ID: 915336696

View in Genome Browser
Species Human (GRCh38)
Location 1:155147569-155147591
Sequence GCCTCTGTACTGAAGATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915336693_915336696 17 Left 915336693 1:155147529-155147551 CCCAGTCAAACAATTTGGAAGAC No data
Right 915336696 1:155147569-155147591 GCCTCTGTACTGAAGATAAAAGG No data
915336694_915336696 16 Left 915336694 1:155147530-155147552 CCAGTCAAACAATTTGGAAGACA No data
Right 915336696 1:155147569-155147591 GCCTCTGTACTGAAGATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915336696 Original CRISPR GCCTCTGTACTGAAGATAAA AGG Intergenic
No off target data available for this crispr