ID: 915327642

View in Genome Browser
Species Human (GRCh38)
Location 1:155088995-155089017
Sequence GTTGATGTATGAGCAGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915327641_915327642 4 Left 915327641 1:155088968-155088990 CCAAAATAAGCTCATACTTTAGT 0: 1
1: 0
2: 1
3: 19
4: 260
Right 915327642 1:155088995-155089017 GTTGATGTATGAGCAGAAATTGG 0: 1
1: 0
2: 0
3: 25
4: 196
915327639_915327642 6 Left 915327639 1:155088966-155088988 CCCCAAAATAAGCTCATACTTTA 0: 1
1: 0
2: 0
3: 24
4: 272
Right 915327642 1:155088995-155089017 GTTGATGTATGAGCAGAAATTGG 0: 1
1: 0
2: 0
3: 25
4: 196
915327640_915327642 5 Left 915327640 1:155088967-155088989 CCCAAAATAAGCTCATACTTTAG 0: 1
1: 0
2: 1
3: 19
4: 209
Right 915327642 1:155088995-155089017 GTTGATGTATGAGCAGAAATTGG 0: 1
1: 0
2: 0
3: 25
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915327642 Original CRISPR GTTGATGTATGAGCAGAAAT TGG Intergenic
902597294 1:17518241-17518263 GCTGGTGTCTGAGCAGAAAGTGG + Intergenic
905522944 1:38614216-38614238 GTTGGTGAATGAGCACTAATTGG + Intergenic
906621354 1:47283371-47283393 GATTATGTTTAAGCAGAAATGGG + Intronic
909199023 1:72664986-72665008 GTTGTTATTTGAGCAGAAACAGG - Intergenic
909237676 1:73174672-73174694 GTTCATGTCTAAGAAGAAATGGG + Intergenic
912641316 1:111348406-111348428 GCTGATTTATGAACAGAAAGAGG + Intronic
915327642 1:155088995-155089017 GTTGATGTATGAGCAGAAATTGG + Intergenic
915605459 1:156947565-156947587 GTTGCTGTATGATCTGAAACTGG - Intronic
916254864 1:162776540-162776562 GTTAATTTTTTAGCAGAAATAGG - Intronic
916299797 1:163261317-163261339 CTTTATGTATGAGCAGGAAGGGG - Intronic
919602034 1:199633996-199634018 TTTGATGAATGGACAGAAATAGG + Intergenic
919662614 1:200262154-200262176 TTTGAAGCATGAGTAGAAATTGG - Intergenic
919714347 1:200759988-200760010 GTTGATTTGGGAGCAGACATTGG + Intronic
920627742 1:207619453-207619475 TTTGTTCTATGTGCAGAAATTGG + Intronic
924155999 1:241177246-241177268 GGTGATGTGTGAGCAGACACTGG + Intronic
1065399749 10:25285573-25285595 GTTGATCTATCTGCAGAAACTGG - Intronic
1066257521 10:33695289-33695311 TTTGATGAATTAACAGAAATAGG - Intergenic
1066477753 10:35764417-35764439 GTTGAAGAATGTGCAGAACTGGG - Intergenic
1067687383 10:48475181-48475203 GTTGATCTATCAGCAGCACTTGG + Intronic
1070032215 10:72688020-72688042 GTGGATATATGAGGAGAAATGGG + Intergenic
1072464117 10:95647390-95647412 GTTCATGCATGAACAGAGATTGG + Intronic
1073001581 10:100289859-100289881 GTTAGTGTATCAGCAGAGATGGG - Intronic
1073742547 10:106425133-106425155 GGTAATGTTTGAGCAGAGATTGG + Intergenic
1075736980 10:124670062-124670084 GCTGATGTGTGTGCAGATATGGG + Intronic
1076477321 10:130761789-130761811 GTTGGTTTGTGAGGAGAAATTGG + Intergenic
1077657173 11:4030471-4030493 GTTTATGTAAAAGCAAAAATGGG - Intronic
1079326344 11:19495868-19495890 GGTGATGTATAAGCAGATGTGGG + Intronic
1080842146 11:35994070-35994092 GTGGATATAGGAGCAGAGATGGG + Intronic
1083459374 11:62800465-62800487 GTTGAAGTCTGAGCGGGAATTGG - Exonic
1086613017 11:88779783-88779805 GTTGATGTACGAGGTGAAAATGG - Intronic
1086814161 11:91347868-91347890 CTTGATTTTTGAGCAGACATGGG - Intergenic
1086858786 11:91899709-91899731 TTGGTGGTATGAGCAGAAATAGG - Intergenic
1087412714 11:97811999-97812021 GTGGATGTATGAACAGATGTTGG - Intergenic
1087630442 11:100644541-100644563 GGTGATGTTTGAGCTGAGATTGG + Intergenic
1090165841 11:124546037-124546059 GTTAATGGATGAGGAGAGATTGG - Intergenic
1092600201 12:10052590-10052612 GTTGGTGTAAGAACTGAAATTGG - Intronic
1093731111 12:22567203-22567225 GTTGATTTTTGTGCAGCAATAGG - Intergenic
1093749034 12:22777806-22777828 CTTGATGTATTACCAGAAACTGG - Intergenic
1094066348 12:26364635-26364657 GTTGCTGAATGAGCAGAGGTTGG - Intronic
1096328144 12:50684489-50684511 GTGGATTTATAAGAAGAAATTGG + Intronic
1098906523 12:76168858-76168880 TTTGATGAATGAACAGAAGTAGG - Intergenic
1099085635 12:78243047-78243069 GTTGATATGTGAGCAAATATTGG - Intergenic
1101198388 12:102408909-102408931 ATTAATGTGTGAACAGAAATAGG - Intronic
1102095298 12:110235843-110235865 GGTGATGGATGTGGAGAAATTGG - Intergenic
1102670986 12:114618778-114618800 GCTAATGTTTTAGCAGAAATGGG - Intergenic
1102823569 12:115927630-115927652 GGTGATGTCTGAGCAGAGACTGG + Intergenic
1105407145 13:20142304-20142326 GCTGATGACTGAGCAGAACTGGG - Exonic
1108047586 13:46397790-46397812 GTTGATTTATTATGAGAAATTGG - Intronic
1109325303 13:60860054-60860076 GTTGATTTTTGAGAAGAAAAGGG + Intergenic
1109622188 13:64925316-64925338 ATTGGTCTATGAGCAGCAATGGG + Intergenic
1109999119 13:70171117-70171139 GTTGATTTATGGACAGAAAAAGG + Intergenic
1110142900 13:72152905-72152927 GCTGATGTCTGGGCAGAAATCGG - Intergenic
1110497394 13:76184909-76184931 GTTGATGTATGTGAATACATTGG - Intergenic
1115902566 14:38169287-38169309 GTTGAAGGATGAGCAGACCTTGG + Intergenic
1118397124 14:65347231-65347253 GTTGAAGGTTGAGGAGAAATAGG + Intergenic
1119135802 14:72218184-72218206 GATGATAGATGAGCAGAAATGGG + Intronic
1120143735 14:80956712-80956734 GTTGATAGATGAAAAGAAATGGG + Intronic
1120523483 14:85551253-85551275 GTTGATGGAGGAGCAGTGATTGG + Intronic
1120701152 14:87700300-87700322 ATATATGTATGAACAGAAATGGG - Intergenic
1120984043 14:90317426-90317448 GTTGATGTATGAGAGGAAGTTGG - Intronic
1121307389 14:92915614-92915636 GGGGATGCATGAGGAGAAATGGG + Intergenic
1121514822 14:94542639-94542661 GTTGGTGGAAGAGCAGACATGGG - Intergenic
1123493919 15:20804342-20804364 GTTGATGGATCAGAAGAAATTGG - Intergenic
1123550417 15:21373424-21373446 GTTGATGGATCAGAAGAAATTGG - Intergenic
1124906526 15:33873615-33873637 GTTGATGTAAGAGAAAAAACTGG - Intronic
1125035985 15:35123887-35123909 GATGATTTATGGGCAAAAATTGG - Intergenic
1130909388 15:88260729-88260751 TTTCAAGTTTGAGCAGAAATAGG + Intergenic
1131778710 15:95830524-95830546 GTCTATGTATGGGAAGAAATGGG + Intergenic
1131977845 15:97963260-97963282 GTTGGTGCAGAAGCAGAAATGGG + Intronic
1132020985 15:98362286-98362308 GCTGATGGATGAGAAGAAAGGGG - Intergenic
1132094066 15:98969175-98969197 GTTGATCTAGGAGAAGAGATGGG - Intronic
1202958760 15_KI270727v1_random:100678-100700 GTTGATGGATCAGAAGAAATTGG - Intergenic
1137400434 16:48148811-48148833 CTTGAAGGCTGAGCAGAAATTGG - Intronic
1139390001 16:66601506-66601528 GTTGATCTATGGGCAGCCATGGG + Intergenic
1144573175 17:16413248-16413270 GATGATGGATGAGCAGGAGTTGG + Intergenic
1145765145 17:27453865-27453887 TTTGATGTAAGTGCATAAATAGG + Intergenic
1147367285 17:39967346-39967368 CTTGAAAGATGAGCAGAAATTGG + Intronic
1151266942 17:72963698-72963720 ATTGATGTATCAGAAGAAATGGG - Intronic
1152573135 17:81129153-81129175 GTTGACGTGGGAGCAGAATTCGG - Intronic
1153118067 18:1685198-1685220 GATGATTTATGAACAGAAAAAGG + Intergenic
1153432421 18:5032369-5032391 TTTGATGTATAACCAGAAGTGGG + Intergenic
1154451441 18:14478803-14478825 GTTGATGGATCAGAAGAAATTGG - Intergenic
1155587674 18:27386311-27386333 GTTGATCTTGGAGCAGCAATGGG - Intergenic
1155645593 18:28073639-28073661 GATGATGTATGAGAAGCATTTGG + Intronic
1157146167 18:45164775-45164797 TGTGATGAATCAGCAGAAATGGG + Intergenic
1159752875 18:72324673-72324695 TTTGGTGTCTGAGCAGAAAGGGG - Intergenic
1159826755 18:73222297-73222319 GTTGATGTATGAACTGGAAGAGG - Intronic
1167815800 19:51879734-51879756 GTTGAAGTTTGGGCAGAAAAAGG + Intronic
926894836 2:17674058-17674080 AGTGATATAAGAGCAGAAATTGG - Intronic
928422404 2:31148859-31148881 GTTGTTGTATTAGCATCAATGGG - Intronic
928679378 2:33683894-33683916 TTTGATGAATGATGAGAAATGGG + Intergenic
929908348 2:46066247-46066269 GTAGGTGTATAGGCAGAAATAGG - Intronic
930326078 2:49920024-49920046 GTTGATGTTTCAGGAAAAATTGG - Intronic
931575654 2:63715707-63715729 TGGAATGTATGAGCAGAAATAGG - Intronic
935723627 2:106001922-106001944 GTTGTTTTATTTGCAGAAATTGG - Intergenic
935998945 2:108805910-108805932 GTAGATGTTGGAGCAGAAATTGG + Intronic
936111440 2:109669147-109669169 TTTCATGTATGAGGAGAGATAGG - Intergenic
936634124 2:114236001-114236023 GTTGAGAAATGAGCAGAAAAAGG - Intergenic
941798075 2:169623519-169623541 GTAGTTGTATGAGAAGAAATGGG + Intronic
942624935 2:177890238-177890260 GTTGATGTATCAGGATAAATAGG - Intronic
942926013 2:181433470-181433492 GGTGATACATGAACAGAAATAGG + Intergenic
944072477 2:195688446-195688468 TTTGACCTATGAGCAGAAATGGG - Intronic
944634714 2:201664189-201664211 GGTGGTGTATGGGCAGAAGTAGG - Intronic
946296660 2:218789435-218789457 GAAGATGTATGAACAGAAAAAGG + Intronic
946503564 2:220275560-220275582 GTTTATGCATGGGCAGAGATGGG - Intergenic
946522701 2:220484117-220484139 GTTGATATTTGAGCAGAGATCGG + Intergenic
947864821 2:233389186-233389208 CTTGATGTGTGAACAGAAATGGG + Intronic
1168742370 20:202895-202917 CTTGATGTATCAGCAGCATTTGG - Intergenic
1168801313 20:645196-645218 GTTGTTGTTTTAGTAGAAATGGG - Intergenic
1169621913 20:7516729-7516751 CTTGGTTTATGAGCAGAGATGGG - Intergenic
1169683639 20:8245625-8245647 TTTGATGGATGAGGAGACATGGG - Intronic
1169815211 20:9649488-9649510 GAAGATGTCAGAGCAGAAATGGG - Intronic
1169937815 20:10903809-10903831 GATGAAGTAAGAGCAAAAATAGG - Intergenic
1171083681 20:22215594-22215616 GTTGTTGGAAGAGGAGAAATGGG - Intergenic
1173662419 20:44743895-44743917 TCTGAAGTCTGAGCAGAAATCGG + Intergenic
1173785477 20:45790043-45790065 GCTGAGGTATGAGCAGGACTAGG + Intronic
1174424510 20:50422621-50422643 GGTGATGTTTGAGCTGAAATTGG + Intergenic
1176444702 21:6811424-6811446 GTTGATGGATCAGAAGAAATTGG + Intergenic
1176822867 21:13676459-13676481 GTTGATGGATCAGAAGAAATTGG + Intergenic
1177162099 21:17559002-17559024 GTTGATGGATCTGAAGAAATTGG + Exonic
1177224379 21:18234652-18234674 GCTGATGTATGGGCACAAAGTGG + Intronic
1177266745 21:18796058-18796080 GTTGATTTATGGACAGAAAAAGG - Intergenic
1178941819 21:36913018-36913040 GTGGATGGATGTGCAGAAAGTGG - Intronic
951089788 3:18559145-18559167 GATAATGTATAAGAAGAAATTGG - Intergenic
951680971 3:25294466-25294488 GTTGATGTAAGAGCTAAAAGAGG + Intronic
954939916 3:54362423-54362445 GATGTTATATAAGCAGAAATGGG - Intronic
955647643 3:61157216-61157238 TTTAATGTGTGCGCAGAAATGGG + Intronic
956949824 3:74269540-74269562 GATTATGTATGTACAGAAATGGG - Intronic
958751324 3:98195554-98195576 GCTGTTGTATGGGCAGAAAGAGG + Intronic
959273548 3:104245726-104245748 GCTGATGTTTTAGCAGTAATAGG + Intergenic
959712879 3:109402282-109402304 GTTAAGGGAAGAGCAGAAATAGG + Intergenic
960191341 3:114710056-114710078 ATTGATGTAAGAGTAGAAATAGG - Intronic
961478239 3:127162184-127162206 GTAGATGTAGGTGCAGATATGGG - Intergenic
963472207 3:145754389-145754411 GTTGATATAAGAGCAAAACTAGG - Intergenic
963723185 3:148887635-148887657 GTTGCTGTAAGAGCAGAAAGTGG - Intronic
964367472 3:155965514-155965536 GTTGATTTCTGAGCATGAATAGG - Intergenic
965441114 3:168715730-168715752 CTTGATGTATTTGCTGAAATTGG + Intergenic
965787617 3:172352519-172352541 GATGATGTATAAACTGAAATAGG + Intronic
966071257 3:175881223-175881245 GTTGTTTTATTAGCAGAAACAGG - Intergenic
966215515 3:177498233-177498255 TTTGAAGTATGAGGAGAAGTTGG + Intergenic
966280283 3:178218459-178218481 GTTAATTTATGTGCAGAACTTGG + Intergenic
966471696 3:180296745-180296767 GGGAATGTATGAGAAGAAATTGG + Intergenic
970604314 4:17665243-17665265 CTTGCTGAATGACCAGAAATGGG + Intronic
971011057 4:22435744-22435766 GTTGAGGTATGTGTAGAATTTGG - Intronic
972072569 4:35039024-35039046 GTTGGTCTATGGGCAGCAATGGG - Intergenic
972375965 4:38470825-38470847 GAAGATTTATGAGCAGAAAAAGG - Intergenic
976102086 4:81575596-81575618 GTTAATGTGTGAGCAGATGTTGG - Intronic
976179511 4:82385873-82385895 GGTGATGTAGGGGTAGAAATAGG + Intergenic
977346276 4:95820642-95820664 TTTGAAATATGAGCAAAAATTGG - Intergenic
977415475 4:96727411-96727433 TTTGATTTATTAGAAGAAATTGG - Intergenic
977472623 4:97460113-97460135 GTTGATGGAAGAGGAGAAAGTGG - Intronic
978493498 4:109333841-109333863 GTGATTGTAAGAGCAGAAATTGG - Intergenic
979319464 4:119305412-119305434 GTACATGTATAAGCAGAAAGAGG - Intergenic
979452219 4:120885953-120885975 TTTGCTGAATGACCAGAAATTGG + Intronic
979468423 4:121068876-121068898 TATGATGGATGAGCAGATATTGG - Intronic
980112373 4:128647005-128647027 ATTAATGTAAGAGCAGAGATGGG - Intergenic
980381859 4:132031535-132031557 GTTGATTTATCAGCAGGAAAAGG - Intergenic
981859720 4:149340542-149340564 TTTGATGAATGGACAGAAATAGG - Intergenic
983626452 4:169806547-169806569 GTTGAAATGTGTGCAGAAATCGG - Intergenic
983762738 4:171432363-171432385 GTTGATGCCTGAGAAGAAAGAGG - Intergenic
984134835 4:175923442-175923464 GATGAAGTGTGAGCAGAAGTCGG + Intronic
984487551 4:180391396-180391418 GTAGATGAATGAGTAGAAGTAGG + Intergenic
986477200 5:8147134-8147156 GTTGATTTATGACCAGAATTTGG + Intergenic
987465866 5:18271276-18271298 GTAGATGTATGAACTAAAATTGG - Intergenic
989023103 5:37033575-37033597 GTTGATTTTTGAGCTGAAGTAGG - Intronic
995015100 5:107301112-107301134 GTTGCTGCAGGAGGAGAAATGGG - Intergenic
997191017 5:131935687-131935709 GGTAATGGATGAGCAGAGATAGG - Intronic
998877897 5:146618934-146618956 GTAGATGTCTGAGCACAAAGTGG - Intronic
999227960 5:150042933-150042955 TTTGATGTAAGAGAAGAAATTGG + Intronic
1000200929 5:159010335-159010357 GGTGTTGCAAGAGCAGAAATTGG - Intronic
1003714501 6:8631569-8631591 TTTGGTGGATGAGCAGAAAAAGG - Intergenic
1004062406 6:12210599-12210621 GATGATGAATGAGCAGAAGGAGG - Intergenic
1004686968 6:17955831-17955853 GTAGATGTGTGAACACAAATTGG - Intronic
1008573170 6:52834215-52834237 GTTGACATATGAGCAGAAGAAGG + Exonic
1009823341 6:68834074-68834096 GTTGATTTATAAACAGAAGTTGG - Intronic
1010048176 6:71471576-71471598 TTTGGTGTATAAGAAGAAATGGG - Intergenic
1011139468 6:84136460-84136482 GTTGATGTTCAAGCAGGAATGGG - Intronic
1012532767 6:100258281-100258303 GATAATGTATGACCAGTAATAGG + Intergenic
1012759773 6:103284435-103284457 GTTGATGTGGGAGTAGAAGTGGG + Intergenic
1012843493 6:104360768-104360790 GATGATGTATGGACAGAAAAAGG + Intergenic
1013272384 6:108557269-108557291 GGTGATGTATGACCACAACTCGG - Intergenic
1014331606 6:120073934-120073956 GCTCATGTATAAGCAGAAATAGG - Intergenic
1014390633 6:120857883-120857905 GTTGATGTATTTGAAGAAATAGG - Intergenic
1014909919 6:127079359-127079381 GTTGATGCATAAGGAGTAATGGG - Intergenic
1015017404 6:128430693-128430715 GTTGAAATATAAGCAGGAATTGG + Intronic
1015495605 6:133879850-133879872 TTAGATGTATAAGCAGAACTTGG + Intergenic
1020417445 7:7962151-7962173 GGAGATGTATCAGCAGGAATGGG + Intronic
1020950096 7:14664654-14664676 AATGATGTCTGAGCATAAATAGG - Intronic
1022566910 7:31412965-31412987 GTAAATGAATGAGCAGAAAATGG + Intergenic
1028866455 7:95719364-95719386 TTTGATGTATAACCAGAATTTGG - Intergenic
1028956001 7:96691135-96691157 GTTTATGTATTAAGAGAAATAGG - Intronic
1030965200 7:115983612-115983634 GTTGAAGTATGAATAGAACTGGG - Intronic
1031440572 7:121789685-121789707 TTTGATATATGAGCAAAAACTGG - Intergenic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1043584855 8:81756832-81756854 ATTGTTTTGTGAGCAGAAATAGG + Intronic
1043733386 8:83713935-83713957 AGTGATGTATTAGCAGTAATAGG - Intergenic
1044473182 8:92595987-92596009 CTTGATGCATGGGCTGAAATTGG - Intergenic
1045062142 8:98419692-98419714 GCTGATGGATGAGCAGAAGCTGG - Intronic
1046593253 8:116230469-116230491 ACTGATGTATTTGCAGAAATTGG + Intergenic
1047644661 8:126857451-126857473 TCTGATGTTTGAGCAGCAATGGG - Intergenic
1048934787 8:139345821-139345843 GTTGGTGGATGGGCAGAAAGAGG + Intergenic
1049022157 8:139964844-139964866 GTGCATGTATGAGCAGCACTGGG - Intronic
1050210699 9:3252463-3252485 GGTGATATCTGAGCAGAAACTGG + Intronic
1052713640 9:32088705-32088727 GGTGACCTCTGAGCAGAAATGGG + Intergenic
1054932645 9:70652169-70652191 GTGGCTATATGAACAGAAATAGG + Intronic
1055015311 9:71610515-71610537 GTTGAGGTTTGAGCAATAATTGG + Intergenic
1055930930 9:81559207-81559229 GTTGATGTCTGGGCAGAGCTGGG - Intergenic
1056138538 9:83652040-83652062 GTTGGTGAATGTGGAGAAATTGG - Intergenic
1056301623 9:85248097-85248119 TCTGATGTGCGAGCAGAAATAGG + Intergenic
1056552692 9:87664483-87664505 GTTGATGGATGAGGAGGAGTGGG - Intronic
1058937796 9:109785177-109785199 GTTTATATATGTGCGGAAATAGG + Intronic
1059983129 9:119795088-119795110 GTAGATGTATAAACAAAAATGGG - Intergenic
1203524496 Un_GL000213v1:73103-73125 GTTGATGGATCAGAAGAAATTGG - Intergenic
1186216032 X:7302250-7302272 GTTGTTGTATGAGCAAAAGGGGG + Intronic
1186731801 X:12418259-12418281 GTGCATGAAAGAGCAGAAATTGG + Intronic
1188287880 X:28350760-28350782 GTAGATGTGAGAGCAGAAGTGGG + Intergenic
1190004809 X:46725581-46725603 GTGGATGTATGAGCAGCAGCAGG - Intronic
1191682957 X:63859978-63860000 GCTGATGTATGAAAAAAAATTGG + Intergenic
1191785129 X:64908741-64908763 GTTGATGAATTGACAGAAATAGG + Intergenic
1196024780 X:111030309-111030331 GTTGATGTATGAGAATTATTGGG + Intronic
1201479799 Y:14427442-14427464 GTTGATGTTGGAGCTCAAATGGG + Intergenic
1201512366 Y:14779365-14779387 GTTAATGTATAAGCAGAGAATGG + Intronic