ID: 915340952

View in Genome Browser
Species Human (GRCh38)
Location 1:155176303-155176325
Sequence GTGGGTTTCCAAAAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915340938_915340952 28 Left 915340938 1:155176252-155176274 CCTGGGGAGGGAGGGACATGCTG 0: 1
1: 1
2: 3
3: 63
4: 484
Right 915340952 1:155176303-155176325 GTGGGTTTCCAAAAGGAAGTGGG 0: 1
1: 0
2: 1
3: 15
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915340952 Original CRISPR GTGGGTTTCCAAAAGGAAGT GGG Intronic
904163551 1:28538222-28538244 GGGGGTTTTCAAAAGGAACATGG + Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905602821 1:39268902-39268924 GAGAGTCTCCAAAAGGAAGACGG + Intronic
905858641 1:41331323-41331345 GAGGGCTTCCAGGAGGAAGTGGG + Intergenic
908625856 1:66040871-66040893 GAGGGCTTTTAAAAGGAAGTAGG + Intronic
910162085 1:84284138-84284160 GTGGGTATCCTAAAGGAATCAGG - Intergenic
912000257 1:104824263-104824285 TTGGGTTTCCAATAGGAGATGGG - Intergenic
913052808 1:115131783-115131805 GTGGGAGTCCAAGAGGATGTTGG - Intergenic
914785349 1:150824298-150824320 ATGGATTTCCCAAGGGAAGTAGG - Intronic
915307672 1:154989998-154990020 GTGGGCTTCCCAGAGGAAGTGGG + Intronic
915340952 1:155176303-155176325 GTGGGTTTCCAAAAGGAAGTGGG + Intronic
917973092 1:180220832-180220854 GTGGGACTCCAAAAGGCGGTAGG + Intergenic
919441885 1:197644784-197644806 TTTGGTTTCCAAAAGCATGTAGG - Intronic
922649640 1:227326598-227326620 GTGGTTTTAAAAAAGGAATTTGG - Intergenic
923354702 1:233142811-233142833 GTGAGTTTTCAAAAGGAGGGAGG - Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063251254 10:4277469-4277491 GTGGGTTTCCTAAAGAAATTTGG + Intergenic
1063297812 10:4825298-4825320 GTGGGTGTCCTCAAGGCAGTAGG + Intronic
1065145894 10:22767811-22767833 TTGGGTCACCAAAAGGAAGATGG - Intergenic
1065386895 10:25142921-25142943 AAGGGGTTCCAAAAGGAAGTAGG + Intergenic
1065547998 10:26841596-26841618 GTGGGTTACCAGGAGCAAGTGGG - Intronic
1066597117 10:37063087-37063109 GTGGGTTTCTAAAAAGCAGTTGG + Intergenic
1067443013 10:46322214-46322236 GTAAGTGTCCAAAAGGAAGGTGG + Intronic
1068907666 10:62344760-62344782 GTGGTTTTCCCAAAAGATGTTGG + Intergenic
1073535309 10:104271114-104271136 TTGGGTATTCAAAAGAAAGTAGG + Intronic
1073608591 10:104920967-104920989 CTGGGCTCCCATAAGGAAGTTGG - Intronic
1080148582 11:29020703-29020725 GTGTTTTTTCAAAAGGAAGTGGG - Intergenic
1080272287 11:30463370-30463392 GTGGATCCCCAAATGGAAGTTGG - Intronic
1081307390 11:41530233-41530255 GAGTGTTTCAAGAAGGAAGTAGG + Intergenic
1085892484 11:80597448-80597470 GTGGGTTTCTAAAAAGCAGTTGG - Intergenic
1086084441 11:82940211-82940233 GTGGGTATACAAATGAAAGTGGG + Intronic
1086686550 11:89740315-89740337 GTGTGTTTAGCAAAGGAAGTTGG - Intergenic
1087867589 11:103250497-103250519 GTGGGATTCCAAAAGTGAGGGGG - Intronic
1089403193 11:118176700-118176722 GTGGATTTCAAAAAGCAGGTGGG + Intergenic
1089637246 11:119822969-119822991 GAGTGTTTCCAGAAGGAAGGGGG + Intergenic
1092022126 12:5211386-5211408 GTGGATTTCAAGAAAGAAGTAGG - Intergenic
1093055246 12:14549603-14549625 GTGGGTTTCAAAAGGCAAATGGG - Intronic
1093278444 12:17158964-17158986 CTGGCATTCAAAAAGGAAGTTGG + Intergenic
1094109994 12:26852348-26852370 GCTGGTTTCCAAATGGAATTTGG + Intergenic
1096859609 12:54515774-54515796 GTGAAATTCTAAAAGGAAGTTGG + Intronic
1098457169 12:70687661-70687683 TTGGGTGACCTAAAGGAAGTAGG + Intronic
1100883113 12:99040115-99040137 TTGGGCTTCCATAATGAAGTAGG + Intronic
1101199996 12:102425592-102425614 TTGGGCTTCCAAAAGAAAGGAGG - Intronic
1102482607 12:113233976-113233998 TTTGTTTCCCAAAAGGAAGTTGG + Intronic
1103621045 12:122187545-122187567 CTGGGTTTTTAAAAGGGAGTCGG + Intronic
1108951717 13:56102570-56102592 GTTTGTGTCCAAAAAGAAGTAGG + Intergenic
1111469137 13:88653922-88653944 GGGGCATTCCAAAAGAAAGTAGG - Intergenic
1112912657 13:104507514-104507536 CTGGGTCTCCAAAAGGAGGAAGG - Intergenic
1117262113 14:54046424-54046446 GTGGATTTGCAAATGGGAGTTGG - Intergenic
1117513371 14:56475026-56475048 GTAGGTGTCCACAAGCAAGTAGG - Intergenic
1118022610 14:61733941-61733963 GGGGGTTTGAAAAAGGAAATGGG + Intronic
1121625907 14:95385279-95385301 GTGAGTTCCCCAAAGGAACTGGG - Intergenic
1125077693 15:35638731-35638753 GTGGGTGACCAAAAGGAGCTTGG + Intergenic
1127006920 15:54581193-54581215 GTGGGTTTTCAAGAAGATGTGGG + Intronic
1128356725 15:66933218-66933240 GTGGGATTCCAAAAGCCACTTGG + Intergenic
1128369591 15:67030656-67030678 GTGTGTTTCCAAAGGAAAGAGGG + Intergenic
1128550413 15:68594745-68594767 GTGTGCTTGCAGAAGGAAGTGGG + Intronic
1128713546 15:69890151-69890173 GCTGTTTTCCCAAAGGAAGTGGG - Intergenic
1129655123 15:77519024-77519046 GCTGGTTTCTAAAAGGAAATGGG - Intergenic
1131988516 15:98068631-98068653 GTGAGTCTCCAAGAGGAGGTTGG - Intergenic
1132279450 15:100600848-100600870 TTGGTTTTTCAGAAGGAAGTGGG - Intronic
1133407512 16:5537036-5537058 GTGAGTACTCAAAAGGAAGTGGG - Intergenic
1137846984 16:51699578-51699600 ATGGTTTTCAAAAAGGAAATGGG - Intergenic
1141466722 16:84210904-84210926 GGGGGGTTCCGAAAGGGAGTAGG + Intergenic
1143376507 17:6470574-6470596 GTGGGTTTTGAGAAGGAAGGAGG - Intronic
1143519201 17:7436095-7436117 GTGAGTTCCCAAAGGCAAGTAGG - Intronic
1144578172 17:16443027-16443049 CTGGGTCTCCATAAGGAGGTAGG + Intronic
1146673972 17:34760397-34760419 GTGGGTCCCCAAAAGGAAAAGGG + Intergenic
1149664648 17:58357445-58357467 GTGAGTTTTCAGAGGGAAGTGGG - Intronic
1149974018 17:61247999-61248021 GTGGGTTTACAAAAAGGAGTTGG + Intronic
1150436917 17:65161163-65161185 TTGGGATGGCAAAAGGAAGTGGG - Intronic
1150970485 17:70021555-70021577 GTGGGTTTCATCAAGGAAGGTGG - Intergenic
1151992470 17:77585141-77585163 TGGGGATTCCAAAAGGAGGTGGG - Intergenic
1153720475 18:7896549-7896571 ATGGGTCTCCATAAAGAAGTGGG + Intronic
1153930368 18:9873411-9873433 GTGGGTTTGCAGAAGGATGAGGG + Intergenic
1154160215 18:11975745-11975767 TGGGGATTCCAAAAGGAAGGAGG + Intergenic
1155007881 18:21745394-21745416 GTGGGTTGCCACAAGGAGGTGGG - Intronic
1155398541 18:25413675-25413697 GTGGTTTTCTTAAAGGAAATGGG + Intergenic
1158296939 18:56008624-56008646 GTGATTTTCCAAAAGGAAACAGG + Intergenic
1158862587 18:61607058-61607080 CTGGCATTCCCAAAGGAAGTGGG + Intergenic
1161634242 19:5377252-5377274 GTGGGTTGCAAAAAGGACTTGGG + Intergenic
1161759642 19:6161627-6161649 GGGGGTTTGCAAAGGGATGTGGG + Intronic
1164264562 19:23601877-23601899 GTAGGTTTTGATAAGGAAGTTGG + Intronic
1165317783 19:35067051-35067073 GTGGGAGTCCCAAAGGAAATAGG + Intergenic
1166171218 19:41028660-41028682 GTGGGTTTCCCTAAGGATCTGGG - Intergenic
1167052122 19:47085650-47085672 GTGGGGCTCTAAAAGGGAGTGGG + Intronic
925091997 2:1163524-1163546 GAGGCCTTCCAACAGGAAGTGGG + Intronic
926062398 2:9812584-9812606 GACGGTTTCCTAGAGGAAGTGGG + Intergenic
927508546 2:23630009-23630031 GGGAGTTTCCAGAAGGAAGAAGG + Intronic
927644013 2:24863892-24863914 GAGGGTTTCCAAAAGCAATGAGG + Intronic
928143234 2:28749242-28749264 ATGTGTTTCCTGAAGGAAGTTGG - Intergenic
928348523 2:30523213-30523235 GTGGGTGTATAAAAGGAAGTAGG + Intronic
928421016 2:31137993-31138015 CTGGGTAACCAAGAGGAAGTTGG - Exonic
930480333 2:51941121-51941143 GTGGCTATGCAAATGGAAGTTGG + Intergenic
930747384 2:54898648-54898670 GTGGCTTTCCAAAGAGAAATTGG - Intronic
932560427 2:72862914-72862936 CTGGGTTTCCAAAAATAAGGCGG + Intergenic
932751666 2:74375253-74375275 AAGGGTTTCCAAAAAGAACTAGG + Intronic
932967416 2:76492826-76492848 TTTTGTTACCAAAAGGAAGTAGG + Intergenic
933248114 2:79998500-79998522 GTGTGTTTCTAAAAGGTAGCCGG - Intronic
934608290 2:95714408-95714430 GTGGGATTCCAGAAGGAGTTGGG + Intergenic
938933524 2:136108633-136108655 GTAGGCTTGCCAAAGGAAGTGGG + Intergenic
940261070 2:151780251-151780273 GTGGCTTTCCAAAAGGGAGAGGG - Intergenic
941543908 2:166821277-166821299 GTGTGTTTGAAAAAGGAAGTGGG + Intergenic
1170123013 20:12931460-12931482 GTGTGTCTGCAAAAAGAAGTTGG - Intergenic
1170212207 20:13856664-13856686 CTGTCTTTCAAAAAGGAAGTTGG - Intronic
1172226629 20:33309726-33309748 CTGGGTTTCCACAAGGAGGCTGG - Exonic
1173723784 20:45282699-45282721 GTGGGTTTCCAAGAAGAAAGTGG - Intergenic
1173853286 20:46232555-46232577 GTGGGGTGGCAAAAGGAGGTAGG - Intronic
1178994400 21:37385472-37385494 CTGGCTTTGCAAAAGTAAGTGGG - Intronic
1179146949 21:38776355-38776377 GAGGGCTTCCCAGAGGAAGTGGG + Intergenic
1180857830 22:19059440-19059462 GGGGGTGTCCAGGAGGAAGTGGG - Intronic
1180929590 22:19579827-19579849 GTGTGTTTTCATAATGAAGTTGG - Intergenic
1182268859 22:29140219-29140241 GTTGGTTTTCGAAAGGAGGTCGG - Intronic
949412355 3:3779738-3779760 GTGTATTTCCACAAGGAAGAGGG + Intronic
950471233 3:13187817-13187839 GTGGCTCTCCATAAGGAGGTGGG - Intergenic
952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG + Intronic
955105769 3:55896200-55896222 AAGGGTTTCCACAGGGAAGTTGG + Intronic
957180537 3:76871754-76871776 GTGGGTTTCCATGAAAAAGTTGG - Intronic
957221912 3:77393320-77393342 GTGTTTTTCCAAAAGAAAATAGG - Intronic
961397588 3:126606958-126606980 GAGGTTTTCCAAAAGGACCTTGG + Intronic
967198734 3:187052264-187052286 GTGGGCTTCAAATAGAAAGTGGG - Intronic
967757534 3:193186907-193186929 CTGGGTTCTCAAAAGAAAGTCGG - Intergenic
968943611 4:3652241-3652263 GTCATTTTCCAAAAGCAAGTGGG - Intergenic
969016176 4:4105895-4105917 GTGGATTGACAAAAGGTAGTGGG - Intergenic
973006329 4:45011172-45011194 TTTGGTTTCCAAAAGGAAGTTGG + Intergenic
973633183 4:52838604-52838626 GGTGGGTTCCAAAAGGAAATGGG - Intergenic
977856151 4:101896802-101896824 ATGTGCTTCAAAAAGGAAGTGGG + Intronic
978324052 4:107531406-107531428 ATGGATTTCCAAAAGAAAGTGGG - Intergenic
979400789 4:120247038-120247060 GTGGATTTGCAGAAGGAAGAGGG + Intergenic
979642446 4:123024775-123024797 GTGGATTTCTAAAAGACAGTAGG + Intronic
979901278 4:126221582-126221604 GTAAGCTTCCAGAAGGAAGTAGG - Intergenic
980105323 4:128582948-128582970 GTTGGTTTCCAGAAGACAGTAGG - Intergenic
982705732 4:158706971-158706993 GTATGTTTCCTAAAGGAAGCTGG - Intronic
985020866 4:185688689-185688711 CTGTGTTTACAAAATGAAGTAGG - Intronic
986074370 5:4319478-4319500 GTGGGTTGCCAAAGGCCAGTGGG + Intergenic
987943424 5:24572309-24572331 GTCTGTTTTAAAAAGGAAGTGGG - Intronic
993255901 5:85589711-85589733 TTGGGATTCCAAAACTAAGTTGG - Intergenic
993951843 5:94185465-94185487 GTGGGTATCTAAAAACAAGTGGG - Intronic
994245898 5:97475970-97475992 GTGTATTTCCAAATGGTAGTTGG + Intergenic
995900595 5:117061305-117061327 GTGGGCTTACACAAGGAAGCTGG - Intergenic
996799191 5:127384048-127384070 GAAGGTTTCCCAGAGGAAGTAGG - Intronic
1000167760 5:158671757-158671779 GAGTGTTACCAAAAAGAAGTTGG + Intergenic
1007071280 6:39040169-39040191 GGGGGGTTCCTAAGGGAAGTGGG - Intergenic
1008059047 6:46977531-46977553 GTGGCTTTCCAATAGGACGTTGG - Intergenic
1009919361 6:70038459-70038481 GTTGGATTTCAAATGGAAGTTGG - Intronic
1011194963 6:84772036-84772058 ATGGGTTTCCAGAAAGACGTGGG + Intergenic
1017517447 6:155169755-155169777 GTGGGTTTGAAAAAGGCACTAGG - Intronic
1018203089 6:161413195-161413217 GTGGGTTTCCACAAATAAATGGG - Intronic
1020966379 7:14874866-14874888 GTTGGTTTTCCAAAAGAAGTAGG + Intronic
1024134574 7:46393223-46393245 GTGGGTTTTCAGAAGGAGCTTGG - Intergenic
1024632246 7:51259485-51259507 GTGGGTTTCCTCAAGGAGATGGG - Intronic
1026580416 7:71611510-71611532 GAGAGATTCCTAAAGGAAGTGGG - Intronic
1029307612 7:99631990-99632012 GTGGTTTTCCAAAGGCAGGTGGG + Exonic
1031818032 7:126463691-126463713 CAGCATTTCCAAAAGGAAGTTGG + Intronic
1032748517 7:134812483-134812505 GAGTGTTTACACAAGGAAGTAGG + Intronic
1032876008 7:136038918-136038940 GTAGTTCTCCAAAATGAAGTTGG - Intergenic
1036567842 8:9952756-9952778 GTGGGTTTCCTAACAGAGGTTGG + Intergenic
1037951448 8:23020909-23020931 GTGGGATGCCAGATGGAAGTGGG + Exonic
1042083995 8:65088374-65088396 GTGAGTTTCCAGAAGCAAGAAGG + Intergenic
1042246811 8:66716399-66716421 GAGGGTTTTCAAAGGGAATTAGG + Intronic
1045410033 8:101907937-101907959 CTGGGATTCCACAAGGGAGTAGG + Intronic
1045624907 8:104033768-104033790 GTTTGTTTCTAAAAGGAAATTGG + Intronic
1048460369 8:134616331-134616353 TTTGGTGTCCAAAAGGGAGTGGG - Intronic
1048643439 8:136390063-136390085 ATGAGTTTTCAAAAGGAAATCGG - Intergenic
1050666029 9:7937534-7937556 TTGGTTTTGCAAAAGCAAGTGGG + Intergenic
1053754035 9:41285036-41285058 ATTGGTTTACAAAAGGAAGTTGG + Intergenic
1054259554 9:62849398-62849420 ATTGGTTTACAAAGGGAAGTTGG + Intergenic
1054332219 9:63770640-63770662 ATTGGTTTACAAAAGGAAGTTGG - Intergenic
1055262399 9:74452606-74452628 GTGGTTTCCCAAAAGAAATTTGG + Intergenic
1055471703 9:76618309-76618331 GTTGAGGTCCAAAAGGAAGTTGG - Intronic
1055658142 9:78472921-78472943 GAGGATTTCCAGAAGGAAGGTGG + Intergenic
1055891535 9:81129354-81129376 GTGCTTTTCCAAAAAGGAGTTGG - Intergenic
1062050814 9:134446038-134446060 GTTGGTTTCCATAAGGACTTAGG - Intergenic
1062325199 9:136009520-136009542 GTTGCTTTCCAGAAGGAGGTGGG - Exonic
1186044605 X:5521489-5521511 TGGGGATTCCAAAAGGAGGTGGG + Intergenic
1186721972 X:12314340-12314362 GCGGGCTTCCTGAAGGAAGTGGG + Intronic
1186800787 X:13090520-13090542 GTTGGCTTCCAAAGGGTAGTTGG + Intergenic
1186920443 X:14273219-14273241 TTTGGTATTCAAAAGGAAGTTGG + Intergenic
1188965535 X:36546393-36546415 GTGGGTTCACAAAATGGAGTGGG - Intergenic
1190107942 X:47572640-47572662 GTGGGGTTCTAAAAGGACTTGGG + Exonic
1193630420 X:83879510-83879532 GTGTGTTTTCACAAGCAAGTTGG - Intronic
1193904731 X:87227886-87227908 ATGGTTTTACAAAAAGAAGTAGG - Intergenic
1193928461 X:87521303-87521325 GTTGCTATCCAAAAGAAAGTAGG + Intronic
1195409218 X:104550827-104550849 GCTGGGTACCAAAAGGAAGTAGG + Intergenic
1195959814 X:110374656-110374678 GAAGGTTTCATAAAGGAAGTAGG + Intronic
1197815493 X:130493983-130494005 GGGGTTTTCTAAAAGGAAGAGGG + Intergenic
1198024573 X:132692679-132692701 GTGGGTTTTCAAAGAGAAGCAGG - Intronic
1198026922 X:132715974-132715996 CTTGGTTTCCAAAATGCAGTCGG - Intronic
1199903919 X:152206025-152206047 GCGGTTTACCAAAATGAAGTGGG + Intronic