ID: 915335322

View in Genome Browser
Species Human (GRCh38)
Location 1:155137594-155137616
Sequence GGGGTCCTTCTCCTGGGTTA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915335311_915335322 19 Left 915335311 1:155137552-155137574 CCCCTGCAGCGTGTTGTGCTCCT 0: 1
1: 0
2: 0
3: 6
4: 107
Right 915335322 1:155137594-155137616 GGGGTCCTTCTCCTGGGTTATGG 0: 1
1: 0
2: 1
3: 8
4: 136
915335313_915335322 17 Left 915335313 1:155137554-155137576 CCTGCAGCGTGTTGTGCTCCTAC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 915335322 1:155137594-155137616 GGGGTCCTTCTCCTGGGTTATGG 0: 1
1: 0
2: 1
3: 8
4: 136
915335314_915335322 -1 Left 915335314 1:155137572-155137594 CCTACAGACTGCAACCCTGCTAG 0: 1
1: 0
2: 2
3: 11
4: 87
Right 915335322 1:155137594-155137616 GGGGTCCTTCTCCTGGGTTATGG 0: 1
1: 0
2: 1
3: 8
4: 136
915335312_915335322 18 Left 915335312 1:155137553-155137575 CCCTGCAGCGTGTTGTGCTCCTA 0: 1
1: 0
2: 0
3: 4
4: 96
Right 915335322 1:155137594-155137616 GGGGTCCTTCTCCTGGGTTATGG 0: 1
1: 0
2: 1
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915335322 Original CRISPR GGGGTCCTTCTCCTGGGTTA TGG Exonic
900376672 1:2357929-2357951 CCGGCCCTTCTCCTGAGTTAAGG - Intronic
900829768 1:4957652-4957674 GAGGTCCTTCTTCTGCCTTAGGG + Intergenic
902824587 1:18964367-18964389 GAGGTCCCTACCCTGGGTTACGG - Intergenic
903020195 1:20388147-20388169 TGGCTCCTTCTACTGGGGTAGGG - Intergenic
903546204 1:24124816-24124838 GGGGTCTTTTTCCTGGAGTAGGG - Intronic
915020870 1:152777436-152777458 GGGGCCCTTCTCATGGGTGCCGG + Intronic
915335322 1:155137594-155137616 GGGGTCCTTCTCCTGGGTTATGG + Exonic
920045812 1:203131661-203131683 GGAGCCTTTCTCCTGAGTTAGGG + Intronic
920364410 1:205440463-205440485 GGAGGCCTTCTCCAGGGTCAGGG + Intronic
921185312 1:212665286-212665308 GGGGGCTTTCTCCTGCGTCAGGG - Intergenic
923202324 1:231724480-231724502 TGGTTCCCTCTCCTGGGTGAAGG - Intronic
1068791712 10:61037045-61037067 GTGTTCCTTCTCCTGTGTTCAGG + Intergenic
1070520961 10:77253207-77253229 GAGGCCCTTCTCCTGGGTTCTGG - Intronic
1070680271 10:78444105-78444127 GGGCTTTTTCTCCTGGGTCATGG - Intergenic
1072893009 10:99341597-99341619 AGGGTCCTTCTCCTTCTTTAAGG - Intronic
1074400664 10:113138987-113139009 GTGATCCTTCTCCTGGCTGATGG + Intronic
1076498752 10:130917534-130917556 TGGGTCCTTCTGTTGGATTATGG + Intergenic
1077293982 11:1815464-1815486 GGGGCCCTTCTCCTGGGGAAGGG - Intergenic
1078831323 11:14979941-14979963 GGGATCCATCTACTGGGTTGGGG + Intronic
1079401719 11:20111298-20111320 AGGTTCCTTCTCCTGCCTTAGGG + Intronic
1095301551 12:40590285-40590307 GGGGCCCTTCTACTGGGGAAGGG - Intergenic
1104924418 12:132306436-132306458 GGGGTGGTTCTCCTGGGGTCTGG + Intronic
1110036845 13:70698040-70698062 TTGGTCCTTCTCATGGTTTAGGG - Intergenic
1110425555 13:75362452-75362474 GGGGGCCTTCTTGTGGGTCACGG + Exonic
1111034105 13:82647803-82647825 GGTCTCCATCTCCTGGGCTATGG - Intergenic
1112262805 13:97892984-97893006 GGTTTCCTTCTCCCGGGTTCTGG - Intergenic
1113483415 13:110637979-110638001 GGGCTCCATCTCCTGGGGGAGGG - Intronic
1114639000 14:24206487-24206509 TGGGTCCTTCTTCTGGGGTCAGG + Exonic
1122111044 14:99502872-99502894 GGGGTCCTTCTGCTGGGGCTGGG - Exonic
1122295300 14:100702121-100702143 GGGGTCCTTCTCCTGGGGCAGGG + Intergenic
1125557131 15:40595191-40595213 GGGTTCCTTATCCTGTGATAGGG + Intronic
1126063043 15:44802348-44802370 GGGGTCCTTCTTTTAGGTTTTGG + Intergenic
1130305706 15:82710920-82710942 GGGGTAATTCTACTGGGGTAAGG + Intergenic
1133726187 16:8539552-8539574 GGGGTCATTTTCCTTGGATAAGG - Intergenic
1136577996 16:31135495-31135517 GGGGCCCTTGTCCTGGGCCATGG - Exonic
1139325028 16:66145924-66145946 GGGGTTGTTCTCCTGGATCAGGG + Intergenic
1139341788 16:66272182-66272204 GGTGTCCTTCTCCAGGGTAGTGG - Intergenic
1139637957 16:68270269-68270291 GGTGTCTTTCTCCTGGGAAAAGG - Intronic
1141289504 16:82704627-82704649 GGGGTCCTTTTCCTGGCCTGGGG + Intronic
1141846750 16:86614953-86614975 GGCTTCCTCCTCCTGGGTTCTGG - Intergenic
1146811987 17:35911208-35911230 TGGGGCCTTCTCTTGGGTTGTGG + Intergenic
1151732482 17:75919697-75919719 CTGGTCCTTCTCCTGCGCTATGG + Exonic
1152317648 17:79590174-79590196 GGGGTTCTTATCCTGGGTATAGG - Intergenic
1152707800 17:81854028-81854050 GCTGTCCTTCTCCTGGGGAAGGG - Intronic
1153956072 18:10097372-10097394 TGGGCCATTCTCCTGGGATACGG + Intergenic
1155319936 18:24609247-24609269 GTGGTCCATCTCCTGTGTCAAGG + Intergenic
1160529663 18:79556268-79556290 GGGGGGGTTCTCCTGGGGTAGGG - Intergenic
1161202054 19:3020479-3020501 TGGACCCTTCTCCTAGGTTAAGG + Intronic
1161403123 19:4077726-4077748 GGGGTCCATCTCCAGGGTCCAGG - Intergenic
1161911909 19:7200196-7200218 GGGGTCATTTTTCTGGCTTATGG + Intronic
1162364166 19:10237967-10237989 GCGTCCCTTCTCCTGGATTATGG - Intergenic
1166741490 19:45117404-45117426 GGGGGCCTTGTCCTGGGCTGAGG + Intronic
926784909 2:16509232-16509254 GGGCTCCCTCTCCTGGGCTGGGG + Intergenic
926914056 2:17876836-17876858 GAGGTCTTTCTCCTGGGGTCTGG - Intergenic
927645628 2:24875234-24875256 GGGGTCCTCCTCCTCAGTTGAGG - Intronic
928995154 2:37281562-37281584 GGGGTCCGTTTCCTGGTTGATGG - Intronic
930373899 2:50540004-50540026 GGGGCCCTTCTGCTGGGATTTGG - Intronic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
932727240 2:74189904-74189926 GGGTTCCTTCTCCTGCATTCTGG + Intergenic
935078072 2:99765484-99765506 GAGGTCATTCTGCTGGTTTATGG - Intronic
935590805 2:104844378-104844400 AGGGTCCTTCTCTTGGGAGAGGG - Intergenic
936076015 2:109402340-109402362 GGGCTCCCTCTCCTGGGCTGTGG - Intronic
936230339 2:110694975-110694997 GCGGCCATTCTCCTGGCTTAGGG - Intergenic
944008217 2:194938146-194938168 GGGGTCCCTCTTCTGGAATATGG - Intergenic
947536678 2:230944047-230944069 CTGGTCCTCCTCCTGGGCTAGGG - Intronic
947843702 2:233226780-233226802 GGGGTCAGTCTCCTGGGGTCCGG - Intronic
948587465 2:239028246-239028268 GGGATTCTTCTCCTGGCTTCTGG + Intergenic
1169287178 20:4319268-4319290 GAGCTTCTTGTCCTGGGTTAGGG + Intergenic
1170124337 20:12946771-12946793 GTGGTCCTTCTGCTTGTTTAGGG - Intergenic
1170457705 20:16548765-16548787 TGGGTCTGTCTCCTGGGGTATGG - Intronic
1171206924 20:23288583-23288605 GAGGTCATTCTCCTGGATTCTGG + Intergenic
1171373447 20:24676175-24676197 GGGGCTCTTCTCCTGTGTCAAGG + Intergenic
1172147537 20:32767213-32767235 GGGGTCCTTGTCTTGTTTTATGG + Intronic
1176123188 20:63463392-63463414 GGCTTCCTTCTCCTGGAGTAGGG - Intronic
1176260406 20:64176556-64176578 GGGTTCCTTGTCCTGGGTGTGGG + Intronic
1183377252 22:37472448-37472470 GGGGTCCTCCTCCGGGGAGAAGG + Exonic
1184114771 22:42416039-42416061 GGGTTCCTACTTCTGGGTCATGG - Intronic
949934572 3:9106873-9106895 GGGGTCCTTCTGCTTGGCTTTGG - Intronic
950486278 3:13275782-13275804 GGGCTGCTTGTCCTTGGTTAGGG - Intergenic
950489431 3:13294688-13294710 GGGGCCCCTGTACTGGGTTAGGG - Intergenic
950677309 3:14562185-14562207 GGGGTCCTTTTGCTGGGCAAAGG - Intergenic
952611655 3:35216904-35216926 GGGGTCCATCTCCAGGCTAAGGG + Intergenic
953351588 3:42220367-42220389 GGGGTCGTTCTACTCTGTTAGGG - Intronic
953565359 3:44027654-44027676 AGGGTCCTACTCCAGGGTGATGG - Intergenic
954419053 3:50408974-50408996 GGGGTCCCTTTCCTGGGAGATGG - Intronic
955241605 3:57183037-57183059 CGGGTCCTGCACCTGGGTTTGGG + Intergenic
955971486 3:64442585-64442607 GTGGTCTTTCTGCTGGGGTAGGG + Intronic
958629698 3:96670176-96670198 GTGTTCCTTCTCCTGTGTTCAGG + Intergenic
962969145 3:140382744-140382766 GAGGGCCCTCTCCTGGCTTACGG + Intronic
963953247 3:151225719-151225741 GAGTTCCTTCTTCTGGGTGAAGG - Intronic
966038867 3:175455283-175455305 GAGGTACTTCTCCTGGGGTAAGG + Intronic
969001451 4:3985872-3985894 GGGGCCCTTCTCTAGGGTGAAGG - Intergenic
969313757 4:6369586-6369608 GGGGGCTTTCTCTTGGGGTAGGG - Intronic
969812467 4:9658989-9659011 GGGGCCCTTCTCTAGGGTGAAGG + Intergenic
969876872 4:10141849-10141871 GGTGTCTGTTTCCTGGGTTAGGG + Intergenic
972524317 4:39893213-39893235 GTGGTCCTTCTCTAGGGTCAAGG + Intronic
972963974 4:44486884-44486906 GGGGTCCTTCCCCTTGTTCATGG - Intergenic
973926662 4:55746074-55746096 GGGGTGCTTTTCCTAGCTTAAGG + Intergenic
976664106 4:87571868-87571890 AGGGCCCTTTTCCTGGGTTCTGG + Intergenic
980444318 4:132886223-132886245 GTGTTCCTTCTCCTGTGTTCAGG - Intergenic
981929617 4:150175554-150175576 GGGCTCCTTCATCTGGGTGAAGG - Intronic
984723850 4:183001481-183001503 GTGTTCCTTCTCCTGTGTTCAGG - Intergenic
986840301 5:11688705-11688727 AGGGCCCTTCTCCTGGGTGGTGG - Intronic
993885299 5:93408955-93408977 GGGGACTTTCTCCTAGGATATGG + Intergenic
994042468 5:95274392-95274414 GGGGTGCTTCTTCTGGCTAAAGG + Intronic
1001453144 5:171841516-171841538 GAGGGCCCTCTTCTGGGTTAAGG + Intergenic
1002575384 5:180171118-180171140 GGGGTCCCACTCCTGGGCTGGGG - Intronic
1007169618 6:39853408-39853430 GAGGTCCTTCTCTTGGGGGATGG + Intronic
1007239986 6:40417833-40417855 GGGGTCCTTCTCCCATTTTATGG + Intronic
1007730266 6:43941266-43941288 AGGGCCCTTCTCCTGGGATCTGG + Intergenic
1011076885 6:83447479-83447501 GTGTTCCTTCTCCTGTGTTCAGG - Intergenic
1013212740 6:108001314-108001336 GGGGACCATCACCTGGATTAAGG - Intergenic
1017574085 6:155782238-155782260 AGCCTCCTTCTTCTGGGTTATGG + Intergenic
1029415930 7:100443223-100443245 GGCTCCCTTTTCCTGGGTTATGG - Intergenic
1033652251 7:143352190-143352212 GGGGCCCTTCGCTAGGGTTAGGG - Intergenic
1035416674 7:158695117-158695139 GGGGTCATTCATCTGGGTGATGG + Intronic
1035712154 8:1726341-1726363 GTGGTAGTTCTCCTGGTTTAAGG - Intergenic
1036375782 8:8198219-8198241 GGGGCCCTTCTCTAGGGTGAAGG + Intergenic
1036387770 8:8296671-8296693 GGGGACCTTCTCCATGTTTATGG + Intergenic
1036853748 8:12224924-12224946 GGGGCCCTTCTCTAGGGTGAAGG - Intergenic
1036875123 8:12467434-12467456 GGGGCCCTTCTCTAGGGTGAAGG - Intergenic
1037815106 8:22107972-22107994 GGGGCCTCTCTCCTGGGTCAGGG - Intronic
1040550954 8:48437221-48437243 GGGGGCCTTCTCCTGGGCTTGGG + Intergenic
1043346839 8:79308123-79308145 GTGGTCCCTCTCCTGCATTAGGG + Intergenic
1044434358 8:92144857-92144879 GGTCTCCTACTCCTGGGTTCAGG - Intergenic
1049031296 8:140039985-140040007 GGGGTCTTGCTCCTGGGAGAGGG - Intronic
1049712837 8:144074019-144074041 GGGGCACTTCTGCTGGGATACGG + Intergenic
1049781418 8:144430697-144430719 GGGGTCCTTCCCAGGGGTCAGGG + Intronic
1049879788 8:145053678-145053700 TTGGTCCTGCTCCTGGGTTGGGG + Intronic
1051342956 9:16128460-16128482 GGGGTCCTTCTCCTGCAGTAGGG - Intergenic
1057179123 9:93020381-93020403 GGGGTCCTCATCCTGGCTGAAGG - Exonic
1059173171 9:112145802-112145824 GAGCTTCTTCTCCTGGGTTGTGG + Intronic
1059356152 9:113701095-113701117 GGGGTCATTCTCCTGGCTGGTGG - Intergenic
1060527702 9:124329761-124329783 GGGGTCTTTCCCCTGGGTCTTGG - Intronic
1060904405 9:127291875-127291897 GGGGTCCTTGCCCAGGGTCAGGG - Intronic
1062070427 9:134552476-134552498 GGGGTCCCTGTCCTGGCTTTGGG + Intergenic
1062208925 9:135352801-135352823 GGGGCCCTTCTCCTGGGACAAGG + Intergenic
1062337290 9:136077635-136077657 GGGGACCTTCTCCTCTGTGAAGG - Intronic
1203773201 EBV:59683-59705 GCGGCCATTCTCCTGGGTAACGG - Intergenic
1185622946 X:1464627-1464649 GTGGTCCTTGTCCTGAGTCAGGG + Exonic
1190183999 X:48219228-48219250 GGGCTCCTTGTCTTGGGTAAAGG - Intronic
1193069697 X:77294995-77295017 GGAGTCTTTCTCCTTGGTAAGGG - Intergenic
1193171866 X:78346641-78346663 GTGTTCCTTCTCCTGTGTTCAGG + Intergenic
1193955172 X:87850974-87850996 CTGGTCCTTCTCCTTGGTTATGG + Intergenic
1197588107 X:128374424-128374446 GGGGTCATTCCCTTGGGTGAAGG - Intergenic
1199565262 X:149208986-149209008 GGGGTCTTTCTCCTGGGCTGAGG + Intergenic