ID: 915339173

View in Genome Browser
Species Human (GRCh38)
Location 1:155166998-155167020
Sequence TTCCCTCTGTCCCCCAGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 808
Summary {0: 1, 1: 0, 2: 5, 3: 62, 4: 740}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915339163_915339173 26 Left 915339163 1:155166949-155166971 CCGGCGGGTGTTAGGGCCACGTG 0: 1
1: 0
2: 0
3: 3
4: 61
Right 915339173 1:155166998-155167020 TTCCCTCTGTCCCCCAGGGGCGG 0: 1
1: 0
2: 5
3: 62
4: 740
915339168_915339173 10 Left 915339168 1:155166965-155166987 CCACGTGTGAGGGAGCAGGAGGA 0: 1
1: 0
2: 1
3: 18
4: 234
Right 915339173 1:155166998-155167020 TTCCCTCTGTCCCCCAGGGGCGG 0: 1
1: 0
2: 5
3: 62
4: 740

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915339173 Original CRISPR TTCCCTCTGTCCCCCAGGGG CGG Intergenic
900040634 1:460282-460304 TTCCCTCTGTCACTCTGTGGAGG - Intergenic
900062064 1:695253-695275 TTCCCTCTGTCACTCTGTGGAGG - Intergenic
900121901 1:1051845-1051867 TTCCATCTGTGCCCTCGGGGCGG + Intronic
900605008 1:3519954-3519976 CTCCCTGTGTCCCCCAGAGTTGG - Intronic
900610249 1:3541676-3541698 TTCCCACTGTCCCCAGGGAGAGG - Intronic
900680932 1:3915781-3915803 TTCTCTCTGCCACCGAGGGGAGG - Intergenic
900769856 1:4532096-4532118 TTACCTCTGTCCTACAGAGGAGG - Intergenic
901484783 1:9551341-9551363 TTCACTCTGTCACCCAGGCTGGG - Intronic
901559549 1:10059198-10059220 CTCGCTCTGTCCCCCAGGGCTGG - Intronic
901563081 1:10088708-10088730 CTCCCTCTGTCACCCAGGCTGGG + Intronic
901588211 1:10316200-10316222 CTCCCTCTGTCACCCAGGCTGGG - Intronic
901972986 1:12922503-12922525 CTCACTCTGTCCCCCAGGCTGGG - Intronic
902012194 1:13279260-13279282 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
902222987 1:14978620-14978642 TGCCCTCTGCAGCCCAGGGGTGG - Intronic
902377517 1:16036788-16036810 TGCCCTCCATGCCCCAGGGGTGG - Intergenic
902382691 1:16060046-16060068 TGCCCTCCATGCCCCAGGGGTGG - Exonic
902844879 1:19102332-19102354 TTCACTCTGTCACCCAGGCTGGG - Intronic
903548250 1:24140688-24140710 TTCCCTCAGGCCCCCAGGCTTGG + Intronic
903915445 1:26760879-26760901 CTCCTTCTGTCCCCATGGGGAGG - Exonic
904558064 1:31378370-31378392 TACCCCCTGTCCCCCAGGGCAGG - Intergenic
904736070 1:32634787-32634809 TTCCCTCTGTCCCTCAGATTTGG - Exonic
904760316 1:32798790-32798812 TTCACTCTGTCTCCCAGGCTCGG - Intronic
905054974 1:35085523-35085545 TTCCCTCTGGCCCAAAGAGGAGG + Intronic
905140069 1:35836437-35836459 ATCACTCTGTCCCCCAAGGTTGG + Intronic
905906426 1:41621416-41621438 CCCCCTCTGTCTCCCAAGGGAGG + Intronic
906241513 1:44245081-44245103 TGACCTCTGACCCCCAGGGCTGG + Intronic
906715999 1:47969773-47969795 CTCCCTCTGAACCCCAGGGCTGG - Intronic
906800176 1:48730216-48730238 TTCCCTCTCTACCCCAGGCCAGG + Intronic
907034791 1:51206629-51206651 CTCTCTCTGTCACCCAGGGCTGG - Intergenic
907396090 1:54190965-54190987 TTCCCACTGTCCCCAAGGAGAGG + Intronic
907743420 1:57189347-57189369 ATCCTTCTTTCCCCCAGGGAAGG + Intronic
908200748 1:61793101-61793123 CTCGCTCTGTCACCCAGAGGTGG + Intronic
908580489 1:65510980-65511002 CTCACTCTGTCACCCAGGGTGGG - Intronic
908891906 1:68858451-68858473 TTCCTTATGTTTCCCAGGGGAGG + Intergenic
909233637 1:73123567-73123589 TTCACTCTGTCACCCAGGCTGGG + Intergenic
909658964 1:78061529-78061551 TTCCTTCTGTCGCCCAGGCTGGG + Intronic
910683926 1:89896600-89896622 CTACCTTTGTCCTCCAGGGGTGG - Intronic
910787231 1:91013102-91013124 CTCACTCTGTCGCCCAGGTGGGG + Intronic
911008124 1:93248940-93248962 TTCACTCTGTCGCCCAGGCTGGG - Intronic
912500111 1:110116118-110116140 CTCCCTCTGTCACCCAGGCTGGG + Intergenic
914005271 1:143727731-143727753 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
914097750 1:144558982-144559004 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
914197481 1:145455229-145455251 CTCCCTCTGTCACCCAGGTTGGG - Intergenic
914301240 1:146378626-146378648 CTCCCTCTGTCGCCCAGGCTGGG - Intergenic
914424927 1:147566724-147566746 CTCGCTCTGTCACCCAGGGCTGG - Intronic
914476581 1:148028252-148028274 CTCCCTCTGTCACCCAGGTTGGG - Intergenic
914503634 1:148269536-148269558 CTCCCTCTGTCACCCAGGTTGGG + Intergenic
914509928 1:148322589-148322611 CTCCCTCTGTCACCCAGGTTGGG - Intergenic
914809873 1:151019524-151019546 CTCCCTCTGTCTCCCAGGCTTGG - Intronic
915323364 1:155068293-155068315 CTCGCTCTGTCGCCCAGGGCTGG + Intronic
915339173 1:155166998-155167020 TTCCCTCTGTCCCCCAGGGGCGG + Intergenic
915554650 1:156654663-156654685 GAGCCTCTGTCCCCCAGGGTTGG + Intronic
915636309 1:157189490-157189512 CTCCCCCTGTCACCCAGGGTGGG + Intergenic
916058354 1:161083112-161083134 TTCAGTGTGTCCCCTAGGGGTGG - Intronic
916100890 1:161392365-161392387 TTCACTCTGTCACCCATGGATGG + Intergenic
917153817 1:171973700-171973722 CTCCCTCTGTCACCCAGGCTGGG + Intronic
917214034 1:172659406-172659428 TTCCCTCTCTTCTTCAGGGGTGG - Exonic
917337642 1:173941899-173941921 CTCACTCTGTCACCCAGGTGGGG - Intronic
917348556 1:174054540-174054562 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
917412510 1:174774501-174774523 CTCACTCTGTCACCCAGGGCTGG - Intronic
917876153 1:179288972-179288994 CTCACTCTGTCACCCAGGCGAGG - Intergenic
919856488 1:201709663-201709685 CTCCCTCTGTGCCCCAGCAGTGG - Intronic
919948877 1:202343945-202343967 TTCCATTTGTCCACCAGAGGGGG + Intergenic
920011078 1:202868223-202868245 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
920066367 1:203272687-203272709 TGGCCTGTCTCCCCCAGGGGTGG + Intronic
921300316 1:213745603-213745625 CCACCTCTGTCCCCCAGGGAAGG + Intergenic
921964078 1:221069229-221069251 TCCCCTCTGTGTCCCAGGAGAGG - Intergenic
922235605 1:223720343-223720365 CTCACTCTGTTCCCCAGGGCTGG + Intronic
922551667 1:226498703-226498725 ATCCCTCTGTCCCCAAGAAGAGG + Intergenic
922564542 1:226593153-226593175 CTCACTCTGTCCCCCAGGCTGGG - Intronic
922590980 1:226776534-226776556 CTTCCTCTGTCCCCCAGGCTGGG + Intergenic
922653572 1:227361541-227361563 CTCCCTCTGCCTCCCAGTGGAGG + Intergenic
922820502 1:228481908-228481930 CTCACTCTGTCCCCCAGGCTGGG - Intergenic
922843377 1:228663661-228663683 TTCACTCTGTCCCCCAGGCTGGG + Intergenic
923642649 1:235780371-235780393 TTCACTCTGTCACCCAGGCTTGG - Intronic
923978198 1:239288740-239288762 TTCCCTCTCTTGCCCTGGGGAGG - Intergenic
924161590 1:241238562-241238584 TTCACTCTGTCACCCAGGGCTGG + Intronic
924230161 1:241956181-241956203 TTCTCTCTGTCACCCAGGCTGGG - Intergenic
924623756 1:245684170-245684192 TTCCCTGTGGCCCTCAGGGCAGG - Intronic
1062979797 10:1712635-1712657 CTCCCTCTGTCCCCCAGGGAAGG + Intronic
1063255305 10:4320944-4320966 TTCTCTCTGTCCTCACGGGGTGG + Intergenic
1063449936 10:6144704-6144726 TCCCCCCGGTCCCGCAGGGGCGG - Intergenic
1063505058 10:6590302-6590324 CTCACTCTGTCCCTCAGAGGTGG + Intergenic
1064356961 10:14627740-14627762 TTCACTCTGTCCCCCAGGCGAGG - Intronic
1065164237 10:22958029-22958051 TTCGCTCTGTCACCCAGGCTGGG - Intronic
1065182925 10:23145027-23145049 TTTGCTCTGTCACCCAGGGCTGG + Intergenic
1066563567 10:36695918-36695940 TTCACTCTGTCTCCCAGGCTGGG - Intergenic
1066584604 10:36918808-36918830 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
1067200421 10:44166450-44166472 TTTCCACTGTCCCCCAGCTGCGG + Intergenic
1067297355 10:44982451-44982473 TTCCCTGTGCCCCCTAGGGATGG - Intronic
1069551211 10:69365801-69365823 CTCACTCTGTCCCCCAGGTTGGG - Intronic
1069607763 10:69750410-69750432 GTCCCCCTGTCCCACAGGAGAGG - Intergenic
1070194222 10:74141393-74141415 CTCCCTCTGTCACCCAGGCTAGG - Intronic
1070573680 10:77660904-77660926 TTCCCCCTGACCTCCAGGGAGGG + Intergenic
1070931472 10:80264059-80264081 TGCCCTCTGACCTCCAGGCGTGG - Intergenic
1071123245 10:82304854-82304876 TTCCCTCTATACTCAAGGGGAGG + Intronic
1071704245 10:87980276-87980298 TTCACTCTGTCGCCCAGGCTGGG + Intergenic
1072173485 10:92891510-92891532 TTCACTCTGTCACCCAGGCTGGG + Intronic
1072708744 10:97701720-97701742 TTCACTCTGTCACCCAGGCTAGG + Intergenic
1073044962 10:100631636-100631658 CTCACTCTGTCTCCCAGGGCAGG + Intergenic
1073219202 10:101855574-101855596 CTCACTCTGTCACCCAGGGTGGG + Intronic
1074188797 10:111118026-111118048 TGCCAACTGTCCCCCAGGAGTGG + Intergenic
1074509959 10:114102731-114102753 CTTGCTCTGTCCCCCAGGGCTGG + Intergenic
1074720140 10:116257079-116257101 TCCCCACTGTCCACCAGGGGAGG + Intronic
1075424466 10:122330756-122330778 TTCACTCTGTCCCCCAAGGCTGG + Intronic
1076024012 10:127097632-127097654 TTTCGTCTGTCCACCAGTGGGGG - Intronic
1076966907 11:96505-96527 TTCCCTCTGTCACTCTGTGGAGG - Intergenic
1077197563 11:1288975-1288997 TTCCCTCTCTCCACCAGGATGGG + Intronic
1077599548 11:3564594-3564616 CTCCATCTCTCCCCTAGGGGAGG - Intergenic
1077775779 11:5270036-5270058 TGACCTGTGTCCCTCAGGGGTGG + Exonic
1078222861 11:9365707-9365729 TTCCCTCTTTCGCCCAGGCTGGG - Intergenic
1078314292 11:10279678-10279700 CTCCCTCTGTCACCCAGGCTGGG + Intronic
1078916510 11:15783678-15783700 TTCCCTCAGGCCCTCAGGTGCGG - Intergenic
1079566517 11:21889692-21889714 TTCCCTCTGTTCCAAAGGGTAGG - Intergenic
1080646179 11:34189568-34189590 CTCACTCTGTCACCCAGGGTGGG - Intronic
1080785765 11:35473687-35473709 GTCTCTCTGTCCTCCAGGAGGGG - Intronic
1080790796 11:35520840-35520862 TTCCATCTGCCCCACTGGGGTGG - Intronic
1080813382 11:35728294-35728316 TTCACTCTGTCTCCCAGGCTGGG - Intronic
1081250402 11:40824826-40824848 TTCTCTCTGTCGCCAAGAGGAGG - Intronic
1081391339 11:42532920-42532942 CTCTCTCTGTCGCCCAGGGTGGG + Intergenic
1081710271 11:45211567-45211589 GTCCCCCTGTCCCCCAAGGCAGG - Intronic
1081785867 11:45746742-45746764 TTCACTCTGTCACCCAGGCTGGG - Intergenic
1081812625 11:45922356-45922378 TCCCCTCACTCCCCAAGGGGAGG - Intronic
1081976456 11:47238426-47238448 CTCGCTCTGTCCCCCCGGGCTGG + Intronic
1082002951 11:47403756-47403778 TTCCTGCTGACCCCCACGGGAGG + Intergenic
1082050689 11:47768001-47768023 CTCACTCTGTCACCCAGGGTGGG - Intergenic
1082160716 11:48885302-48885324 GTCCCTCTGTCTCCCATGGTGGG + Intergenic
1082161650 11:48895104-48895126 GTCCCTCTGTCTCCCATGGTGGG - Intergenic
1082167233 11:48963533-48963555 GTCCCTCTGTCTCCCATGGTGGG - Intergenic
1083440177 11:62671067-62671089 CTCGCTCTGTCGCCCAGGGCTGG - Intronic
1083555464 11:63622640-63622662 TTTCCTCCATGCCCCAGGGGAGG - Intergenic
1084255452 11:67939202-67939224 CTCCATCTCTCCCCTAGGGGAGG - Intergenic
1084268644 11:68017580-68017602 TGCCCTCTGCGCCCCAAGGGAGG - Intronic
1084384493 11:68834403-68834425 CTCCCTCTGTCACCCAGGCTGGG - Intronic
1084488471 11:69464575-69464597 TTCTCTCTGTACCCCCCGGGTGG - Intergenic
1084591807 11:70094673-70094695 TCCCCGTTCTCCCCCAGGGGAGG + Intronic
1085049196 11:73371270-73371292 CTCCCTCTGTCACCCAGGATGGG - Intergenic
1087282367 11:96225800-96225822 CTCGCTCTGTCACCCAGGGTGGG - Intronic
1087915310 11:103803185-103803207 TTCCCACGGTCACCCTGGGGTGG + Intergenic
1088230492 11:107669248-107669270 ATCCCTGTCTCCCCCAGGAGAGG + Intergenic
1088597992 11:111454217-111454239 TTCCCTCCGACCCCCACAGGTGG + Exonic
1089116883 11:116102617-116102639 CTGCCTCTGTCCCCCAGGGGAGG - Intergenic
1089242239 11:117091811-117091833 TTCACTCTGTCACCCAGGCTGGG + Intronic
1089388777 11:118085872-118085894 TTCCCTCTGTTCCAGAGTGGTGG - Intronic
1089464910 11:118678838-118678860 TTCTCTCTGTGACCCAGGGCAGG - Intronic
1089466964 11:118691740-118691762 TTCTCTCTGTGACCCAGGGCAGG - Intergenic
1089698248 11:120228851-120228873 TTGCCTCTCTCCCCCAGGTGTGG + Exonic
1089741347 11:120586701-120586723 TTCCCTCTGTCCCACAGCAAGGG + Intronic
1090337958 11:125986733-125986755 CTCACTCTGTCGCCCAGGGCTGG - Intronic
1090658910 11:128867045-128867067 TTCTATCTATCCCCCAGGAGTGG + Intronic
1090760523 11:129833207-129833229 CTCCCTCTGTCGCCCAGGCTGGG - Intronic
1091503201 12:1039305-1039327 CTCGCTCTGTCACCCAGGGCTGG - Intronic
1091754664 12:3043646-3043668 TTCCCCCAGACCCCCAGGGCTGG - Intergenic
1092164414 12:6334168-6334190 TTCTCCCTGTCCCCTAGGTGAGG + Exonic
1093462769 12:19421312-19421334 CTCGCTCTGTCACCCAGGCGGGG - Intronic
1094624349 12:32107998-32108020 TTCCCTCTCTCACCAAGGAGTGG - Intronic
1095084110 12:38041818-38041840 TTCACTCTGTCACCCAGGCTGGG - Intergenic
1095239956 12:39846481-39846503 CTCACTCTGTCACCCAGGGTGGG + Intronic
1095449084 12:42310700-42310722 CTCACTCTGTCACCCAGGGCTGG + Intronic
1095924426 12:47564179-47564201 TTCACTCTGTCCCCCAGACTGGG + Intergenic
1096043404 12:48540534-48540556 TCCCCTCTGGCCCTCAGGTGTGG - Intergenic
1096142983 12:49257746-49257768 CTCCCTCTGTCACCCAGGCTGGG - Intronic
1096183860 12:49565900-49565922 TGCCCTCAGTCCCACAGGGAAGG + Intronic
1096715557 12:53489047-53489069 TTCACTCTGTCGCCCAAGGCTGG - Intronic
1096888991 12:54747213-54747235 CTCACTCTGTCCCCCAGGCTGGG - Intergenic
1097186675 12:57199924-57199946 TGCCTGCTGTCCCCCGGGGGAGG + Exonic
1097393860 12:59049558-59049580 TTCACTCTGTCACCCAGGCTGGG - Intergenic
1098223644 12:68298035-68298057 TTCCCTGTGTTGCCCAGGGGAGG - Intronic
1098271220 12:68772066-68772088 TTTCCTCTGTCTCCCAGGCTTGG + Exonic
1099373810 12:81871322-81871344 CTCACTCTGTCACCCAGGGATGG - Intergenic
1099662320 12:85579597-85579619 TTCGCTCTGTCGCCCAGGCTAGG + Intergenic
1100270088 12:93016419-93016441 TTCCCTCTTTCCCGGAGGTGAGG + Intergenic
1101147167 12:101852202-101852224 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1101160506 12:101969339-101969361 TTCACTCTGTCACCCAGGCTGGG - Intronic
1101919471 12:108920622-108920644 TTCACTCTGTCACCCAGGGTGGG + Intronic
1102028752 12:109728037-109728059 TTCCCCCAGTGCCCCTGGGGCGG - Intronic
1102775565 12:115515729-115515751 TTCCTTCTGTCCCCCAGTCTTGG - Intergenic
1103349509 12:120274074-120274096 CTCCCTCTGTCACCCAGAGCTGG + Intergenic
1104356441 12:128090787-128090809 CTCCCTCTGTCGCCCAGGATGGG + Intergenic
1104548781 12:129736845-129736867 TTTCCTCTGTCACCCAGAGCTGG + Intronic
1104677172 12:130719164-130719186 CTCACTCTGTCCCCCAGGCTGGG - Intergenic
1104835793 12:131789503-131789525 TTCACTCTGTTACCCAGGTGGGG - Intronic
1104874632 12:132025391-132025413 TACCCTCTGTCCCTCATGGAAGG - Intronic
1105517763 13:21105384-21105406 CTCGCTCTGTCCCCCAGGCTAGG - Intergenic
1105685961 13:22782449-22782471 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
1105702674 13:22944652-22944674 TTGCCTCTCTCCCCGCGGGGAGG + Intergenic
1105855307 13:24366446-24366468 TTGCCTCTCTCCCCGCGGGGAGG + Intergenic
1105891519 13:24685670-24685692 TTCACTCTATCCCCCTGGGATGG + Intronic
1106160722 13:27199110-27199132 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
1106468436 13:30033544-30033566 TCCCCTCTGTCCCTTAGGGCTGG + Intergenic
1106687869 13:32080713-32080735 TTCCCTCCCTCCACCAGGGGAGG - Intronic
1106790097 13:33146291-33146313 TTCACTCTGTCACCCAGGCTGGG - Intronic
1106934729 13:34705479-34705501 CTCACTCTGTCACCCAGGGCTGG + Intergenic
1107248530 13:38327143-38327165 CTCTCTCTGTCCCCCAGGGATGG - Intergenic
1107254087 13:38402174-38402196 CTCGCTCTGTCTCCCAGGGCTGG - Intergenic
1107424243 13:40276779-40276801 TCCTCTCTGTCCCACAGGAGAGG - Intergenic
1108106888 13:47020428-47020450 TTCCATCTGTACTCAAGGGGAGG - Intergenic
1110275238 13:73635093-73635115 CTCCCTCTGTCTCCAAGGGATGG + Intergenic
1110371308 13:74743564-74743586 TTCCCCCTGGTCCCCAGGGAAGG + Intergenic
1110812527 13:79826676-79826698 TTCCCTCTGTCCCAAAAGAGGGG + Intergenic
1111671114 13:91331739-91331761 TTTCCTCTGTTCTACAGGGGAGG + Intergenic
1111821716 13:93223928-93223950 CTCCCTCTGTCACCCAGGCTGGG + Intergenic
1112154542 13:96803144-96803166 TTACCTCATTCCCCCAGTGGAGG + Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113768847 13:112895975-112895997 TTCTGTCAGGCCCCCAGGGGAGG - Intronic
1114030906 14:18580048-18580070 CTCACTCTGTCCCCCAGGTTGGG - Intergenic
1114304712 14:21412031-21412053 TTCACTCTGTCACCCAGGTTGGG - Intronic
1114452937 14:22838330-22838352 TTTGCTGGGTCCCCCAGGGGAGG + Intronic
1115519783 14:34221763-34221785 CTCACTCTGTCCCCCAGGCTGGG + Intronic
1115606544 14:35008915-35008937 CTCCCTCTGTCACCCAGGCTGGG + Intronic
1115957145 14:38794106-38794128 TTCCCTCTGTCCCCAACATGGGG + Intergenic
1116334500 14:43639827-43639849 TGCCCTATGTTGCCCAGGGGAGG - Intergenic
1116972581 14:51081967-51081989 TGACCTCTGACCCCCAGGGCAGG - Intronic
1117164009 14:53016164-53016186 CTCGCTCTGTCGCCCAGGCGCGG + Intergenic
1117235496 14:53770181-53770203 TTCCCTCTATCCCACAGGACAGG - Intergenic
1117319854 14:54611283-54611305 TTCCCTCTTTCCCCCACCAGTGG + Intronic
1117574500 14:57084460-57084482 TTTGCTCTGTCCCCCAGGCTTGG - Intergenic
1117877039 14:60263184-60263206 CTCCCTCTGTCACCCAGGCTAGG - Intronic
1118180279 14:63485857-63485879 CTCCCTCTGTCACCCAGGGCTGG + Intronic
1118356324 14:65016951-65016973 TTCACTCTGTCACCCAGGCTGGG + Intronic
1118691788 14:68346947-68346969 TTCCCTCTACCCCCCAAGGCTGG + Intronic
1118812532 14:69285763-69285785 CTCCATCTGTCCCTCAGGGACGG + Intronic
1119867561 14:77986445-77986467 CTCACTCTGTCCCCCAGGCTGGG - Intergenic
1120194641 14:81468486-81468508 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1120208916 14:81615312-81615334 CTCACTCTGTCACCCAGGGCTGG + Intergenic
1120786400 14:88541622-88541644 TCCCCTCTGTCCCCCCTGAGAGG + Intronic
1121139001 14:91524471-91524493 CTCACTCTGTCACCCAGGGTTGG + Intergenic
1122459650 14:101884555-101884577 CTCCCACTGTGCACCAGGGGAGG + Intronic
1122554009 14:102566931-102566953 TTCCCTCTGTCACCCAGGCTAGG + Intergenic
1122678899 14:103441313-103441335 TTCGCTCTGTCACCCAGGCTGGG + Intronic
1122844183 14:104481716-104481738 TTGCCTCTCTCCCCATGGGGAGG + Intronic
1122860510 14:104580352-104580374 TTCCCTGCTTCCCCCAGAGGCGG - Intronic
1122913310 14:104844197-104844219 TACCCCTAGTCCCCCAGGGGTGG + Intergenic
1123034490 14:105466375-105466397 TTGCCTCTGCCCAGCAGGGGAGG - Intronic
1123113620 14:105884071-105884093 TGCCCTGTGTCCCCCTGGAGAGG + Intergenic
1124018695 15:25900927-25900949 TTCCCTCTGTTCTCTAGGAGTGG + Intergenic
1124056419 15:26244396-26244418 TTCCCTCTGTCCTCAGGGTGGGG + Intergenic
1124227077 15:27903619-27903641 TGCCCTCCATCCCCCAGGAGCGG + Intronic
1124412925 15:29451623-29451645 TCCCCTCTGCCCACCACGGGAGG + Intronic
1124700419 15:31907606-31907628 CTCCCTCTCTCCAGCAGGGGCGG + Intergenic
1124773402 15:32562799-32562821 TTCGCTCTGTCGCCCAGGCTGGG + Intergenic
1124965153 15:34428124-34428146 CTCACTCTGTCACCCAGGGGAGG + Intronic
1124981765 15:34574334-34574356 CTCGCTCTGTCACCCAGGGGAGG + Intronic
1125257301 15:37779796-37779818 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1125667897 15:41446831-41446853 CTCCCTCTGTCACCCAGGCTGGG + Intronic
1125880106 15:43185942-43185964 CTCCCGCTGTCCCCCACGGAGGG + Intronic
1126077121 15:44922256-44922278 CTCACTCTGACCCCCAGGGCTGG - Intergenic
1126081598 15:44968622-44968644 CTCACTCTGACCCCCAGGGGTGG + Intronic
1126464462 15:48948873-48948895 CTCGCTCTGTCACCCAGGGTGGG - Intronic
1126826734 15:52558820-52558842 TTCCCTTTGTACCCACGGGGGGG + Intronic
1126827095 15:52562598-52562620 CTCACTCTGTCTCCCAGGGTAGG - Intronic
1127470220 15:59283331-59283353 TTCCCACTGTCCCCCAGCTTAGG + Intronic
1128175119 15:65548480-65548502 CTCCCTCTGTCACCCAGGGCTGG - Intronic
1128183482 15:65624959-65624981 TTCCCACTAACCCCCAGGGATGG - Exonic
1128259937 15:66226275-66226297 CTCACTCTGTCACCCAGGGGTGG + Intronic
1128458948 15:67851638-67851660 TTCCCTCTGTCGCCCAAGCTGGG + Intergenic
1128514297 15:68332538-68332560 TTCCCTCTGCCCGCGAGGCGAGG - Intronic
1128665692 15:69536790-69536812 TTCCCTCTCTTCCCCAGGCTGGG - Intergenic
1128794809 15:70458548-70458570 CTCCCTCTGTCACCCAGGCAGGG - Intergenic
1129108075 15:73322725-73322747 TTCCCGCTCTTCCCCAGGGCTGG - Exonic
1129376285 15:75134733-75134755 TTCACTCTGTCACCCAGGCTAGG + Intergenic
1129769169 15:78192753-78192775 TTCCATCTGTGCCCGAGGGTGGG - Intronic
1129833828 15:78689300-78689322 TTCACTCTGTCGCCCAGGCTGGG + Intronic
1130116183 15:81006542-81006564 CTCACTCTGTCGCCCAGGGTGGG + Intergenic
1130182099 15:81640335-81640357 CTCACTCTGTCCCCCAGGCTGGG - Intergenic
1130394796 15:83492716-83492738 TTCCCTCTATCCCCCAGGGTTGG + Intronic
1131164014 15:90129265-90129287 TTCACTCTGTCGCCCAGGCTGGG + Intergenic
1131223179 15:90602005-90602027 TTCCCTCTGTGCCACATGTGAGG - Intronic
1131350753 15:91697682-91697704 CTCGCTCTGTCCCCCAGGCTGGG - Intergenic
1131475796 15:92738217-92738239 TTCCCTCTGTCGCCCAGGCTGGG + Intronic
1131550171 15:93350502-93350524 TTCCCTCTGCCCTGCAGAGGAGG + Intergenic
1131594262 15:93781115-93781137 CTCCCTCTGTCGCCCAAGGCTGG + Intergenic
1131646341 15:94349270-94349292 GTCCCTCTGTCCCTCTGGTGTGG - Intronic
1132150855 15:99457321-99457343 CTCCCTGTCTCCCACAGGGGTGG + Intergenic
1132441269 15:101867330-101867352 TTCCCTCTGTCACTCTGTGGAGG + Intergenic
1132474217 16:125044-125066 TTCACTCTGTCGCCCAAGGCTGG - Intronic
1133247789 16:4460843-4460865 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
1133999526 16:10771847-10771869 TTCGCTCTGTCGCCCAGGCTGGG + Intronic
1134081161 16:11326007-11326029 TTCCCTCAGACTCCCATGGGTGG - Intronic
1134930415 16:18202777-18202799 AGCCCTCTGAGCCCCAGGGGTGG - Intergenic
1135017658 16:18937269-18937291 CTCCCTCTGTCACCCAGGCTAGG + Intergenic
1136080142 16:27846924-27846946 CTCCCTCTGTCACCCAGGCTGGG - Intronic
1136116421 16:28097603-28097625 CTCCCCCTGCCCCCCAGGGTGGG - Intergenic
1136424571 16:30161029-30161051 TTCACTCTGTCGCCCAGAGCTGG + Intergenic
1136777520 16:32879715-32879737 TGGGCTCTGTCCCCCAGGGTGGG - Intergenic
1136849390 16:33601612-33601634 TTCGCTCTGTCGCCCAGGCTTGG - Intergenic
1136893103 16:33981799-33981821 TGGGCTCTGTCCCCCAGGGTGGG + Intergenic
1137042714 16:35628084-35628106 CTCCCTCTGTCCCCTAGGCTGGG + Intergenic
1137479583 16:48840757-48840779 TACCCTCTCTCCCCCAGTGAAGG + Intergenic
1137642936 16:50048860-50048882 CTCCCTCTGTCACCCAGGCTAGG - Intergenic
1137729240 16:50677621-50677643 TTCCCTCTGCCTGCCAGGAGGGG - Intronic
1138126265 16:54441284-54441306 CTCGCTCTGTCCCCCAGGCTGGG + Intergenic
1138436918 16:57006447-57006469 TTCACTCTGTCGCCCAGGCTGGG + Intronic
1138517002 16:57541668-57541690 CTCCATCTTTCCCCCAGGGCTGG + Intergenic
1138873590 16:60922961-60922983 TCCGCTTTGTCTCCCAGGGGAGG + Intergenic
1139085065 16:63574526-63574548 CTCACTCTGTCACCCAGGGTTGG - Intergenic
1139103401 16:63797618-63797640 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
1139579295 16:67862802-67862824 CTCGCTCTGTCCCCCAGGTCAGG - Intronic
1139636525 16:68261502-68261524 TGCCATCTGTACCCCTGGGGAGG + Intergenic
1139830100 16:69790604-69790626 CTCACTCTGTCACCCAGGCGGGG + Intronic
1140819053 16:78646456-78646478 TTCACTCTGTCACCCAGGCTGGG + Intronic
1140996234 16:80262336-80262358 TTCACTCTGTCGCCCAGGCTGGG + Intergenic
1141077611 16:81021783-81021805 CTCACTCTGTCACCCAGGGTGGG + Intronic
1141127525 16:81411393-81411415 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
1141655993 16:85416884-85416906 CTCACTCTGTCCCCCAGGCCGGG + Intergenic
1141883660 16:86876745-86876767 GTGCCTCTGTCACCCAGGGCAGG + Intergenic
1141892492 16:86935702-86935724 TTCTCCCTTTCCCCCAGGGCTGG + Intergenic
1142127055 16:88415399-88415421 TTCCCTCCTTCAGCCAGGGGTGG - Intergenic
1203079934 16_KI270728v1_random:1141824-1141846 TGGGCTCTGTCCCCCAGGGTGGG - Intergenic
1203111098 16_KI270728v1_random:1450262-1450284 TTCGCTCTGTCGCCCAGGCTTGG - Intergenic
1142536979 17:625019-625041 CTCACTCTGTCACCCAGGGCTGG + Intronic
1142581517 17:946014-946036 CTCCCTCTCTACCCCAGGGAGGG - Intronic
1142609805 17:1102738-1102760 CTCCCTCTGTCGCCCAGGGCTGG + Intronic
1143025559 17:3939755-3939777 CTCGCTCTGTCACCCAGGGCTGG - Intronic
1143066260 17:4250696-4250718 CTCCCTCTGTCACCCAGGCTGGG + Intronic
1143130703 17:4675190-4675212 TTCCTTCTCTGCCCCAGGTGTGG - Exonic
1143147655 17:4787067-4787089 CTCACTCTGTCGCCCAGTGGCGG + Intergenic
1143162529 17:4880967-4880989 ATCCCTCTGTCCCGCAGGGTCGG + Exonic
1143416631 17:6755657-6755679 TTCCCTCTTTCCTGCAGGGGAGG + Intronic
1143513527 17:7408197-7408219 TTCTCTCTCTCTCCGAGGGGGGG + Exonic
1143537733 17:7551105-7551127 TTCTCTCTGTGACCCAGGCGTGG + Intronic
1143744648 17:8983223-8983245 CTCGCTCTGTCCCCCAGGTTGGG + Intergenic
1144466541 17:15502081-15502103 TGCCCTCTGGCTCCAAGGGGAGG + Intronic
1145061907 17:19738948-19738970 CTCCCTCTGGGCCCCAGGGCTGG - Intronic
1146025488 17:29317046-29317068 TTCACTCTGTCACCCAGGCTGGG + Intergenic
1146192187 17:30779258-30779280 CTCGCTCTGTCACCCAGAGGTGG + Intronic
1146308242 17:31747071-31747093 GTCACTCTGTCACCCAGGGTGGG + Intergenic
1146337353 17:31985996-31986018 CTCGCTCTGTCACCCAGAGGTGG + Intronic
1146495077 17:33314454-33314476 TTCTCCCTGTCCACCAGGGATGG - Intronic
1146831063 17:36070001-36070023 CTCCCTCTGTCTCCCAGAGGTGG - Intronic
1147715132 17:42501443-42501465 CTCGCTCTGTCCCCCAGGCTGGG + Intronic
1148204159 17:45769161-45769183 TTCCCCCTGTCTCCCAGGAAAGG - Intergenic
1148490217 17:48018645-48018667 CTCGCTCTGTCACCCAGGGCTGG + Intergenic
1148687589 17:49509357-49509379 TTCCCTCCCTGCCCCAGGCGTGG + Intronic
1148946810 17:51269883-51269905 CTCACTCTGTCACCCAGGGCTGG + Intronic
1149030722 17:52079426-52079448 CTCGCTCTGTCCCCCAGGCTGGG - Intronic
1150048884 17:61939441-61939463 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
1150060644 17:62065516-62065538 TCCCCTCCGTCCCCCAGAGAGGG - Intergenic
1150924742 17:69521170-69521192 TACCCCCAGTCCCCCATGGGTGG + Intronic
1151178823 17:72311112-72311134 TTCCCTCTGACAGCAAGGGGAGG + Intergenic
1151404534 17:73878021-73878043 CTGCCCCTGTGCCCCAGGGGAGG + Intergenic
1151654525 17:75489693-75489715 TTCCCTCCGACCCGCAGGGCTGG + Intronic
1152130948 17:78476135-78476157 CTCCCTCTGTCCACTTGGGGTGG - Intronic
1152646729 17:81472555-81472577 TTCGCTCTGTCGCCCAGGATGGG + Intergenic
1153629449 18:7055421-7055443 TTCACTCTGTCACCCAGGCTGGG - Intronic
1153925064 18:9828180-9828202 TTCCCACTATTCCCCAGGGCAGG - Intronic
1154439435 18:14374669-14374691 CTCGCTCTGTCGCCCAGGGCTGG + Intergenic
1155671847 18:28380647-28380669 TTCCCTCTCTTCCCCAGGGTTGG - Intergenic
1156300506 18:35832405-35832427 TTCCCACTCTCCTCCAGGGAAGG + Intergenic
1156447380 18:37247878-37247900 TTCTTTCTCTCCCCCAGGGGTGG + Intronic
1156870764 18:41942370-41942392 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
1157007841 18:43607125-43607147 TTCTCTCTGTGCCACAGGCGGGG + Intergenic
1157554496 18:48604204-48604226 CTCGCTCTGTTCCCCAGGGCTGG + Intronic
1157587278 18:48811991-48812013 CTCACTCTGTCCCCCAGGCTGGG + Intronic
1158524354 18:58198832-58198854 TTCACTCTGTCACCCAGGTCTGG + Intronic
1159293025 18:66446336-66446358 CTCCCTCTGTCTCCCAGGCTGGG + Intergenic
1160200889 18:76794307-76794329 TTCTTCCTGTCCCCCAGGGCAGG + Intergenic
1160242094 18:77131956-77131978 CTCCCTCTGAGCTCCAGGGGCGG - Intronic
1160275054 18:77424185-77424207 CTCGCTCTGTCGCCCAGGGCTGG - Intergenic
1160298534 18:77658575-77658597 TTCCCTCCCTTCCCCCGGGGTGG - Intergenic
1160329226 18:77977216-77977238 TTCTCTCTGGGCCCCGGGGGAGG - Intergenic
1160464154 18:79062203-79062225 CTCCCTCTGTCACCCAGGCTGGG + Intergenic
1160475890 18:79187359-79187381 TCCACACTGTCCCACAGGGGAGG + Intronic
1160643710 19:166128-166150 TTCCCTCTGTCACTCTGTGGAGG - Intergenic
1160649220 19:212783-212805 CTCGCTCTGTCACCCAGGGGTGG - Intergenic
1160706513 19:532481-532503 CTCCCTCTTTCTCGCAGGGGCGG - Intronic
1160849046 19:1181118-1181140 CTCGCTCTGTCCCCCAGGCTGGG + Intronic
1161064282 19:2229880-2229902 TTGCCTCTGCCGTCCAGGGGTGG - Exonic
1161190997 19:2955731-2955753 GTCACTCTGTCCCCCAGGGTAGG - Intergenic
1161541991 19:4857536-4857558 CTCACTCTGTCACCCAGGGTGGG - Intronic
1161554659 19:4934052-4934074 CTCCCTCTGTCGCCCAGGCTGGG + Intronic
1162019321 19:7861509-7861531 TGCCCTCTGGCCCCCAGGCCAGG - Intronic
1162291086 19:9781167-9781189 CTCCCTCTGTAGCCCAGTGGCGG + Intronic
1162306026 19:9874509-9874531 CTCCCTCTGTCGCCCAGGCTGGG + Intronic
1162349654 19:10140904-10140926 TGGCCTCTCTCCCCCAGGGAAGG - Exonic
1162414887 19:10529781-10529803 TTCACTCTGTCACCCAGGCTGGG + Intergenic
1162541865 19:11301607-11301629 CTCCCTCTGTCGCCCAGGCTGGG - Intronic
1162570384 19:11468443-11468465 CTCCCTCTGTCACCCAGGCTGGG + Intronic
1162653126 19:12106869-12106891 CTCGCTCTGTCGCCCAGGGTGGG - Intronic
1162932707 19:13965375-13965397 TCTCCTCTGCTCCCCAGGGGCGG - Intronic
1162971121 19:14182136-14182158 TCCTCTCTGCCCCTCAGGGGAGG - Intronic
1163048207 19:14660970-14660992 TTCACTCTGTCACCCAGGCTGGG + Intronic
1163144506 19:15371517-15371539 CTCCCTCTGTCGCCCAGGCTGGG + Intronic
1163245160 19:16088919-16088941 TTCCTTCTGCCCCCCACCGGGGG + Intronic
1163297310 19:16420784-16420806 ACCCCTCTTTCCCCCAGGGCTGG - Intronic
1163720049 19:18894560-18894582 ATCCTCCTGTCCCGCAGGGGTGG + Intronic
1163960414 19:20684962-20684984 CTCCCTCTGTCACCCAGGCCTGG + Intronic
1164974283 19:32560263-32560285 TTCACTCTGTCGCCCAGGCTGGG + Intergenic
1165031375 19:33000249-33000271 TTCGCTCTGTCACCCAGGCTTGG + Intronic
1165060642 19:33203761-33203783 TCCTCTCTGTCCTGCAGGGGTGG + Intronic
1165413488 19:35676866-35676888 TTCACTCTGTCGCCCAGGCTGGG - Intronic
1165889333 19:39101064-39101086 TCCCCACTGTCTCCCAGGGAGGG - Intronic
1166095831 19:40538496-40538518 TTCCCTTTGTCAGCCAGGGCTGG + Intronic
1166735598 19:45082382-45082404 TACCCTCTATCCCCCAGGCTGGG + Intronic
1166835239 19:45663656-45663678 TTCACTCTGTCGCCCAGGCTAGG - Intergenic
1167063583 19:47167295-47167317 CTCGCTCTGTCCCCCAGGCTGGG + Intronic
1167166471 19:47802975-47802997 TCCCCTCTGCCCCCCAGGTGTGG - Exonic
1167175372 19:47860785-47860807 TCCCCTCTGCCCCCCAGGTGTGG + Intergenic
1167257331 19:48438809-48438831 ATCCCTCTGTCACCCAGGCTGGG + Intronic
1167430663 19:49452598-49452620 CTCCCTCTGTCGCCCAGGGCTGG - Intronic
1167762496 19:51458339-51458361 TCCCCTTTGTCCCCCAGAGCAGG + Exonic
1167992930 19:53375976-53375998 CTCTCTCTGTCCCCAAGGGTGGG + Intronic
1168525354 19:57084375-57084397 TTCTCTCTGTCACCCAGGCTGGG + Intergenic
1168602078 19:57726278-57726300 CTCACTCTGTCGCCCAGGGTGGG - Intronic
925340058 2:3130006-3130028 TTCACTCTGTCACCCAGGCTGGG - Intergenic
926350873 2:11993237-11993259 CTCTCTCTGTCCTCCTGGGGAGG + Intergenic
927701067 2:25269296-25269318 TTCACTCTGTCTCCCAGGCTGGG - Intronic
927737004 2:25533294-25533316 CTCACTCTGTCGCCCAGGGTGGG - Intronic
927895652 2:26780095-26780117 TTCACTCTGTTGCCCAGGTGTGG - Exonic
928401979 2:30985623-30985645 TTCCCTTCCTCCCCCAGAGGAGG + Intronic
928815832 2:35293329-35293351 TTCCCTGTCTCCAACAGGGGTGG - Intergenic
928946027 2:36772674-36772696 CTCACTCTGTCCCCCAGGCTGGG - Intronic
928973837 2:37062816-37062838 TTCACTCTGTCACCCAGGCTGGG + Intronic
929516923 2:42611782-42611804 CTCACTCTGTCCCCCAGGCTAGG - Intronic
929690938 2:44072584-44072606 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
929779718 2:44949797-44949819 TCCTCTCTGTCCCCCAGCGCTGG + Intergenic
929922221 2:46180769-46180791 TTCCATCTGTCACACGGGGGTGG - Intronic
930178354 2:48324223-48324245 TTCGCTCTGTCTCCCAGGCCTGG + Intronic
931177122 2:59865330-59865352 CTCCCTGTTTCCCACAGGGGCGG - Intergenic
932462379 2:71891298-71891320 TCCCCACTGTCCCCCAAGGCAGG - Intergenic
932506014 2:72233039-72233061 TTCACTCTGTCACCCAGGCTGGG - Intronic
933058079 2:77698928-77698950 CTCGCTCTGTCCCCCAGGCTGGG - Intergenic
933725168 2:85422711-85422733 TTCCCTCTGTCCCACCCAGGTGG - Intronic
934847346 2:97670593-97670615 CTCCCTCTGTCACCCAGAGCTGG + Intergenic
934961524 2:98679599-98679621 TTCACTCTGTCGCCCAGGCTGGG - Intronic
935650452 2:105377696-105377718 TTACCTCTGTCCCCCTGTGCAGG + Intronic
935755213 2:106271256-106271278 GTCCCTCTGTCTGCCAGGGCAGG - Intergenic
935990473 2:108714720-108714742 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
936053802 2:109245319-109245341 TTCCCTCTGTCCCCAACTTGGGG + Intronic
936458561 2:112694052-112694074 CTCCCTCTGTCACCCAGGGTGGG + Intergenic
937283854 2:120737543-120737565 GTCCCTCTGTCCCCCAGCCCGGG + Intronic
938497299 2:131805725-131805747 CTCACTCTGTCCCCCAGGTTGGG + Intergenic
938814247 2:134883530-134883552 TTCACTCTGTCGCCCAGGCTGGG + Intronic
939507767 2:143070487-143070509 CTCCCTCTGTTCCCCAGGCAGGG - Intergenic
940130877 2:150380284-150380306 CTCGCTCTGTCGCCCAGGGCTGG + Intergenic
941694951 2:168541167-168541189 TTGACGCTGTCCCTCAGGGGTGG - Intronic
942237612 2:173927304-173927326 CTCACTCTGTCGCCCAGGGTGGG + Intronic
943123629 2:183769249-183769271 CTCACCCTGTCTCCCAGGGGCGG - Intergenic
944175744 2:196827206-196827228 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
944582481 2:201143917-201143939 CTCACTCTGTCACCCAGGGTGGG - Intronic
944624642 2:201558792-201558814 TGGCCACTGTCCCCCAGAGGAGG - Intronic
945459126 2:210083797-210083819 CTCACTCTGTCGCCCAGGGCTGG - Intronic
945921317 2:215757501-215757523 TTCACTCTGTCGCCCAGGCTGGG - Intergenic
946393267 2:219429378-219429400 CACCCTCTATCCCCCAGGTGGGG + Intergenic
947177242 2:227380297-227380319 CTCCCTCTGTCGCCCAGGCTGGG - Intronic
947362858 2:229364026-229364048 CTCCCTCTGTCGCCCAGGCTGGG + Intronic
947489523 2:230581699-230581721 CTCACTCTGTCACCCAGGGTGGG + Intergenic
947663254 2:231885844-231885866 CTCTCTCTGTCGCCCAGGGCTGG + Intergenic
947830475 2:233137485-233137507 CTCCCTCTGTTCCCCAGGCTGGG + Intronic
948466095 2:238152241-238152263 GCCCCTCTGGTCCCCAGGGGCGG - Exonic
949003951 2:241634789-241634811 TTCACTCTGTTCCCCAGGATGGG - Intronic
1169170634 20:3462043-3462065 TTCCCTCTGTCGCTCAGGCTAGG + Intergenic
1169187577 20:3631654-3631676 TTCCCTCTATGCCTCAGGGAAGG - Intronic
1169189375 20:3648153-3648175 TGCCCTCTTTCCCCCAGGAGGGG + Exonic
1169327561 20:4687287-4687309 CACCCTCTGTTCTCCAGGGGCGG + Intronic
1169422513 20:5471570-5471592 TCCTCCCTGTCCCCCAGGGCCGG + Intergenic
1169476841 20:5939447-5939469 CTCGCTCTGTCGCCCAGGTGGGG - Intronic
1170354197 20:15474663-15474685 TTGCCTCTGTTCCCAAAGGGTGG - Intronic
1171345620 20:24464122-24464144 CAGCCTCTGTCCTCCAGGGGCGG - Intergenic
1172358527 20:34296138-34296160 TGGCCTCTCTGCCCCAGGGGAGG + Intronic
1172363992 20:34334906-34334928 TTTCCTCCCTCCCCCAGGGCAGG - Intergenic
1172411827 20:34730096-34730118 GTCACTCTGTCCCCCAGGCTGGG + Intronic
1172411950 20:34731048-34731070 TTCACTCTGTCGCCCAGGCTGGG + Intronic
1172412266 20:34734102-34734124 CTCACTCTGTCCCCCAGGCTGGG + Intronic
1173518796 20:43683957-43683979 TTCGCTCTGTCACCCAGGCTGGG + Intronic
1173531515 20:43773115-43773137 CTCCCACAGTCCCCCAGGGCAGG - Intergenic
1173671975 20:44805273-44805295 CTCCCTCTGTCGCCCAAGGTGGG - Intronic
1173798831 20:45881875-45881897 TTCACTCTGTCACCCAGAGCTGG + Intronic
1173843392 20:46173631-46173653 TTCCCTACATCTCCCAGGGGAGG - Intergenic
1174000719 20:47372533-47372555 TTCACTCTGTCACCCAGGTTAGG - Intergenic
1174643689 20:52067131-52067153 CTCACTCTGTCACCCAGGGCTGG - Intronic
1175224420 20:57436718-57436740 CTCACTCTGTCCCCCAGGTTGGG + Intergenic
1175381844 20:58569005-58569027 TTCCTTCTGCCACCCAGGAGAGG + Intergenic
1175503461 20:59466335-59466357 TGACCTCTGCCCTCCAGGGGAGG + Intergenic
1175897371 20:62345046-62345068 TTCGCTCTGTTGCCCAGGCGGGG + Intronic
1176248641 20:64109576-64109598 CTTCCTCTGCCCCCCAGGGCTGG + Intergenic
1176370686 21:6059998-6060020 TTCCCTCTCTTCTCCTGGGGTGG + Intergenic
1176780797 21:13192584-13192606 CTCACTCTGTCGCCCAGGGCTGG + Intergenic
1177476282 21:21628143-21628165 TTCACTCTGTCACCCAGGCTGGG + Intergenic
1178038279 21:28609331-28609353 TCTCCTCTTTCCCCTAGGGGTGG - Intergenic
1178234497 21:30825319-30825341 TTCACTCTGTCGCCCAGGCTGGG + Intergenic
1178448443 21:32667600-32667622 CTCACTCTGTCACCCAGGGCTGG + Intronic
1178529732 21:33365828-33365850 CTCGCTCTGTCACCCAGGGCTGG + Intergenic
1179438230 21:41376515-41376537 CTCACTCTGTCACCCAGTGGGGG - Intronic
1179752833 21:43478543-43478565 TTCCCTCTCTTCTCCTGGGGTGG - Intergenic
1180258752 21:46651613-46651635 GTCCCTCAGTCTCCCTGGGGGGG - Intronic
1180455019 22:15507106-15507128 CTCACTCTGTCCCCCAGGTTGGG - Intergenic
1180611753 22:17102772-17102794 CTCGCTCTGTCCCCCAGAGTGGG - Intronic
1180657307 22:17433640-17433662 TTTTCTGTGTTCCCCAGGGGTGG + Intronic
1180800423 22:18629252-18629274 CCCCCTCTGTCCCCCAGGTGCGG - Intergenic
1180851657 22:19024808-19024830 CCCCCTCTGTCCCCCAGGTGCGG - Intergenic
1181184273 22:21091216-21091238 TTCGCTCTGTCGCCCAGGCTGGG + Intergenic
1181221296 22:21366010-21366032 CCCCCTCTGTCCCCCAGGTGCGG + Intergenic
1181450840 22:23019472-23019494 CTCACTCTGTCACCCAGGGCTGG + Intergenic
1181560194 22:23695512-23695534 TTCCCCCTCTCCCCCAGTGCAGG - Intronic
1181647176 22:24238196-24238218 CTCACTCTGTCCCCCAGGCTGGG - Intronic
1182225155 22:28792015-28792037 TTCGCTCTGTCGCCCAGGCTGGG - Intergenic
1183096878 22:35557589-35557611 TTCCCTCCCTCGCCCAGCGGTGG + Intergenic
1183109073 22:35635622-35635644 CTCACTCTGTCGCCCAGGCGGGG + Intronic
1183269807 22:36854039-36854061 CTCGCTCTGTCGCCCAGGGTGGG + Intergenic
1183924497 22:41196490-41196512 CTCACTCTGTCGCCCAGGGCCGG - Intergenic
1183940470 22:41291950-41291972 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1184667142 22:45995101-45995123 TGCCCTGTGTCTCCCACGGGCGG - Intergenic
1184971940 22:48028929-48028951 TTCCCTCAATCCCTCAGGTGTGG - Intergenic
1184989165 22:48155629-48155651 TTCCCTCTGGCCTGCAGGGGTGG - Intergenic
949175173 3:1053158-1053180 CTCCCTCTGTCGCCCAGGGTGGG + Intergenic
950751078 3:15128558-15128580 CTCCATCTCTCCCCTAGGGGAGG + Intergenic
950809363 3:15636437-15636459 TTCCCTCTTTGCCCCCAGGGGGG - Intronic
950887206 3:16372796-16372818 TTCAGTCTGGCCCCCTGGGGAGG - Intronic
951294587 3:20918094-20918116 TCTCCTCTTTCCCCCAGGGATGG - Intergenic
952239391 3:31514472-31514494 TTCACTGTGGCCCACAGGGGTGG - Intergenic
952926367 3:38322883-38322905 TTCACTCTGTCACCCAGGCTGGG - Intergenic
953795482 3:45982557-45982579 GTCCCTCTGTCCCACAGCAGAGG - Intronic
953830201 3:46290657-46290679 CTCACTCTGTCGCCCAGGGTCGG + Intergenic
953883934 3:46705084-46705106 TCCCCTCAGTCCCCCAGGGCAGG + Intronic
954991009 3:54840750-54840772 CTCGCTCTGTCACCCAGGGCTGG + Intronic
955213292 3:56962012-56962034 CTCCCTCTGTCACCCAGGCTGGG - Intronic
955215929 3:56985116-56985138 CTCACTCTGTCGCCCAGGCGGGG + Intronic
955286220 3:57644333-57644355 CTCACTCTGTTCCCCAGGGCTGG + Intronic
955315632 3:57936628-57936650 TTCACTCTGTCACCCAGGCTGGG - Intergenic
956168526 3:66414363-66414385 CTCGCTCTGTCCCCCAGGTGGGG - Intronic
956233985 3:67046176-67046198 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
956810989 3:72863989-72864011 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
956952535 3:74298855-74298877 CTCTCTCTGTCACCCAGGAGTGG - Intronic
957070365 3:75563228-75563250 CTCCATCTCTCCCCTAGGGGAGG - Intergenic
957220949 3:77381282-77381304 CTCCCTCTGTCACCCAGGCTGGG - Intronic
958681243 3:97334508-97334530 TTTTCTCTGTCCCCCAGGCTGGG + Intronic
959083932 3:101831668-101831690 CTCCCTCTGTCGCCCATGGTTGG + Intronic
959088252 3:101874332-101874354 TTCACTCTGTCACCCAGGCTGGG - Intergenic
959722418 3:109507623-109507645 CTCCCTCTGTCACCCAAGGCTGG + Intergenic
960284404 3:115810875-115810897 CTCCCTCTGTCCCCGGGGGGAGG + Intronic
961110474 3:124279139-124279161 CTCTCTCTGTCCCCCACAGGAGG - Intronic
961620080 3:128217245-128217267 TTACCTCTGTCCCACAGTGAGGG - Intronic
962130611 3:132670052-132670074 CTCACTCTGTCCCCCAGGTTGGG + Intronic
962542441 3:136396244-136396266 CTCGCTCTGTCGCCCAGGCGGGG + Intronic
962750459 3:138431164-138431186 CTCACTCTGTCCCCCAGAGCTGG - Intergenic
962866430 3:139451457-139451479 TTCCCTGTCTGCCCCAGGAGAGG + Intergenic
962943387 3:140145846-140145868 TGCCATCTGTCCCACATGGGTGG - Intronic
964058155 3:152487463-152487485 CTCCCTCTGTCACCCAAGGCTGG + Intergenic
964101609 3:152994527-152994549 TTCACTCTGTCGCCCAGGCTGGG + Intergenic
964841585 3:160999438-160999460 TTCCCTCTGGCGGCCAGGTGGGG - Intronic
965359905 3:167726149-167726171 TTCACTCTGTCACCCAGGCTGGG + Intronic
965514776 3:169609231-169609253 TAGCCTCTGTGCCCCAGAGGAGG - Intronic
965569031 3:170152689-170152711 CTCCCTCTGTCACCCAGGCTGGG + Intronic
967562793 3:190936345-190936367 TTACCTCTGTCACCCAGGGTAGG + Intergenic
968023545 3:195417908-195417930 CTCCCTCTGTCACCCAGGCTGGG - Intronic
968543976 4:1186332-1186354 CTCCCTCTGTCACCCAGGCTGGG + Intronic
969276824 4:6141403-6141425 TTCACTCTGTCGCCCAGGCTGGG - Intronic
969299417 4:6288879-6288901 TTCCCTTTGTCACCCAGGCCAGG - Intronic
969360853 4:6662967-6662989 TTCCTTCCCTCCCACAGGGGTGG - Intergenic
969391368 4:6893318-6893340 CTCACTCTGTCCCCCAGGCTGGG - Intergenic
969406742 4:6998327-6998349 TTTGCTCTGTCACCCAGGGTGGG - Intronic
969690266 4:8700363-8700385 TGCCCTCTGTCCAGCCGGGGAGG + Intergenic
969739999 4:9017524-9017546 CTCCATCTCTCCCCTAGGGGAGG + Intergenic
969799162 4:9549028-9549050 CTCCATCTCTCCCCCGGGGGAGG + Intergenic
970399318 4:15702713-15702735 CTCACTCTGTCGCCCAGGGCTGG + Intronic
970464093 4:16306021-16306043 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
970945243 4:21683496-21683518 CTCACTCTGTCACCCAGGGCTGG + Intronic
971195918 4:24471767-24471789 GTGCTTCTGTGCCCCAGGGGAGG + Intergenic
971265673 4:25094363-25094385 TTCCTTCTGTCCCTGGGGGGTGG - Intergenic
972490260 4:39580550-39580572 CTCACTCTGTCACCCAGGCGAGG + Intronic
972506935 4:39728666-39728688 CTCGCTCTGTCCCCCAGGTGGGG + Intronic
972643141 4:40943498-40943520 TTCCCCCTGTACCACAGTGGGGG - Intronic
973579941 4:52333330-52333352 TTTCCTCAGTCTCCCAGGGAAGG + Intergenic
973746409 4:53967719-53967741 TTTGCTCTGTCACCCAGAGGTGG + Intronic
973854695 4:54999501-54999523 TTCTCTCTGTCACTCAGGGAAGG + Intergenic
973890168 4:55360474-55360496 CTCCCTCTGTTGCCCAGGCGTGG - Intronic
974210239 4:58763528-58763550 TTCACTCTGTCGCCCAGGCTGGG - Intergenic
975632725 4:76418986-76419008 TTCCCTCTTTTCCCCAGGCCTGG + Intronic
976168835 4:82283101-82283123 TTCCTTCTTTCCCCATGGGGTGG - Intergenic
976208317 4:82642585-82642607 TTTCATCAGTCCCCCAGGCGAGG + Intronic
976752116 4:88459611-88459633 GTCCTTATGTCCCCCAGGGCAGG + Intronic
977433484 4:96963706-96963728 CTCGCTCTGTCGCCCAGGCGTGG + Intergenic
979621848 4:122806762-122806784 CTCACTCTGTCCCCCTGGGCTGG - Intergenic
980341001 4:131547376-131547398 CTCACTCTGTCCCCCAGGAAGGG + Intergenic
980709258 4:136542591-136542613 CTCACTCTGTCACCCAGGGCTGG - Intergenic
980724377 4:136739801-136739823 CTCACTCTGTCCCCCAGGGCTGG + Intergenic
980905894 4:138948320-138948342 CTCCCTCTGTCGCCCAGGCTGGG - Intergenic
981976664 4:150738020-150738042 TTCGCTCTGTCGCCCAGGCTGGG + Intronic
982704822 4:158696473-158696495 CTCACTCTGTCACCCAGGGTAGG - Intronic
984195828 4:176657498-176657520 TTCACTCTGTCACCCAGGCTGGG - Intergenic
984481615 4:180310868-180310890 TTCACTCTGTCGCCCAAGGCTGG + Intergenic
984901440 4:184590176-184590198 GTCCCTCTGTCACCCAGGCTGGG - Intergenic
984927227 4:184817628-184817650 GTCCCTCTGCCTCCCAGGTGTGG - Intronic
985134907 4:186776728-186776750 TTCACTCTGTCACCCAGGCTGGG + Intergenic
985664295 5:1173952-1173974 TGCCCACGGTACCCCAGGGGCGG - Intergenic
985861152 5:2471602-2471624 CTTCCACTGTCCCCAAGGGGTGG - Intergenic
985888225 5:2696626-2696648 CTCCCTCTGGCCTGCAGGGGAGG - Intergenic
986992960 5:13575297-13575319 TTCGCTCTGTCACCCAGGCTGGG - Intergenic
987410449 5:17609907-17609929 CTCACTCTGTCCCCCAGGCTGGG - Intergenic
987850916 5:23353002-23353024 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
988274205 5:29059588-29059610 GTCACTCTGTCCCCCTGGGCTGG + Intergenic
988497632 5:31758456-31758478 TGCTGTCTGTCCCCCAGGGTAGG - Intronic
988905739 5:35786628-35786650 CTCCCGCTGTCGCCCAGGGCTGG - Intronic
989362901 5:40623802-40623824 TTCCCTCTGTCTCCAAGTTGGGG + Intergenic
989538495 5:42591498-42591520 TTCCCACTATCCTGCAGGGGTGG + Intronic
990413831 5:55566976-55566998 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
990468142 5:56088460-56088482 CTCTCTCTGTCCCCCAGGCTGGG - Intergenic
992213783 5:74506233-74506255 TTTGCTCAGCCCCCCAGGGGAGG - Intergenic
992384499 5:76270797-76270819 CTCACTCTGTCACCCAGGGTAGG + Intronic
993329531 5:86580442-86580464 CTCACTCTGTCCCCCAGGCTGGG - Intergenic
993931511 5:93947453-93947475 CTCACTCTGTCACCCAGGTGAGG + Intronic
994043525 5:95284379-95284401 TTCCCTGTGCCCACCGGGGGTGG + Exonic
994739275 5:103597388-103597410 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
996047714 5:118894008-118894030 CTCCCTCTGTCACCCAGGCTGGG - Intronic
996065185 5:119071482-119071504 CTCCCTCCTTCCCTCAGGGGCGG - Exonic
996916621 5:128720019-128720041 TTCACTCTGTCGCCCAGGCCGGG - Intronic
997171811 5:131729606-131729628 CTCACTCTGTCACCCAGGGTGGG + Intronic
997510664 5:134451622-134451644 CTCACTCTGTCACCCAGGTGGGG - Intergenic
997697992 5:135876848-135876870 TTCCTCCAGTGCCCCAGGGGTGG + Intronic
998018644 5:138752657-138752679 CTCCCTCTGTCGCCCAGGCTGGG - Intronic
998226925 5:140334384-140334406 TTCACTCTGTCTCCCAGGGGAGG + Intronic
998931599 5:147187469-147187491 TTACCTCCCACCCCCAGGGGAGG - Intergenic
999170388 5:149589160-149589182 CTCACTCTGTCACCCAGGGCTGG - Intronic
1000757218 5:165176021-165176043 CTCACTCTGTCTCCCAGGTGGGG - Intergenic
1000864368 5:166494307-166494329 TTCACTCTGTCACCCAGGCTGGG + Intergenic
1001014583 5:168128541-168128563 GCCCCTCTGTCCCCCAGATGTGG - Intronic
1001028104 5:168241284-168241306 CTCACTCTGTCCCCCAGGGTGGG + Intronic
1001196069 5:169674603-169674625 GTCCCTAGGTCCCCCAGGGGTGG - Intronic
1001250454 5:170142987-170143009 TTCCCTCTTTCCCCCTGGTTTGG - Intergenic
1001694633 5:173660842-173660864 CTGCCTCTGTCTCCCTGGGGAGG - Intergenic
1001725534 5:173894588-173894610 CTCACTCTGTCCCCCAGGCTAGG - Intronic
1001757346 5:174180795-174180817 TGCCCACTGGTCCCCAGGGGAGG + Intronic
1002154424 5:177265469-177265491 CTCCCTCCCTCCCCCAGAGGAGG - Intronic
1002204070 5:177550858-177550880 TTCCCTCTCTCCCCCAGGCTGGG + Intronic
1002704849 5:181153645-181153667 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
1002733212 5:181358652-181358674 TTCCCTCTGTCACTCTGTGGAGG + Intergenic
1002751327 6:115455-115477 TTCCCTCTGTCACTCTGTGGAGG - Intergenic
1003296988 6:4838715-4838737 CTCCCTCTGTCACCCAGGCTGGG + Intronic
1003423771 6:5982763-5982785 TCCCCTCTGTCACCCAGGCTAGG - Intergenic
1003533225 6:6954916-6954938 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
1003817781 6:9861676-9861698 TTCCCACTGGCCCCAAGGGAGGG - Intronic
1003856360 6:10280037-10280059 CTCCCTCTGTCGCCCAGGCTGGG - Intergenic
1003997647 6:11559222-11559244 TTCACTCTGTCACCCAGGCTGGG + Intronic
1004693455 6:18012262-18012284 TTCACTCTGTCACCCAGGCCGGG + Intergenic
1005454791 6:26008902-26008924 CTCGCTCTGTCGCCCAGGGTGGG + Intergenic
1005488496 6:26323975-26323997 CTCGCTCTGTCGCCCAGGGCTGG + Intergenic
1005944255 6:30584175-30584197 CTCCCTCTGCCTCCCAGAGGTGG + Exonic
1006032933 6:31190745-31190767 TTCACTCTGTCACCCAGGCTGGG - Intergenic
1006185642 6:32180212-32180234 TTTCCTCTCTCCCACAGGTGTGG + Exonic
1006590909 6:35156977-35156999 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1006940065 6:37746036-37746058 TTCCCTCTATCCACCATGAGTGG - Intergenic
1007035385 6:38668200-38668222 CTCACTCTGTCACCCAGGGTTGG - Intergenic
1007390681 6:41548011-41548033 TTCCCTGTGTCCCCCAACTGGGG + Intronic
1007582839 6:42969450-42969472 TAACCTCTGTCCTCCAGGGCTGG - Intronic
1007605087 6:43112297-43112319 CTCCCTCTGTCACCCAGGCTGGG + Intronic
1007690398 6:43697331-43697353 TTCACTCTGTCACCCAGGCTGGG - Intergenic
1007831636 6:44643383-44643405 TTTCCTCTGGTCCCCAGGGCAGG - Intergenic
1007848129 6:44777840-44777862 TTCCTTGTGTCCCCCAGGGCGGG + Intergenic
1008077913 6:47165195-47165217 ATTCCCCTGTCCCCCAGGTGTGG + Intergenic
1008291367 6:49720372-49720394 CTCTCTCTGTCACCCAGAGGGGG + Intergenic
1009606938 6:65882826-65882848 TTCACTCTGTCACCCAGGCTAGG + Intergenic
1010084875 6:71905404-71905426 TTCCCTCTCTTCCCCAGCTGTGG - Intronic
1010211746 6:73367569-73367591 GTCGCTCTGTCCCCCAGGCTGGG - Intergenic
1010227013 6:73499489-73499511 TTCACTCTGTCACCCAGGCTGGG - Intronic
1012278423 6:97300488-97300510 TTCACTCTGTCGCCCAGGTTGGG - Intergenic
1014809781 6:125871964-125871986 CTCCCTCTGTCACCCAGGCTGGG - Intronic
1015501778 6:133942048-133942070 CTCACTCTGTCCCCCAGGTTGGG + Intergenic
1015600933 6:134909825-134909847 TACCTTCAGTCCCCCAGGGAAGG - Intergenic
1015987554 6:138899799-138899821 TTCCCCCTCCCCACCAGGGGTGG - Intronic
1016971372 6:149767481-149767503 TTCACTCTGTCACCCAGGCTAGG + Intronic
1017115824 6:150975645-150975667 TTCCCACTGTCAGCCAGAGGAGG - Intronic
1017616203 6:156249556-156249578 CTCCCTCTGTCACCCAGGCTGGG + Intergenic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018608263 6:165621724-165621746 CTCACTCTGTCACCCAGGGCTGG - Intronic
1019159891 6:170062787-170062809 CTCACTCTGTCCCACAGGGAAGG + Intergenic
1019192170 6:170258364-170258386 TTACCTCTGTCCCCTTGGTGAGG - Intergenic
1019194384 6:170272690-170272712 TTCCCTCTGTCCCTCTGAGGCGG - Intergenic
1019237462 6:170630974-170630996 TTCCCTCTGTCACTCTGTGGAGG + Intergenic
1019562698 7:1666249-1666271 TTCCCTGCCTCCCCTAGGGGCGG - Intergenic
1019717755 7:2548061-2548083 CTCGCTCTGTCGCCCAGGGCTGG - Intronic
1022531784 7:31071392-31071414 CTCCCCATGTCCCCCAGTGGGGG + Intronic
1023679495 7:42670804-42670826 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
1024111594 7:46152836-46152858 TTCTCTCTTTCCTCCAGAGGGGG + Intergenic
1024527382 7:50360265-50360287 TTCCCTCTCATCCCCAGGGCTGG - Intronic
1024564265 7:50668531-50668553 TTCCCTCTGTTCCACAGTTGAGG - Intronic
1025605503 7:63037527-63037549 TTCCCTCTGATCCCTGGGGGTGG - Intergenic
1025748968 7:64274666-64274688 TTCGCTCTGTCACCCAGGATAGG + Intergenic
1025947541 7:66115838-66115860 CTTGCTCTGTCCCCCAGGCGGGG + Intronic
1026935990 7:74255657-74255679 TTCACTCTGTCCCCCGGGGCTGG - Intergenic
1028803127 7:94991679-94991701 CTCGCTCTGTCACCCAGGGCTGG + Intronic
1029072638 7:97912527-97912549 CTCCATCTCTCCCCTAGGGGAGG - Intergenic
1029594253 7:101528436-101528458 TTCCCTCAGGCCCCAAGGGTGGG + Intronic
1029712197 7:102305923-102305945 CTCACTCTGTCACCCAGGTGGGG + Intronic
1029814253 7:103076917-103076939 CTCCCTCTGTCACCCAGGCTCGG + Intronic
1029827626 7:103216999-103217021 CTCGCTCTGTCCCCCAGGCCCGG + Intergenic
1030049394 7:105524248-105524270 CTCACTCTGTCCCCCAGGTTGGG - Intergenic
1030697266 7:112599437-112599459 CTCACTCTGTCACCCAGGGCTGG - Intergenic
1030794708 7:113773205-113773227 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
1032173217 7:129602806-129602828 CTCGCTCTGTCACCCAGGGCTGG - Intergenic
1032192057 7:129771022-129771044 TTCCCTCTCTCCCTTTGGGGTGG - Intergenic
1032283223 7:130523086-130523108 TTCACTCTGTCGCCCAAGGCTGG - Intronic
1032425072 7:131815974-131815996 TGCCCTCTATTCCCCAGGTGAGG + Intergenic
1032736163 7:134694471-134694493 TTACATCTCTCCCCCAGGAGAGG + Intergenic
1033107972 7:138547704-138547726 TTCCCTCTGTCACCCAGGCTTGG + Intronic
1034080099 7:148268622-148268644 CTCCCTCTGTCGCCCAGGCTGGG - Intronic
1034225234 7:149476281-149476303 CTCACTCTGTCCCCCAGGCTTGG - Intronic
1034297494 7:149987095-149987117 TACCCTTTGTCCCCCAGTGGAGG - Intergenic
1034497482 7:151431360-151431382 TCCCCTCTGCCCCTCAAGGGTGG + Intronic
1034808531 7:154109759-154109781 TACCCTTTGTCCCCCAGTGGAGG + Intronic
1034821189 7:154217819-154217841 TTCCCTCTCTCCCTCCTGGGTGG - Intronic
1035398262 7:158549041-158549063 CTCCCTCGGCCCCCCTGGGGTGG - Intronic
1035459406 7:159029914-159029936 TTCCCTCTGTCCTGCAGATGAGG + Exonic
1035482539 7:159198835-159198857 CTCCCACTGTCCCCCAAGTGCGG + Intergenic
1035510305 8:175637-175659 TTCCCTCTGTCACTCTGTGGAGG - Intergenic
1035626396 8:1074471-1074493 TTCCCTCTGTCCCACATGAAAGG - Intergenic
1035657932 8:1325152-1325174 TTCCCCCAGTCCCCCAGAGCTGG + Intergenic
1035737447 8:1898741-1898763 TCCCCTCTGTCCCCCAAGGCTGG - Intronic
1035761299 8:2070709-2070731 TTCCCTCTGTCAAACACGGGTGG - Intronic
1036083115 8:5579943-5579965 CTCGCTCTGTCACCCAGGGCTGG - Intergenic
1036245030 8:7108769-7108791 CTCCATCTCTCCCCTAGGGGAGG + Intergenic
1036693478 8:10959556-10959578 TTCCCTCTCTCCACCACGTGAGG - Intronic
1036896788 8:12642697-12642719 CTCCATCTCTCCCCTAGGGGAGG - Intergenic
1036953803 8:13165987-13166009 GTCCCTCTGGCTCCCAGTGGTGG - Intronic
1037867911 8:22462210-22462232 CTCCCTCTGTCACCCAGGCTGGG - Intronic
1037892207 8:22629364-22629386 TTCCCTCGGTCCCCAGGGCGGGG - Intronic
1038561993 8:28588828-28588850 TTCGCTCTGTCGCCCAGGCTGGG + Intergenic
1038748609 8:30275884-30275906 TTCACTCTGTCACCCAGGCTGGG + Intergenic
1038799431 8:30735806-30735828 CTCACTCTGTCCCCCAGGCTGGG - Intronic
1038968814 8:32608207-32608229 TTCACTCTGTCACCCAGGCTAGG + Intronic
1038987637 8:32829697-32829719 CTCCCTCTGTCCCCCAGGCTGGG - Intergenic
1039390428 8:37176212-37176234 TTCACTCTGTCACCCAGGCTGGG + Intergenic
1039459363 8:37730449-37730471 TTTCCTCTGTCGCCCAGGCCAGG - Intergenic
1039831783 8:41221202-41221224 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1040009329 8:42648264-42648286 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1040882541 8:52222460-52222482 TTCACTCTCTTCCCCAGGGAGGG - Intronic
1040907201 8:52480895-52480917 TTCCTCCAGTCCCCCAGGAGAGG + Intergenic
1041802243 8:61812973-61812995 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1042242816 8:66681819-66681841 TTCACTGTGTTGCCCAGGGGTGG + Intronic
1042607022 8:70555645-70555667 CTCACTCTGTCCCCCAGGCGGGG - Intergenic
1042649211 8:71021531-71021553 TTCGCTCTGTCGCCCAGGCTGGG + Intergenic
1042885051 8:73539811-73539833 TTCACTCTGTCGCCCAGGGCTGG - Intronic
1043924743 8:86024133-86024155 CTCACTCTGTCACCCAGGGCTGG - Intronic
1043937792 8:86161527-86161549 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1044641997 8:94392625-94392647 CTCACTCTGTCGCCCAGGGCTGG + Intronic
1045281231 8:100751334-100751356 CTCCCTCTGTCACCCAGGCTGGG + Intergenic
1045828538 8:106429768-106429790 TTTCCTCTTTCCACCAGGGATGG + Intronic
1046147592 8:110181613-110181635 CTCGCTCTGTCGCCCAGGGCTGG + Intergenic
1046922756 8:119750308-119750330 CTCACTCTGTCACCCAGGGTGGG - Intronic
1046924767 8:119774138-119774160 CTCGCTCTGTCCCCCAGGCTAGG - Intronic
1047234510 8:123028031-123028053 TTCACTCTGTCACCCAGTCGGGG - Intronic
1047444331 8:124906092-124906114 CTCCCTCTGTCACCCAGGCTGGG + Intergenic
1047653366 8:126948584-126948606 CTCACTCTGTCGCCCAGGGTGGG - Intergenic
1047712679 8:127567988-127568010 CTCCCTCTGTCACCCAGGCTGGG + Intergenic
1047977526 8:130145870-130145892 CTCACTCTGTCGCCCAGGGTGGG + Intronic
1049093565 8:140534807-140534829 TTCCTCCTGTCCCCCGGGCGAGG + Intronic
1049533863 8:143169114-143169136 TTCCCTCTGACCCCCAGATCAGG + Intergenic
1049587290 8:143437930-143437952 GTCCCTGTGGCCCCCAGGTGAGG + Exonic
1051136882 9:13932814-13932836 TTCCCTCACTCCCTCAGGGTTGG + Intergenic
1051656991 9:19392620-19392642 TTCACTCTGTCACCCAGGCTGGG + Intergenic
1052898955 9:33773660-33773682 CTCACTCTGTCACCCAGCGGTGG + Intronic
1053545477 9:39018771-39018793 CTTCCACTGTCCCCCAGGTGAGG - Intergenic
1053569424 9:39288476-39288498 GTCCCTCTCTCCCACCGGGGCGG + Intergenic
1053809808 9:41840469-41840491 CTTCCACTGTCCCCCAGGTGAGG - Intergenic
1053835385 9:42129497-42129519 GTCCCTCTCTCCCACCGGGGCGG + Intronic
1054091053 9:60847460-60847482 GTCCCTCTCTCCCACCGGGGCGG + Intergenic
1054112464 9:61123016-61123038 GTCCCTCTCTCCCACCGGGGCGG + Intergenic
1054127722 9:61330534-61330556 GTCCCTCTCTCCCACCGGGGCGG - Intergenic
1054595241 9:67059113-67059135 GTCCCTCTCTCCCACCGGGGCGG - Intergenic
1054620785 9:67346959-67346981 CTTCCACTGTCCCCCAGGTGAGG + Intergenic
1055328913 9:75161928-75161950 ATCCCTCTGTCACCCAGGCTGGG + Intergenic
1055730704 9:79277149-79277171 CTCCCTCTGTCACCCAGGCTGGG + Intergenic
1055836534 9:80449432-80449454 CTCACTCTGTCACCCAGGGTGGG - Intergenic
1055939067 9:81632057-81632079 TTCGCTCTGTCACCCAGGCTGGG - Intronic
1055951624 9:81734816-81734838 CTCACTCTGTCACCCAGGCGGGG - Intergenic
1056173295 9:84009043-84009065 CTCACTCTGTCACCCAGGGTGGG - Intergenic
1056673159 9:88648886-88648908 CTCCCTCTGTCACCCAGGCTGGG + Intergenic
1057414444 9:94848589-94848611 CTCCCTCTGTCACCCAGGCTGGG - Intronic
1057906012 9:98984077-98984099 TGCCCTCTGGCCTCCAGAGGAGG + Intronic
1058890325 9:109355646-109355668 TTTGCTCTGTCCCCCAGGCTGGG + Intergenic
1058899575 9:109430588-109430610 TTCCCTCTGTCCCCAGGGCCTGG - Intronic
1060082350 9:120661484-120661506 CTCACTCTGTCACCCAGGTGGGG - Intronic
1060216921 9:121744007-121744029 GTTGCTCTGTCCCCCAGGCGCGG + Intronic
1060219344 9:121756100-121756122 TTTCCTCTGTCCCACCGTGGGGG + Intronic
1060501126 9:124156708-124156730 TTTGCTCTGTCGCCCAGGGCTGG + Intergenic
1060846717 9:126843081-126843103 CTCCCTCTGTCCCCCCAGGCTGG + Intergenic
1061215043 9:129216849-129216871 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1061225242 9:129277448-129277470 TTCACTCTGTCACCCAGGCTGGG + Intergenic
1061370873 9:130196711-130196733 CTCCCTCTGTCACCCAGGCTGGG - Intronic
1061505514 9:131029690-131029712 GTCCCTCTGACCCCCAAGGAAGG + Intronic
1061673743 9:132203795-132203817 TTCCCTCTGACTCCCAGGTCTGG - Intronic
1061857776 9:133452141-133452163 TTTTCTCTGTCACCCAGGGTGGG + Intronic
1062064205 9:134517610-134517632 ATCCCTCTGTCCACGTGGGGAGG - Intergenic
1062172669 9:135144184-135144206 TTCCCTCTGCCCCTCAAGCGGGG + Intergenic
1062211726 9:135368050-135368072 CTCCCTCTGTCCCCCAGGCTGGG - Intergenic
1062377277 9:136267845-136267867 CCCCCTCTGTCACCCAGGGCGGG + Intergenic
1062599518 9:137313608-137313630 CTCCCTCTGGGCCCCATGGGGGG + Intronic
1062757617 9:138310975-138310997 TTCCCTCTGTCACTCTGTGGAGG + Intergenic
1185635382 X:1548205-1548227 TTCGCTCTGTCACCCAGGCTGGG - Intergenic
1186663710 X:11696682-11696704 TTACTTCTGTGCCCCAGGGATGG - Intergenic
1186678879 X:11851010-11851032 TTCACTATGTCCACCAGAGGAGG - Intergenic
1186743888 X:12546208-12546230 CTCACTCTGTTGCCCAGGGGTGG + Intronic
1188246377 X:27840505-27840527 TGCCCTCTGTCAGCCATGGGAGG - Intergenic
1188721881 X:33532024-33532046 CTCGCTCTGTCACCCAGGGCTGG - Intergenic
1190087065 X:47404453-47404475 CTCCCTCTGTCTGCCAGGTGCGG - Intronic
1190100490 X:47518992-47519014 CTCCCTCTGTCACCCAGGCTAGG - Intergenic
1190295866 X:49027146-49027168 TTCCCTCTGTCACCCAGGCTGGG - Intergenic
1190634134 X:52417856-52417878 TTCCCTCTGTTGCCCAGGCTGGG - Intergenic
1193022038 X:76801438-76801460 GTACCTATGTCCCCCAGGGGAGG - Intergenic
1195030224 X:100920788-100920810 CTCCCTCTGTCGCCCAGGCTGGG + Intronic
1196204140 X:112919981-112920003 CTCGCTCTGTCCCCCAGGCTGGG + Intergenic
1196793673 X:119485882-119485904 TTCCCTCTGTCGCCCAGGCTGGG - Intergenic
1197240159 X:124114625-124114647 TTCCCTCTTCCCCCAAGCGGAGG + Intronic
1199712203 X:150477407-150477429 TCCTCTCTGACCCCCAGGGGTGG + Intronic
1200102333 X:153694327-153694349 TGGGCTCTGTCCCCCAGGGCGGG + Exonic
1200210366 X:154344379-154344401 TCCCCTCTCTGCCCCAGGTGGGG + Intergenic
1200220486 X:154387713-154387735 TCCCCTCTCTGCCCCAGGTGGGG - Intergenic
1201243215 Y:11978703-11978725 TTTGCTCTGTCTCCCAGGCGGGG - Intergenic