Intergenic
1078746066 11:14115400-14115422 GGGGACAAAACGGAGGCTTCTGG - Intronic
1078765865 11:14297369-14297391 GAGGACAGAAAAGAATCCCCTGG + Intronic
1078811906 11:14776408-14776430 GGGGAGAGAAAGGAGTCTCCAGG - Intronic
1079531791 11:21463102-21463124 GAAGACAGAGGAGAGGCTCCTGG - Intronic
1080116138 11:28623321-28623343 CAGGACAGAAAGAAAGATCCCGG + Intergenic
1080208375 11:29756613-29756635 GAGCACAGAAGGGAGGCTGGGGG - Intergenic
1080928103 11:36779288-36779310 GAAAACAGAAAGGATTCTCCTGG - Intergenic
1081646865 11:44796162-44796184 GAGGAGAAAATGGAGGCTCCTGG + Intronic
1081692630 11:45088527-45088549 GAGTCCAGAAAGGGGGCTCAAGG + Intergenic
1081960632 11:47134050-47134072 AAGGAAAGAGAGGAGGGTCCAGG - Intronic
1082922356 11:58509292-58509314 GAGGACAGAAACCTGTCTCCAGG - Intergenic
1083202093 11:61126772-61126794 GAGGACAGGAAGGGGACTCCCGG + Exonic
1083272161 11:61578041-61578063 GGGGGCAGAAGGGAGGCTGCAGG + Intronic
1083364406 11:62132814-62132836 GAGGAGAGAGAGGAGGATACAGG + Intronic
1083596708 11:63921062-63921084 GGGGTCAGCAAGGAGACTCCAGG + Intergenic
1083612229 11:64009765-64009787 GAGCAGAGAAGGGAGTCTCCCGG - Intronic
1083966789 11:66048471-66048493 CAGGACAGGATGGAGTCTCCGGG - Intronic
1084714245 11:70863616-70863638 GTTGACTGAAAGGAGGCACCAGG - Intronic
1084952859 11:72676318-72676340 GAGGGCAGAAAGGAGGCTGAGGG - Intergenic
1084953017 11:72677072-72677094 GATGGCAGGAAGGATGCTCCTGG + Intergenic
1085752959 11:79177983-79178005 AAGAACAGGTAGGAGGCTCCTGG + Intronic
1086079835 11:82891562-82891584 GAGGACAGAAAGGAGGTTCAGGG - Intronic
1086426732 11:86691940-86691962 GAGAATGGAAAGGAGGCTACTGG + Intergenic
1087813187 11:102630801-102630823 CAGGACTGACATGAGGCTCCAGG + Intergenic
1088274779 11:108073822-108073844 CAGGACATCAAGGAAGCTCCAGG - Intronic
1089252477 11:117174949-117174971 GAGGACAGGGAGGAAGCTTCAGG - Intronic
1090082663 11:123624429-123624451 GAGGAGGGTGAGGAGGCTCCAGG + Intronic
1090440068 11:126718172-126718194 GAGGGCAGAAATGTGGCTGCAGG - Intronic
1090536414 11:127646416-127646438 GAGGGCAAAAAGGAGGGTCAGGG + Intergenic
1090945520 11:131426290-131426312 GAGGACAGAAATCCTGCTCCAGG + Intronic
1090950155 11:131465866-131465888 GAGGACAGAGAGGGGTCTCACGG - Intronic
1091113490 11:132993317-132993339 GAGGACAGAAAGGGCGCCCTGGG - Intronic
1091221393 11:133931728-133931750 GAGGCCACAGAGGAGGCTCTTGG - Exonic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1092180728 12:6445064-6445086 GGGCACAGAAAGGAGCCGCCTGG + Exonic
1094412522 12:30182439-30182461 GATGACAGAAAGCAGACTGCTGG + Intergenic
1095421759 12:42031454-42031476 GAGGTCAGCAAGGAGGTCCCAGG - Intergenic
1096034576 12:48454558-48454580 GAGGACAGAAAGCAGGCCACAGG - Intergenic
1096636140 12:52960780-52960802 GAGGAGAGAGGGGAGGCTGCTGG - Intergenic
1096771204 12:53937086-53937108 GAGTTCAGAAAGCAGGCTGCGGG - Intergenic
1096829117 12:54300824-54300846 GAGGAGAGAGATGAGGCTCCCGG + Intronic
1096981979 12:55733335-55733357 GGGAACACAAAGGAGTCTCCAGG + Intergenic
1097131755 12:56816413-56816435 GAGGACAGAAGGGAGAGACCTGG - Intergenic
1097394748 12:59060177-59060199 GAAGACAGAAAACAGGATCCGGG + Intergenic
1098123968 12:67270236-67270258 GCGGGCAGAGAGGAGGCTGCCGG - Intronic
1098306761 12:69110079-69110101 AAGGAGAGAAAGGAGGCTAAGGG - Intergenic
1099401972 12:82211409-82211431 GAGGACAGAGAGGAGGTAACAGG - Intergenic
1100786923 12:98088543-98088565 GATGACTGAAACGAGGATCCAGG - Intergenic
1101712885 12:107284884-107284906 GAAGACAGACAGGAGGATCTGGG + Intergenic
1102254537 12:111407826-111407848 GAGGATAGTGAGGAGGGTCCTGG + Intronic
1102527951 12:113525281-113525303 GAGAACAGAGAGGAGACACCTGG - Intergenic
1104590322 12:130079615-130079637 GAAGACCGAAAGCAGACTCCTGG - Intergenic
1104607375 12:130199936-130199958 GAGGACGGAAAGGAGTATGCAGG + Intergenic
1104626642 12:130361634-130361656 GAGGACATAAAGCAGGGTTCTGG + Intronic
1104676127 12:130713744-130713766 CCGGACACAAAGGAAGCTCCCGG + Intronic
1106059231 13:26270568-26270590 AGGGACAGAAAGGAGATTCCTGG - Intronic
1106140399 13:27006538-27006560 GAGGAAAGTAGGGAGGCCCCGGG - Intergenic
1106242107 13:27920612-27920634 GGGAACAGAGAGAAGGCTCCTGG - Intronic
1106375629 13:29184283-29184305 GAGGAAATAAGGGAGGCCCCTGG - Intronic
1106518677 13:30477440-30477462 TAGGACAGAAAGGAGCAGCCAGG + Intronic
1107832955 13:44390583-44390605 CAGGGCACAAAGGAGGCTGCAGG - Intronic
1108495476 13:51020397-51020419 GAGGGCAAAAAGGTGGCTGCAGG - Intergenic
1108644092 13:52408988-52409010 GATGACAGGAAAGAGGCACCAGG + Intergenic
1108837519 13:54570498-54570520 GAGGAAAGAAAGAAGGCTATAGG + Intergenic
1109768143 13:66932305-66932327 GACAACAGAAAGGATGCTCCTGG - Intronic
1110845442 13:80186514-80186536 GAAGACACAAAGGAGGCTTTGGG - Intergenic
1112143294 13:96670529-96670551 CTGGAGAGAAAGGAGGTTCCAGG + Intronic
1113596903 13:111539976-111539998 GGGGACAGAGAGGAGCATCCAGG - Intergenic
1113785708 13:113001200-113001222 GAACACAGAAGGCAGGCTCCCGG - Intronic
1113812198 13:113149672-113149694 GGGGGCAGGATGGAGGCTCCAGG + Intergenic
1114405923 14:22456007-22456029 TAGGACTGAAAGGAGCCTCAAGG - Intergenic
1114501859 14:23175583-23175605 GAGGAAAGAAAGTAGGAACCCGG - Intronic
1115632838 14:35262604-35262626 AAAGAAAGAAAAGAGGCTCCAGG + Intronic
1116767723 14:49092490-49092512 GTGGACAGAAAGGATGCTGTTGG - Intergenic
1117294711 14:54368734-54368756 GGGGACACAAAGGAGGCTCTGGG + Intergenic
1117562070 14:56950814-56950836 AAAGACAGAAAGGAGACTCATGG + Intergenic
1118884946 14:69858894-69858916 GGGAACAGAGAGGAGGCTGCTGG + Intronic
1120486352 14:85118454-85118476 GAGGACAGGAATGAGGCTAAGGG - Intergenic
1120853701 14:89194592-89194614 GAGGAGAGACAGGAGGCTGTTGG - Intronic
1121102715 14:91261129-91261151 GAGGACAGAATAGAGTCTCACGG - Intergenic
1121422446 14:93824985-93825007 GGGGGCGGAAAGGAGCCTCCAGG + Intergenic
1121637523 14:95463734-95463756 GAGGAGCCACAGGAGGCTCCAGG - Intronic
1122309340 14:100784626-100784648 GTACACAGAAAGGTGGCTCCAGG - Intergenic
1122445848 14:101767958-101767980 GAGGTCACAAAGGAGGTACCTGG - Intronic
1122447610 14:101781272-101781294 GAGGACAGAAGCCAGGGTCCCGG - Intronic
1123124585 14:105937416-105937438 GAGGGCAGCATGGAGGCACCTGG + Intergenic
1123415700 15:20093470-20093492 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1123525039 15:21100584-21100606 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1123798146 15:23794359-23794381 GAGTACAGAGCAGAGGCTCCAGG - Intergenic
1124010835 15:25837464-25837486 CAGAGTAGAAAGGAGGCTCCCGG + Intronic
1124973701 15:34514608-34514630 GAGGGCAGAGAGGGGGCGCCCGG - Intergenic
1125107264 15:35986823-35986845 AGGGACAGAAAGCAGGCTGCAGG - Intergenic
1127130380 15:55856003-55856025 CAGCACAGAATGTAGGCTCCAGG - Intronic
1127676792 15:61246951-61246973 GAGCAGAGGAAGGAGGTTCCAGG + Intergenic
1128015242 15:64339084-64339106 GAGGAGAGAAAAGGGGCTACAGG + Intronic
1128106606 15:65050008-65050030 GAGCACAGTGAGGGGGCTCCCGG + Exonic
1128394603 15:67211324-67211346 GAGGAGATAAGGGGGGCTCCAGG - Intronic
1129030924 15:72617020-72617042 CCGGACAGAGATGAGGCTCCTGG - Intergenic
1129193446 15:73951111-73951133 CAGGAAACAAAGGAGGCTGCTGG + Intronic
1129854237 15:78812204-78812226 GAAGGGAGAAAGGAAGCTCCTGG - Intronic
1130119559 15:81035813-81035835 GAGGAAAGAATGGAGGATGCTGG - Intronic
1130231877 15:82103367-82103389 GAGCACAGAAAAGAGGCTAGAGG + Intergenic
1130562954 15:84972938-84972960 CAGGTCAGAGAGGAGGCTCCTGG - Intergenic
1130948980 15:88570879-88570901 AAAGACAGAAAGGAGTTTCCAGG - Intergenic
1132864559 16:2087021-2087043 GAGGACACAACGCAGGCTCGGGG - Intronic
1133353656 16:5120014-5120036 GAGTACAGAGAGGAGGAACCAGG + Intergenic
1134037564 16:11042413-11042435 GAGGACAGGAGGGAAGCTGCTGG + Intronic
1134213914 16:12301250-12301272 GAGTACAGGAAGGAGTCTACTGG - Intronic
1136346413 16:29679046-29679068 GAGGACAGGAGGGAGGCTTGGGG + Exonic
1136484713 16:30564040-30564062 GAGGCCAGCTAGGAGGCCCCTGG - Intergenic
1136518577 16:30782415-30782437 GAGGGCAGAGCGGAGGCCCCCGG - Exonic
1136532008 16:30876108-30876130 GAGGACAGAAAGTAAGTTCTTGG + Intronic
1136550553 16:30980315-30980337 GAAGGCAGAAAAGAGGCACCAGG - Intronic
1137393372 16:48099705-48099727 GAGGCCAGGAAGGAGGACCCAGG - Intronic
1137429924 16:48410383-48410405 GACTAGAGAAGGGAGGCTCCTGG - Intronic
1137573145 16:49579568-49579590 GGAGACAGAAGGGAGGGTCCAGG + Intronic
1137963797 16:52911374-52911396 GAGGACAAAAAGGCAGGTCCAGG - Intergenic
1138085404 16:54129189-54129211 TAGGACAGAAAGAAGACTGCTGG + Intergenic
1138138620 16:54546747-54546769 GATGCCAGCAAAGAGGCTCCAGG + Intergenic
1138190400 16:55009527-55009549 GAGGACAGAAAGCAGACTTGGGG - Intergenic
1138191507 16:55017500-55017522 GAGGGCAGCATGGAAGCTCCTGG + Intergenic
1138672826 16:58629486-58629508 GAGGCCAGCGAGAAGGCTCCAGG - Intronic
1139038593 16:62977397-62977419 CAGGAGAGAGAGGAGGATCCAGG + Intergenic
1139039132 16:62982012-62982034 GAGGACACAAAGGAGGCTTTGGG + Intergenic
1139267902 16:65656968-65656990 GAGGAACAAACGGAGGCTCCAGG - Intergenic
1139517360 16:67459787-67459809 GGAGGCAGAAAGGAGGGTCCTGG + Intronic
1141126539 16:81404585-81404607 GAGGACAGTTAGGAGACTGCTGG - Intergenic
1141311556 16:82918144-82918166 GACCACAGAAAGGAGGTACCCGG - Intronic
1141481583 16:84310084-84310106 GAGGAGACACAGGAGGCTCGAGG + Intronic
1141865099 16:86744896-86744918 GAGGACACAAAGGAGGCTTTGGG + Intergenic
1142065335 16:88059199-88059221 GAGGAGAGTAGGGATGCTCCTGG + Intronic
1142227739 16:88885715-88885737 GAGGACAGGGAGGAGGCTGGTGG - Intronic
1142848836 17:2694682-2694704 GAGGGCAGCCGGGAGGCTCCCGG - Intronic
1144070780 17:11669496-11669518 GAGGACCGGAAGGAGGTTCTGGG + Exonic
1145285582 17:21503826-21503848 GTGGAAAAAGAGGAGGCTCCAGG + Intergenic
1145987411 17:29056313-29056335 GTGCACAGAAGGGAGGCTTCTGG - Exonic
1146358953 17:32159055-32159077 GAGGCCATAGTGGAGGCTCCAGG - Intronic
1146464922 17:33078901-33078923 TAGGACAGGAAGAAGGCTCAAGG + Intronic
1147164508 17:38586239-38586261 GAGGACAGAGAAGAGGGTCGAGG + Intronic
1147605870 17:41773416-41773438 GAGGAGAGGAAGGAGGCAGCTGG - Intronic
1148199517 17:45740633-45740655 GAAGACAGAAAGGCAGGTCCAGG + Intergenic
1148217008 17:45838827-45838849 GAGGGCAGCAAGGAGGCCTCAGG + Intergenic
1148755226 17:49969661-49969683 CAGGACAGGTAGGAGTCTCCGGG - Exonic
1148844080 17:50518493-50518515 GAGGGCAGTAAGAAGGCTCTGGG - Intronic
1148848976 17:50545326-50545348 GAGGACAGAGGAGAGGCTTCAGG - Intronic
1149449354 17:56737868-56737890 GAGGTCAGGAAGCAGGCCCCAGG - Intergenic
1149894792 17:60421518-60421540 GAGGACACGAAGGAAGGTCCGGG + Intronic
1149988142 17:61364003-61364025 GAGGACAGCAAAGGTGCTCCTGG - Intronic
1150001661 17:61444218-61444240 GAGGACAGGAAGGAGTCCCCAGG - Intergenic
1150143623 17:62750375-62750397 GAGGACAGTCAGGAGGTTCCTGG + Intronic
1150552499 17:66223698-66223720 GAGCACAGACAGGAAGCTCCGGG + Exonic
1151081491 17:71334381-71334403 GAAGACTGACAGCAGGCTCCTGG - Intergenic
1151390277 17:73782517-73782539 GAGGACAGACAGGAGGTTGTGGG - Intergenic
1151651865 17:75475246-75475268 GAGAACAGAAGGGAGGGCCCGGG - Intronic
1151696317 17:75719875-75719897 GATGACAGCATGGAGGCTCAGGG + Intergenic
1151878391 17:76880329-76880351 GAGGTCAGAAGGGAGGCCACAGG - Intronic
1152008645 17:77697423-77697445 CATGAAAGAGAGGAGGCTCCTGG - Intergenic
1152240252 17:79157206-79157228 GAGGACAGAGTGGGGGCCCCTGG - Intronic
1152390717 17:80002222-80002244 GAGGACAGAAATGAGGCTCTCGG - Intronic
1152575334 17:81137508-81137530 GAGGGCACAGAGAAGGCTCCAGG - Intronic
1153466615 18:5395305-5395327 GAGGACGGAATGGAGGCCCTTGG + Intronic
1153526421 18:5998794-5998816 GAGGACAGAAAGGAGGGGACAGG - Intronic
1156894933 18:42235180-42235202 GAGGAGAGAAAGGAAGGTCGGGG - Intergenic
1157904731 18:51559462-51559484 GAGGAAACAATGCAGGCTCCAGG + Intergenic
1158795469 18:60840364-60840386 GAGGACACAAAGCAGGCTCAGGG + Intergenic
1161055623 19:2189407-2189429 GAGGAGAGAAAGAGGGCTCGAGG - Intronic
1161266101 19:3365565-3365587 GAGAACAGAATGTGGGCTCCAGG + Intronic
1161394726 19:4038918-4038940 GGGGACAGGAAGGAGGCCCCTGG - Exonic
1161504868 19:4638591-4638613 CAGGACACACAGGAGCCTCCCGG - Intergenic
1161571597 19:5033679-5033701 CGGGACAGGGAGGAGGCTCCTGG - Intronic
1161582798 19:5090103-5090125 GAGGACAGAGTGGAAGGTCCTGG + Intronic
1161699827 19:5788456-5788478 GTGGGTAGAAGGGAGGCTCCAGG - Intronic
1161903165 19:7134927-7134949 GAGAAGAGACAGGAGGCTCTTGG + Intronic
1162495025 19:11018738-11018760 GAGGACAGAAGGGAGGCCACTGG - Intronic
1162535911 19:11262633-11262655 GGGGACGGAGAGGAGGCCCCGGG + Intergenic
1162950998 19:14072251-14072273 GCGGCCAGTAAGGCGGCTCCTGG + Intergenic
1163111160 19:15161492-15161514 GAGGACAGAGCAGAGGCCCCAGG + Exonic
1163190264 19:15672418-15672440 GAGGACAGAGCGGAGGCACAGGG - Intergenic
1163500709 19:17674544-17674566 GAGGACAGAGGGGAGTCACCCGG + Intronic
1164941212 19:32253293-32253315 GAGGAGTGAAAGGAGGGCCCAGG - Intergenic
1165185309 19:34015389-34015411 GAGGATAGAATGGTGGTTCCCGG + Intergenic
1165278284 19:34773339-34773361 GAGAACAGAAAGTGCGCTCCAGG - Intergenic
1165309271 19:35020852-35020874 GAGGCCAGGGAGGAGGCTGCTGG + Intronic
1165315980 19:35055684-35055706 GAGGCCAGGGAGGAGGCTCTGGG - Intronic
1165433171 19:35783829-35783851 GGGGACCGGAAGGAGGCTCTGGG + Intronic
1166596062 19:44051422-44051444 GATGGCTGAAAGGAGGCTCAGGG - Intronic
1166728310 19:45042319-45042341 GAGGACAGACTGGAGGAGCCAGG + Intronic
1167330364 19:48852096-48852118 AAGGACAGAAAGGAGGCTAAGGG + Intronic
1167656077 19:50765169-50765191 GAGGAAAGAAAGGGTGCTCCAGG + Intergenic
1167728246 19:51233832-51233854 GAGGGCAGCATGGAGGCACCCGG - Intronic
1168102353 19:54148040-54148062 GAGGCCAGAGAGGAGGCTGCTGG + Intronic
1168355255 19:55696226-55696248 GAGGACAACCAGGAGGCGCCTGG - Intronic
925342562 2:3147434-3147456 CAGGACAGAAAGGAGACCTCGGG + Intergenic
926125590 2:10269959-10269981 GAGGACAGAGAGGAGGCCCGGGG + Intergenic
926723849 2:15982548-15982570 GAGGACAGGCAGAAGGATCCAGG + Intergenic
926727114 2:16007238-16007260 GAGGACAGTGATCAGGCTCCTGG - Intergenic
926750106 2:16192008-16192030 GAGGAGAGAACTGAGGCTCAGGG + Intergenic
927038273 2:19203258-19203280 GAGCACAGAAAGGAGGGGGCAGG + Intergenic
927216295 2:20669534-20669556 AGGGACAGACAGGCGGCTCCTGG + Intronic
927460273 2:23292792-23292814 GAGCACAGGTAGGAGGTTCCCGG + Intergenic
927561263 2:24076012-24076034 GGGGACAGAAATGTGGCTCAAGG + Intronic
928126930 2:28623291-28623313 GAGCCCAGAGAGGAGGCTCAAGG + Intronic
929510754 2:42564187-42564209 GGGGACAGAAATGAGCCTCTGGG - Intronic
930234279 2:48873997-48874019 AAGGTCAGAAAGGATGCTCAGGG - Intergenic
931222485 2:60300429-60300451 GGGGACAGAAGGGAGGGTCTAGG - Intergenic
931612379 2:64116016-64116038 GAGGACAGAAAGGAACCTAAGGG + Intronic
932073945 2:68645868-68645890 GAGCACAGAAAGGAAGCTGGTGG - Exonic
933608568 2:84410198-84410220 GAGCACAGACAGGAGGCCTCAGG + Intergenic
933989603 2:87624782-87624804 GTGCAGAGACAGGAGGCTCCCGG + Intergenic
934745952 2:96760010-96760032 GATGACAGTATGGAGGCACCAGG + Intergenic
935545022 2:104391707-104391729 AAGGAAAGAAAGGTTGCTCCAGG + Intergenic
935658826 2:105448080-105448102 AAGCTGAGAAAGGAGGCTCCAGG - Intergenic
935757513 2:106288019-106288041 AAGGACAGAAGGGAGGCTTTTGG + Intergenic
936243767 2:110809167-110809189 GAAGAAAGAAAGAAGACTCCTGG - Intronic
936304240 2:111326044-111326066 GTGCAGAGACAGGAGGCTCCTGG - Intergenic
936917618 2:117655811-117655833 CAGGAAAGAAAGGAAACTCCAGG + Intergenic
937250298 2:120519517-120519539 GCGGTCAGAAAGGCTGCTCCAGG - Intergenic
938293743 2:130163946-130163968 GAGCAGGCAAAGGAGGCTCCAGG + Intronic
939385899 2:141497543-141497565 GAGAACAGGAAGGAAGGTCCAGG + Intronic
939735351 2:145837311-145837333 GGGGACAGAAAGAAGGTTTCAGG + Intergenic
941728636 2:168890962-168890984 GAGGACAGGAATGAGGCACAAGG + Intronic
942658199 2:178236894-178236916 GAAGACAGGAAGGAGGCTGGGGG - Intronic
943421479 2:187673350-187673372 GAGGACGCAAAGGAGGCTTTGGG + Intergenic
944522961 2:200590007-200590029 GAGGAGAGAAAGAAGCCTCAGGG - Intronic
945016863 2:205527686-205527708 GAAGAATGAAAGGAGGCTGCAGG - Intronic
945177748 2:207060623-207060645 GAGGACAGAGAGGAGTCCGCTGG - Intergenic
945600488 2:211856713-211856735 GAGGAAAGAAAGCAGACTTCTGG + Intronic
946103106 2:217343961-217343983 GAGGGCAAAAAGGAAGCACCTGG + Intronic
946133839 2:217629152-217629174 GAGTACAGAAAAGTGGCTCAAGG + Intronic
946507575 2:220317912-220317934 GAGGAGAGAAAGAAGGATCACGG - Intergenic
947161668 2:227221369-227221391 GAGGGAAGACAGGAGACTCCAGG - Intronic
948403824 2:237702982-237703004 GGGCAGAGAAAGGAGGCTTCAGG + Intronic
948717012 2:239871572-239871594 GAGGACAGAGGGGACTCTCCAGG + Intergenic
1168772094 20:421865-421887 GAGCCCAGCGAGGAGGCTCCTGG + Intronic
1168898205 20:1338353-1338375 GAGGGCAAAAAGGGGGTTCCAGG - Intronic
1169342828 20:4809532-4809554 GGGGCCAGAGAGGAAGCTCCAGG - Intronic
1169849896 20:10036887-10036909 GAGGACAGAAAAGAGTCTTGAGG + Intronic
1169867164 20:10214515-10214537 GAGGGCAGAAAGGAGTCTGATGG + Intergenic
1170635776 20:18103057-18103079 GGGGACATAAAGGAGTCTTCTGG + Intergenic
1170902617 20:20480620-20480642 GAGGCAGTAAAGGAGGCTCCAGG + Intronic
1172167084 20:32906118-32906140 AGGGACAGAAAGGAAGCTCCCGG - Intronic
1172205758 20:33161843-33161865 GAGGCCAGAGAGGAGGCTTTGGG + Exonic
1172485587 20:35296116-35296138 GAGGGCAGACAGGTGGCTCCCGG + Intergenic
1172763228 20:37336555-37336577 GAGCAGACCAAGGAGGCTCCAGG + Intergenic
1172930092 20:38580241-38580263 CATGGCAGAAAGGAGGCTTCGGG - Intergenic
1172932361 20:38595578-38595600 GAAGACACAAAGGAGGCTTTGGG + Intergenic
1173070193 20:39756866-39756888 GAGGACAGAGAGCAGTCCCCTGG - Intergenic
1173077714 20:39835611-39835633 AAGGACAGGAAGTAGTCTCCAGG - Intergenic
1173163118 20:40666898-40666920 GTGGACAGATGTGAGGCTCCAGG + Intergenic
1173236260 20:41248501-41248523 GAGGACTGAAAGCAGGCAGCAGG + Intronic
1173249695 20:41358007-41358029 GAGGGCAGAGAAGAGGCTGCTGG - Exonic
1173640883 20:44601138-44601160 GAGGACAGAAAGGTGTCCCTGGG + Intronic
1173903886 20:46611748-46611770 GAGGTCAGACAGGAGGGTACGGG - Intronic
1174520034 20:51122264-51122286 GAGGCCAGAGAGGAGGCTAAGGG - Intergenic
1174547542 20:51337027-51337049 GAGGACACAAATGCAGCTCCAGG + Intergenic
1174768230 20:53273660-53273682 GAGGCCAGCAAGGAGGCTGTTGG + Intronic
1175411031 20:58769172-58769194 GAGCTGAGTAAGGAGGCTCCAGG - Intergenic
1175741274 20:61421157-61421179 GGGGACACAAGGTAGGCTCCTGG + Intronic
1177144705 21:17394874-17394896 GTGGGCAGAATGGAGGCTTCTGG + Intergenic
1179130259 21:38630063-38630085 AGGGACAGAAAGGAGAATCCAGG + Intronic
1179983431 21:44908101-44908123 GAGGACAGACGGGAGCCACCCGG + Intronic
1180910928 22:19449436-19449458 GAGGAGAGAATGGTGGCCCCAGG - Intergenic
1181088824 22:20458220-20458242 GTGGAAACACAGGAGGCTCCTGG - Intronic
1181460428 22:23083017-23083039 GAGACCAGGCAGGAGGCTCCAGG + Intronic
1181475962 22:23168100-23168122 TGGGCCAGAAAGGGGGCTCCAGG - Intergenic
1181622065 22:24098072-24098094 GAGGAGGGGAGGGAGGCTCCGGG - Exonic
1182106474 22:27693423-27693445 GAGGACAGGATGGTGTCTCCAGG + Intergenic
1182544386 22:31066009-31066031 GAGGACAGACAGAAGTCTGCAGG - Intronic
1183196424 22:36356817-36356839 GTAGACAGAAAGCAAGCTCCTGG + Intronic
1183324407 22:37183652-37183674 GGGGACAGAAAGGAGGGCACAGG + Intronic
1183730470 22:39615642-39615664 GAGGATAGAAAGGAGGACACAGG - Intronic
1183786018 22:40029683-40029705 GAGGCCAGGACGGAGGCTGCAGG - Exonic
1184149016 22:42627861-42627883 GAGGACAGAGCTGAGCCTCCGGG - Intronic
1184379769 22:44137994-44138016 GAGGACAGCAAGGAGGAGCTGGG + Intronic
1184434153 22:44459891-44459913 GAGGCCTGGAAGGAGGGTCCAGG - Intergenic
1184456274 22:44611535-44611557 GAGGACAGATAGGTGGTGCCAGG + Intergenic
1184460561 22:44635374-44635396 GGGGAAGGAAAGCAGGCTCCAGG + Intergenic
1184957441 22:47900193-47900215 GTGGGCAGAAATGATGCTCCTGG - Intergenic
1184993334 22:48185037-48185059 GAGGAGGGAAGGAAGGCTCCTGG + Intergenic
1185064975 22:48627654-48627676 GAGCCAAGAAAGGAGGCTGCTGG - Intronic
1185088275 22:48752445-48752467 GTGGGCAGCAAGGAGGCTCTGGG - Intronic
949161989 3:893534-893556 GAGGACGCAAAGGAGGCTTTGGG + Intergenic
950100194 3:10352071-10352093 GAAGGCAGAAAGGAGACCCCAGG - Intronic
950105588 3:10386330-10386352 GAGGGCACAAAGGAGGGTCTGGG + Intronic
952895113 3:38073533-38073555 GAAGACACAAAGGAGGCTTTGGG + Intronic
953340590 3:42131191-42131213 GAGGGGAGACAGGAGCCTCCAGG - Intronic
953367403 3:42357817-42357839 GAGGAGAGAAATGAGGCACAGGG - Intergenic
953624581 3:44560327-44560349 GAGGAGATTAAGGAGGGTCCAGG + Intronic
953656457 3:44858545-44858567 GAAGACACAAAGGAGGCTTTCGG + Intronic
953670418 3:44957641-44957663 GAGGACAGGAAGGAGGCAGAGGG - Intronic
953885433 3:46712249-46712271 GAGGGCAGCAAGGAGGCTGAGGG + Exonic
953903142 3:46854562-46854584 GAGGCCAGTGAGGAGGGTCCAGG - Intergenic
953933520 3:47019907-47019929 GGGGAAAGAAAGGAGGGTTCTGG - Intronic
954108369 3:48421074-48421096 GGGCACAGAATGGAGGCTTCAGG + Intronic
955859330 3:63310830-63310852 GAAATCAGAAAGGAGACTCCTGG + Intronic
956465594 3:69517748-69517770 GAAGGCAGTAAGGAGGCTCAAGG - Intronic
956927121 3:74001683-74001705 GAGGACAGAAAGGAGCTCCTAGG - Intergenic
957057608 3:75456007-75456029 GAGTACAGAGAGGAGGAACCAGG + Intergenic
957313347 3:78546713-78546735 GAGGACAGAATGGAGTCTGCAGG + Intergenic
957417821 3:79929220-79929242 GAGCACAGGAAGGAGGCTGAGGG + Intergenic
958168282 3:89905736-89905758 AAGAAAAGACAGGAGGCTCCTGG - Intergenic
959897043 3:111617110-111617132 GAGCACAGGAAGGAGGCAGCAGG + Intronic
960618797 3:119619940-119619962 GAGTGCAGAAAGGAGGCAGCCGG - Intronic
960972497 3:123149882-123149904 GGGGGCAGAAAGGAGGGGCCTGG + Intronic
961295848 3:125883723-125883745 GAGTACAGAGAGGAGGAACCAGG - Intergenic
961332996 3:126153983-126154005 GAGGACAGCAGAGAGGCTTCTGG + Intronic
961703311 3:128764161-128764183 AAGGACAGAAAGGAGTCACAGGG - Intronic
961768105 3:129228032-129228054 GAGGAAGGAAATGAGGCTTCAGG + Intergenic
963836298 3:150061328-150061350 GAGGGCAGAAAGGACACTGCTGG - Intergenic
964088294 3:152844936-152844958 GAGGACAAAAAAGAGTCTGCTGG + Intergenic
964273789 3:154987141-154987163 GAGGACAGCATGGAGGCACTGGG + Intergenic
964758912 3:160115086-160115108 GAGAGCACCAAGGAGGCTCCTGG + Intergenic
966232749 3:177668715-177668737 GAGGACACAAAGGAGGCTTTGGG + Intergenic
967279504 3:187808338-187808360 GAAGACAAATGGGAGGCTCCAGG + Intergenic
967562754 3:190935539-190935561 GAGGATGGAAAGGAAGCTACAGG - Intergenic
967855578 3:194115076-194115098 GGGGACACACAGGAGGCTGCAGG - Intergenic
967920217 3:194608957-194608979 GATGACAGCCAGGAGGCTGCTGG + Intronic
968542499 4:1175213-1175235 GAGGAGAGGAAGGAGGCGCCGGG + Intronic
968849917 4:3072284-3072306 GAGGACATAAAGGCGGCCTCTGG - Intergenic
969042764 4:4313724-4313746 AAGGACAGGAAGGAGGGTCGAGG - Intronic
969417073 4:7067876-7067898 GAGGCCGGGAAGGAGGCCCCGGG + Intronic
969526010 4:7704424-7704446 GAGGACAGGACCGAGGCTCCAGG + Intronic
970152549 4:13104970-13104992 GAGGTAAGACAGGAGGATCCTGG + Intergenic
971262497 4:25069839-25069861 GAGGGCAGAAAGGAAGCCCAGGG + Intergenic
972981504 4:44709232-44709254 GTGGAGGGAAAGGAGGCTGCTGG + Intronic
978392017 4:108236848-108236870 GAGGCCAGAAAGAAGCCTACTGG + Intergenic
979054520 4:115978524-115978546 GAGGACGCAAAGGAGGCTTTGGG + Intergenic
981229756 4:142338957-142338979 GAGGGGAGAACGGAGGGTCCAGG + Intronic
982088731 4:151862178-151862200 GAGGGAAGAAAGGAGTTTCCAGG - Intergenic
982223317 4:153143062-153143084 GAGGACAGAAGGCAGGCTGTTGG - Intergenic
982318912 4:154059118-154059140 GAAGACACAAAGGAGGCTTTGGG - Intergenic
982396627 4:154921710-154921732 GAAGACACAAAGGAGGCTTTGGG + Intergenic
984488153 4:180398855-180398877 GAAGTCAGAGAGCAGGCTCCTGG - Intergenic
985233635 4:187849154-187849176 GAGAACCAAAAGGAGGCTCCAGG + Intergenic
985605738 5:857273-857295 GGGGGCAGACAGGAGGCGCCTGG - Intronic
985837954 5:2284107-2284129 GAGGTGGGACAGGAGGCTCCTGG + Intergenic
985869560 5:2543277-2543299 CAGGACAGAAAGGAGTCACCAGG - Intergenic
985926313 5:3022192-3022214 GAGACCAGAGAGGAGGCTTCTGG - Intergenic
986361316 5:6980928-6980950 GGGGTCAGAAAGCAGGCTCTGGG - Intergenic
988854797 5:35217466-35217488 GAGTTTAGAAAGGAAGCTCCAGG + Intronic
990062677 5:51671420-51671442 GAGGACAGAAAAGTGACTTCTGG - Intergenic
991396457 5:66209418-66209440 GGAGGGAGAAAGGAGGCTCCAGG - Intergenic
992532780 5:77668546-77668568 CAGAAGAGAATGGAGGCTCCAGG + Intergenic
993899908 5:93578461-93578483 GAGGAAGGAAGGGAGGCTCCCGG + Intergenic
997197213 5:131988145-131988167 GTGGAGAGGAAGGAGACTCCAGG - Exonic
997469281 5:134107856-134107878 GATGAGAAAAAGAAGGCTCCAGG + Intergenic
998676133 5:144410016-144410038 GAGGAGGGGAAGGATGCTCCAGG + Intronic
999114998 5:149155156-149155178 GAGGAGGGAAAGGAGGCCTCAGG - Intronic
999964708 5:156796989-156797011 GAAGAGAGAAAGGAGGCCCTGGG + Intergenic
1001246355 5:170108170-170108192 GAAGACAGAGAGCAGTCTCCCGG + Exonic
1001321939 5:170689835-170689857 GAATCCAGAAAGGGGGCTCCTGG - Intronic
1001886228 5:175293139-175293161 GAGGACAGTAAGGCAGCTGCAGG - Intergenic
1003426209 6:5999867-5999889 GTGGAGAGCAAGGAGGATCCAGG - Intronic
1003680182 6:8245011-8245033 GAGGAGTGAAAAAAGGCTCCTGG - Intergenic
1004171670 6:13300077-13300099 GTAGACACAAGGGAGGCTCCTGG + Intronic
1004925954 6:20415316-20415338 GAGGGGACAAAGGAGGCTTCAGG + Intronic
1005814844 6:29542153-29542175 CAGGACAGAAACCAGGTTCCTGG - Intergenic
1007228337 6:40330269-40330291 GAGGACAGTGAGAAGGCTGCTGG - Intergenic
1007442357 6:41873395-41873417 GAGGCCAGAAAGTAGGTCCCAGG + Intronic
1007830640 6:44635842-44635864 GAGGACAGAGAAGACTCTCCAGG + Intergenic
1008011086 6:46468531-46468553 GAGGACAGAAAGGAGAAGCTGGG - Intronic
1008394480 6:50990861-50990883 GAGGTGAGAAAGGAAGCTCTGGG + Intergenic
1009489665 6:64273957-64273979 GAGAACAGAAAGGAGTCTGGAGG - Intronic
1011000566 6:82583675-82583697 GAGAACTGAAAGGAGCCCCCAGG - Intergenic
1014690261 6:124554950-124554972 GAAGACAGAGAGGAGGCTCTGGG - Intronic
1015165321 6:130195183-130195205 GAGGACATGAAGGAGGCTTTGGG - Intronic
1017409564 6:154153717-154153739 GAGGAGAGAAGGAAGGCACCAGG + Intronic
1017676777 6:156822457-156822479 AATGACACAAAGGAGGCTCACGG - Intronic
1017815649 6:158014745-158014767 GAGGACAGAAGGCAGGCACCAGG - Intronic
1018359728 6:163055010-163055032 GAGAACAGAAAGGAGATTCAAGG + Intronic
1018507354 6:164485553-164485575 GAGGACAGAAAGAAGGCATGAGG + Intergenic
1018557612 6:165064986-165065008 CAGGAAAGAAAGGGGGCCCCAGG + Intergenic
1018910997 6:168101017-168101039 GAGGGCAGACAGGAGGCTAGGGG + Intergenic
1019529387 7:1495925-1495947 GAGCACACAAAGGACGCTCATGG + Intronic
1022223580 7:28340104-28340126 TAGGGCACAAAGCAGGCTCCTGG - Intronic
1023394561 7:39740725-39740747 GAGGGCACAAAGGAGGCTTAAGG - Intergenic
1023744007 7:43304992-43305014 GAGGCCAGAGAGGAAGCTGCGGG + Intronic
1024976145 7:55115717-55115739 GAGGGCACACAGGAAGCTCCAGG - Intronic
1026533586 7:71221433-71221455 GACCCCAGAGAGGAGGCTCCGGG - Intronic
1026795548 7:73364029-73364051 GAGGCCAGAAAGGCAGCCCCCGG - Intergenic
1028606440 7:92661127-92661149 GAGAATGGAGAGGAGGCTCCTGG + Intronic
1028846343 7:95484417-95484439 GAGGACATAAAGGGGGCTTCAGG + Intronic
1031989483 7:128188426-128188448 GAGGAGAGCAACGAGGCACCAGG + Intergenic
1032003750 7:128283834-128283856 GAGGACTGAAAGAAGGCTGGTGG - Intergenic
1032537060 7:132672956-132672978 GAGGACAGGAAGGAGGGCCAGGG - Intronic
1032716316 7:134511985-134512007 GAGGACAGGATGGAGGCACATGG - Intergenic
1032804146 7:135339068-135339090 GGGGGCAGAGAGGTGGCTCCAGG - Intergenic
1033419286 7:141192249-141192271 GAGGACAGGCAGAGGGCTCCAGG + Intronic
1034275057 7:149820345-149820367 GTGGACACAAAAGAGGCTCCAGG + Intergenic
1034557661 7:151860230-151860252 CAGGGCAGAAAGGGGGCACCAGG + Intronic
1035247006 7:157569132-157569154 GAGGGGAGAAGGGAGGCCCCTGG + Intronic
1035406586 7:158602629-158602651 GAGGACCCACAGGAGTCTCCAGG + Intergenic
1036025275 8:4900562-4900584 GAGGCCAGAAAGGTGGCACTGGG - Intronic
1036747266 8:11418647-11418669 GAGGACAGAGAGGTGGATGCTGG - Intronic
1036777100 8:11620976-11620998 GAGGTCAGACGTGAGGCTCCAGG - Intergenic
1038256281 8:25954260-25954282 GATGCCAGAATGGAGGCTCCAGG - Intronic
1038328074 8:26587490-26587512 TCAGACAGAAAGGAGTCTCCAGG - Intronic
1038425178 8:27460143-27460165 CGGGACAGCATGGAGGCTCCAGG - Exonic
1038515886 8:28187411-28187433 GAGAACAGAATGAAGGCTCCAGG - Intronic
1040300064 8:46183348-46183370 CAGGACAGACAGGAGGCTTCTGG + Intergenic
1040548836 8:48422976-48422998 GGGGAAAGAAAGGCGACTCCAGG + Intergenic
1040629516 8:49194080-49194102 GAGGGAAGAAAGGAGGCTAGAGG + Intergenic
1042530547 8:69810415-69810437 GTGGACAGAAAGGAAGCTGGAGG + Intronic
1043195832 8:77290225-77290247 CTGGAGAGAAAGTAGGCTCCTGG - Intergenic
1043255885 8:78136056-78136078 GAGGTAAGAAAAGAGTCTCCTGG + Intergenic
1044160834 8:88913065-88913087 GAAGACAGAAAGGGGGCAGCAGG - Intergenic
1044255518 8:90055987-90056009 GTGGGCAGAAGGGAGGCTTCTGG - Intergenic
1044839452 8:96325506-96325528 GAGGACAGGAAGCAGCCTCCAGG - Intronic
1045445385 8:102256969-102256991 GAGTACAGAAAGGATCTTCCAGG + Intronic
1045699828 8:104853004-104853026 GAGGATAGGGAGGAGGCACCAGG - Intronic
1047256785 8:123219605-123219627 GCTGGCAGAAAGGAGACTCCTGG - Intergenic
1048318211 8:133377430-133377452 GACTGCAGACAGGAGGCTCCAGG + Intergenic
1048840175 8:138558712-138558734 AAGGACAGAAAGGGCTCTCCAGG - Intergenic
1049098793 8:140564508-140564530 GAGGAGAGAAAGGAGGAGCTTGG - Intronic
1049153474 8:141051891-141051913 GAAGAAAGAAAGGAGGCAACTGG + Intergenic
1049163481 8:141112252-141112274 GAGGACAGAGCGGAGGCTGAGGG + Intergenic
1049240692 8:141536085-141536107 GAGGACAGACAGGCAGCACCTGG - Intergenic
1049278795 8:141733457-141733479 GGGGACAGAATGGAGGGCCCTGG + Intergenic
1049398358 8:142412411-142412433 GAGGACAGAACTGAGGCTTCTGG + Intergenic
1049443260 8:142618758-142618780 GAGGCCAGGGATGAGGCTCCTGG - Intergenic
1049483853 8:142841091-142841113 GAGGGGAGAAAGCAGGCTTCAGG - Intronic
1050024503 9:1319992-1320014 CAGGAGAGAGAGGAGGCACCAGG - Intergenic
1051100353 9:13513995-13514017 GAGGGCAGATGGGACGCTCCTGG - Intergenic
1052333583 9:27297097-27297119 GGCCACAGAAAGGAGGCTCTGGG - Exonic
1053891600 9:42698528-42698550 AAGCACAGAAAGGAGGCTCACGG - Intergenic
1056409749 9:86313261-86313283 GTGGACAGACTGGAGGCACCAGG + Intronic
1056416930 9:86385960-86385982 GAGGACAGCATGGAGGCACCAGG - Intergenic
1057438501 9:95064161-95064183 CAGGATAGAAAGGAAACTCCAGG + Intronic
1057666306 9:97048272-97048294 AAGGACAGCAAGGAGGATCTAGG - Intergenic
1057891890 9:98875846-98875868 GAGGAAAGAGAGGATGCTCCAGG + Intergenic
1058421897 9:104840534-104840556 GGGGACAGAAAGGAGGGTAGGGG + Intronic
1058474444 9:105317550-105317572 GGGGACTGAGAGGTGGCTCCAGG + Intronic
1058908495 9:109499716-109499738 AAGGACCGAAATGAGGTTCCAGG - Intergenic
1058948579 9:109881839-109881861 GAAGACAGAGATGAAGCTCCAGG - Intronic
1059574716 9:115476189-115476211 GAGGACACAAAGGAGGCTTTGGG - Intergenic
1059889241 9:118782989-118783011 AAGGGCAGAAGGGAGGCTTCTGG + Intergenic
1060174158 9:121485282-121485304 GCAGACAGAATGGAGCCTCCAGG + Intergenic
1060760285 9:126241437-126241459 GAGGACAGACAGTAGCCACCTGG - Intergenic
1060870106 9:127033187-127033209 AAGGACAGAAGTGAGGCACCAGG + Intronic
1061056306 9:128224689-128224711 GAGGACAGGGAGGGGGCTCAGGG - Intronic
1061372139 9:130203438-130203460 GTGGACAGCAAGGAGTCTTCGGG + Intronic
1061725461 9:132580022-132580044 GAGGACAGAGCGGACGCTCTGGG + Intergenic
1061962051 9:133993271-133993293 GAGGACAGGAAGAGGGCTCTGGG - Intergenic
1062004986 9:134234574-134234596 GAGGACAGGGAGGTGACTCCAGG - Intergenic
1062025997 9:134341075-134341097 GAGCACAGATGGGAGGGTCCTGG + Intronic
1186321128 X:8426549-8426571 GAGTTCAGAAAGGCTGCTCCAGG - Intergenic
1186892129 X:13969223-13969245 GAGGACAAGAAAGAGGCTCATGG - Intergenic
1187418078 X:19110741-19110763 GAGGACAGAAAGAACATTCCAGG + Intronic
1187475752 X:19609407-19609429 TAGGACAAAAAGCAGGCTCAGGG - Intronic
1187525733 X:20053054-20053076 GAGGACAGGAAGGACACTTCGGG - Intronic
1188200861 X:27292009-27292031 GAAGACACAAAGGAGGCTTTGGG + Intergenic
1189179182 X:38987349-38987371 GAGGACATGCAGGTGGCTCCGGG + Intergenic
1190325664 X:49205530-49205552 GAGGACGGAAAGGAGTCCCCAGG - Intronic
1192453058 X:71255170-71255192 AAGGACAGAAAGGGGGCTGGAGG - Intergenic
1193096864 X:77559337-77559359 GAAGACAGACACGGGGCTCCAGG + Intronic
1194231509 X:91330953-91330975 GACGACAGATAGGAGGCAGCAGG + Intergenic
1197737364 X:129861640-129861662 AGGAACAGCAAGGAGGCTCCTGG - Intergenic
1199595499 X:149503454-149503476 GAGGAAAGAAACGCGGCTCGGGG + Intronic
1199598379 X:149525757-149525779 GAGGAAAGAAACGCGGCTCGGGG - Intronic
1200001043 X:153059908-153059930 GATGACAGGAAGGAAGCACCAGG + Intronic
1200233999 X:154459582-154459604 GAGGCCAGACAGCGGGCTCCTGG + Intronic
1201937232 Y:19421813-19421835 GAGGACACAAAGGAGGCTTTGGG - Intergenic