ID: 915342368

View in Genome Browser
Species Human (GRCh38)
Location 1:155183719-155183741
Sequence TACCAGAGGGAGACGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915342368 Original CRISPR TACCAGAGGGAGACGCTGGA AGG (reversed) Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901428060 1:9196079-9196101 TCCCAAAGGGAAAGGCTGGAGGG + Intergenic
901969445 1:12895647-12895669 TCCCAGAGGGAGGCGGAGGAAGG + Exonic
902015727 1:13306133-13306155 TCCCAGAGGGAGGCGGAGGAAGG - Intronic
902026759 1:13389836-13389858 TCCCAGAGGGAGGCGGAGGAAGG - Exonic
902040089 1:13486204-13486226 AGACAGAGGGAGAGGCTGGAGGG - Intronic
902347219 1:15827242-15827264 TATCAAAGGGAGACGCTGGTGGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903335188 1:22619854-22619876 TGCCAGAGGGAGAGGAAGGAAGG + Intergenic
903363347 1:22790887-22790909 GACAAGAGGGAGAGGCTGGGAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904599704 1:31666672-31666694 TTCCAGAGGGAGAGGCTGGGTGG - Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906882765 1:49610550-49610572 TAAGAGATGGAGACACTGGAAGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908957277 1:69648492-69648514 AACCAGTGGGAGACACTGGTTGG + Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910629290 1:89339734-89339756 TACCAGTGGATGACCCTGGATGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915342368 1:155183719-155183741 TACCAGAGGGAGACGCTGGAAGG - Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917596557 1:176535024-176535046 AACCAGAGGGAGACTGTAGAAGG + Intronic
919006270 1:191902723-191902745 TCCCAGAGGAAGAGGCTGGCAGG + Intergenic
920017406 1:202924412-202924434 TACCAGAGGGATAAGGAGGAAGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063957908 10:11283138-11283160 TAGGAGAGGGACAGGCTGGAAGG + Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069729275 10:70600630-70600652 CGCCAGAGGCAGGCGCTGGAGGG + Exonic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073048387 10:100653324-100653346 TCACAGGGGGAGACGCTGGATGG + Intergenic
1074108355 10:110405090-110405112 TACCAGATGGGGAAGTTGGATGG - Intergenic
1078001192 11:7497465-7497487 TTCCAGAAGGAGGCACTGGAAGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078254503 11:9646394-9646416 TCCCAGAGGGAGAGGATGAATGG + Intergenic
1079010777 11:16826402-16826424 TCCCAGAGGGACCCACTGGAGGG - Exonic
1079136250 11:17777352-17777374 TCCCAGAAGGAGACGCTGCCTGG + Intronic
1080096476 11:28414361-28414383 TAACAGAGGGAGGCACTGGCAGG - Intergenic
1080660353 11:34291286-34291308 TCCCAGTGGGAGAGGCTGGCTGG - Intronic
1081589107 11:44408539-44408561 CAGCATAGGTAGACGCTGGAGGG + Intergenic
1082668988 11:56010512-56010534 TACTGGAGGGAGAGGCTGGGAGG + Intergenic
1083847141 11:65342424-65342446 TAACAGAGGGAGACCCTGTCTGG + Intronic
1085175922 11:74488142-74488164 TTCCAGAGGGAAACTCTGAAGGG + Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087493222 11:98854882-98854904 TACCAGAAGGAGAAGATAGAAGG + Intergenic
1089965586 11:122652586-122652608 GGCCAGAGGGAGACCCAGGATGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091288233 11:134421073-134421095 CACCAGAGGGAGAGGCAGGGAGG - Intergenic
1091304576 11:134529467-134529489 GACCAGAGGAAGCCGCTGGTAGG - Intergenic
1091341891 11:134822358-134822380 TACTAGAGGGAGGGGCTGGCAGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092722422 12:11454930-11454952 TATCAGAGGGTGAAGGTGGAAGG + Intronic
1092751270 12:11721571-11721593 TACTAGAGGGAGGAGCGGGAGGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092880560 12:12884819-12884841 GACCAAGGGGAGAGGCTGGAAGG + Intergenic
1093157707 12:15707599-15707621 TACCAGAGGAAGACTTCGGAAGG - Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1095336642 12:41036295-41036317 TACCCCAGGGAGATGCAGGAGGG + Intronic
1096217051 12:49803582-49803604 CACAAGAGGAAGAGGCTGGATGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1099369395 12:81811629-81811651 GACCAGAGGGAGCCCCTGGGGGG + Intergenic
1100044091 12:90357249-90357271 TACCAGAGGGAAATTCTGAAGGG + Intergenic
1100822483 12:98444344-98444366 TCCAAGAGGGAGAGGCTGGCTGG + Intergenic
1102080249 12:110091969-110091991 AACCAGAGGGAAATGATGGAGGG + Intergenic
1102168699 12:110825772-110825794 TACCAGAGGGAAAAGAGGGAGGG + Intergenic
1102990755 12:117314063-117314085 GCTCAGAGGGAGCCGCTGGAGGG - Intronic
1103342582 12:120228982-120229004 AACCGGTGGGAGCCGCTGGAGGG + Intronic
1103922311 12:124405366-124405388 AACCAGAGGGTGAGGGTGGAAGG - Intronic
1104769026 12:131348914-131348936 TACCAGAGGCTGACATTGGAGGG + Intergenic
1105469232 13:20677167-20677189 GAGGAGAGGGAGACTCTGGAGGG - Intronic
1105795163 13:23844207-23844229 TACCAGAGGGAGGGGTGGGAAGG + Intronic
1109209149 13:59514526-59514548 CTCCAGATGGAGACTCTGGATGG + Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1114444568 14:22778401-22778423 TATCAGAGGGAAACACAGGAAGG + Intronic
1115239845 14:31243302-31243324 TACCAGAGGGGGAAGGTAGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1118391492 14:65299518-65299540 TACGAGAGTGAGAGGCTGGGTGG - Intergenic
1119095706 14:71828762-71828784 AACCAGAGAGAGAGGCTGCAAGG + Intergenic
1122273460 14:100578833-100578855 TACCAGAGGCAGATGATGCAAGG - Intronic
1122407435 14:101508827-101508849 TCCCAGATGGGGACGCTGGGTGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1124599296 15:31118315-31118337 TACCAGAGGGAGAAGAAAGAGGG + Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128675079 15:69602600-69602622 TAGCAGAGAGAGAGGGTGGAGGG - Intergenic
1132862518 16:2078600-2078622 TGCCTGAGGGTGACGGTGGAAGG + Intronic
1136022638 16:27449753-27449775 TCCTGGAGGCAGACGCTGGAGGG - Exonic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136746968 16:32598978-32599000 TTCCAGAGGCAGAAGCTGGCAGG - Intergenic
1139482706 16:67239366-67239388 GAGCAGCGGGAGATGCTGGAGGG - Exonic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1203049098 16_KI270728v1_random:858182-858204 TTCCAGAGGCAGAAGCTGGCAGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143524945 17:7466444-7466466 AAGCAGGGGGAGAGGCTGGAGGG + Exonic
1143900885 17:10173911-10173933 GAGCACAGGGAGACGGTGGAGGG + Intronic
1144638472 17:16925287-16925309 CCCCAGAGGGAGACTCCGGAGGG + Intergenic
1145777407 17:27539020-27539042 TTCCCTAGGGAGACTCTGGAAGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1151774459 17:76189957-76189979 TGCCAGTGGGAGGTGCTGGAAGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1154111114 18:11569318-11569340 TACCAGTGGGAGATGGTGGAAGG - Intergenic
1157110839 18:44818825-44818847 TCACAGAGGGAGATGGTGGAAGG - Intronic
1157589047 18:48825192-48825214 AACCAGAGGGAGAGGTTGGTGGG - Intronic
1158253850 18:55522191-55522213 TACCAATAGGAGGCGCTGGAGGG - Intronic
1160032126 18:75271296-75271318 TATCCGAAGGAGAGGCTGGAGGG - Intronic
1160369691 18:78361989-78362011 TCCCAGACGGAGAGGCAGGAGGG - Intergenic
1161112802 19:2479290-2479312 TCCCAGAGGGAGAAGCGGGGAGG + Intergenic
1161581601 19:5083704-5083726 AACCAGAGGGAGACGCCGGGAGG - Intronic
1161884350 19:6982280-6982302 TACTAGAGGGAGAGGGTGGGAGG + Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1165100290 19:33435038-33435060 TGCCAGAGGAAGACGAGGGATGG + Intronic
1166130080 19:40740751-40740773 TACGAGAGGCAGTTGCTGGACGG + Exonic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929872059 2:45767438-45767460 TACAAGAGGAAGAGGCAGGAAGG - Intronic
933577224 2:84082920-84082942 TGCCATAGGGAGACACTGGATGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935661076 2:105467539-105467561 TTCCAGAGGGAGGGACTGGATGG + Intergenic
937154670 2:119710534-119710556 TGTCAGAGGGAGAGGCTTGAGGG + Intergenic
937216940 2:120318818-120318840 TACCAGAGGGAGAGGCAAGGTGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941338684 2:164277991-164278013 TACCAGAGACAGAGGATGGATGG - Intergenic
943547478 2:189298674-189298696 TACCAGAAGGAGAAACTGGCTGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1170770960 20:19332151-19332173 TAGCAGAGGGAGTCCATGGAAGG + Intronic
1172518962 20:35555081-35555103 TACCAGATGGAAACCATGGAGGG + Intronic
1173604896 20:44324858-44324880 GACCAGAGGAGGAAGCTGGAGGG - Intergenic
1178973775 21:37204707-37204729 TATCAGAAGGAGAAGCTGGGAGG + Intergenic
1179278961 21:39917467-39917489 TGGTAGAGGGAGAAGCTGGAAGG + Intronic
1180139603 21:45885257-45885279 TACAGGAGGGAGACAATGGATGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181947284 22:26528110-26528132 TACCCCAGGGAGGCTCTGGAAGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183620301 22:38968205-38968227 AACCAGAAGGAGCCCCTGGAGGG - Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184523951 22:45010366-45010388 TATCAGAGGGAGGCGGAGGAGGG - Intergenic
950435499 3:12976921-12976943 TACCATAGAGAGATTCTGGAAGG + Intronic
953827855 3:46269583-46269605 CACCAGAGGGTGAGGATGGATGG - Intergenic
953982280 3:47418778-47418800 AACCCGAGGGAGGCTCTGGAGGG - Exonic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
955212626 3:56955959-56955981 TACCAGAGGGAGACAGTTCAGGG - Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960662786 3:120079186-120079208 TCCCAGAGGGAGACTGAGGAGGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964948438 3:162256170-162256192 TACCAGAAGGAGGGGTTGGAAGG - Intergenic
965163909 3:165169982-165170004 TACCAGAGGGAGTTGTTGAAGGG + Intergenic
966750048 3:183313324-183313346 TAGCAGAAGGAGACACTGGAGGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968051272 3:195656676-195656698 TCCCGGAGGGAGAGGGTGGAGGG + Intergenic
968104552 3:195991663-195991685 TCCCGGAGGGAGAGGGTGGAGGG - Intergenic
968121789 3:196130999-196131021 GACCAGAGGCAGACGTTGGAGGG - Intergenic
968302843 3:197629246-197629268 TCCCGGAGGGAGAGGGTGGAGGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968654132 4:1771415-1771437 CACCAGAGTGAGAAACTGGAGGG + Intergenic
970320183 4:14867800-14867822 TACTAGAGGGAGAAGGTGGAAGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971098632 4:23436819-23436841 TATCATTGGGAGAGGCTGGAAGG + Intergenic
972279697 4:37590306-37590328 TCCCACAGGGGGACGCTGGAGGG + Exonic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973657493 4:53064268-53064290 TACTAGAGGGGGAGGGTGGAAGG - Intronic
973980356 4:56303689-56303711 TACCACAGGGAGAGCCTGTAGGG + Intronic
974085572 4:57257039-57257061 TATCAGAGGTAGACGGTGGTAGG - Intergenic
975126307 4:70786232-70786254 TACCAGAGGGAGAGGAGGCAGGG + Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979312426 4:119219375-119219397 TGACAGAGGCAGAGGCTGGAAGG - Intronic
980076830 4:128302854-128302876 TACCTGAGGGATGCTCTGGAAGG - Intergenic
980282700 4:130741034-130741056 TACCAGAGGTTGAGGGTGGAGGG - Intergenic
981505522 4:145495117-145495139 AATTGGAGGGAGACGCTGGAGGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982893851 4:160891728-160891750 TACTAGAGGGAGAGGAAGGAAGG + Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985507954 5:295308-295330 TCCCAGAGGGAGAGAGTGGAGGG + Intronic
985740081 5:1610360-1610382 TCCCAGAGGGAGAGAGTGGAGGG - Intergenic
986012797 5:3731827-3731849 TAGCACGGGGTGACGCTGGAAGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992843807 5:80724051-80724073 TTCCAGAAGGAAACGCTGGCCGG - Intronic
992894190 5:81232866-81232888 TCCCAGACAAAGACGCTGGAAGG + Intergenic
996437198 5:123447786-123447808 TATCATTGGGAGAAGCTGGATGG - Intergenic
998046200 5:138989051-138989073 TAGCAAAGGGACACGGTGGAAGG + Intronic
999178138 5:149646665-149646687 TAGCAGAGGGAGATGCTACAGGG - Intergenic
999220444 5:149971928-149971950 TACCTGAGGGGGATTCTGGAGGG - Intronic
1001309273 5:170599090-170599112 AACCAGAGGCAGAGACTGGAAGG + Intronic
1001574751 5:172755954-172755976 TACAAGAGGGAGAGGGAGGAAGG + Intergenic
1001986439 5:176077362-176077384 TTCCAGAGGCAGAAGCTGGCAGG - Intronic
1002230428 5:177760763-177760785 TTCCAGAGGCAGAAGCTGGCAGG + Intronic
1002264908 5:178022984-178023006 TTCCAGAGGCAGAAGCTGGCAGG - Intronic
1003024464 6:2541947-2541969 AACCAGAGGGAGATGGGGGAAGG + Intergenic
1005360521 6:25027341-25027363 TCCCAGGGGGAGGCGCTCGAGGG + Intronic
1006082851 6:31577364-31577386 TGCCAGAGGGAGACCCCAGAGGG + Exonic
1006155764 6:32012035-32012057 TACCAGGGAGAGAGGATGGATGG - Intergenic
1006162095 6:32044889-32044911 TACCAGGGAGAGAGGATGGATGG - Intronic
1006832308 6:36976366-36976388 TAACAGAGGGAGCCAGTGGAAGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009404285 6:63292929-63292951 TACCAGAGTGGGACGTTAGAGGG - Intronic
1011253826 6:85401416-85401438 TACCAGATGCAGACTCAGGAAGG + Intergenic
1011904102 6:92339377-92339399 GACCAGTGGGAGAGGCTGGCAGG + Intergenic
1018865783 6:167746167-167746189 GCCCAGAGGGAGAGGCAGGAGGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019937993 7:4268822-4268844 AACCAGAAGGTGACGCGGGAAGG - Exonic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022342975 7:29486124-29486146 TACCAGAGGGAAACTCCCGATGG + Intronic
1024843145 7:53610968-53610990 GTCCAGAGGGAAATGCTGGAAGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1028846423 7:95485953-95485975 TTCCAGAGGGAGAGGAAGGATGG + Exonic
1030165865 7:106554305-106554327 TACCAGAAAGAGAAGCTGGTAGG + Intergenic
1031894765 7:127336444-127336466 TAGCAGAAGCAGAGGCTGGAGGG - Intergenic
1032761352 7:134946488-134946510 TACCAGAGGCAGAGGGTGGGCGG - Intronic
1032776976 7:135123425-135123447 TACCTGAGGGAGACGGAGAATGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033825765 7:145187131-145187153 TGACAGAGGGAGACCCTGGAAGG - Intergenic
1034471040 7:151254474-151254496 TTCCAGAGGCAGAGGTTGGAGGG - Intronic
1034537281 7:151733303-151733325 TTCCAGAGGAAGGCTCTGGAGGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035022299 7:155806904-155806926 TCCCAGAGGGTGCCCCTGGAGGG - Intronic
1036052995 8:5221019-5221041 TCACAGAGGGAGATGCTGAAGGG + Intergenic
1037648433 8:20815140-20815162 TTCCAGTGGGAGACTCTGGAGGG - Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038615508 8:29090233-29090255 TTTCAGTGGGAGACACTGGAAGG + Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041520668 8:58752452-58752474 CACCAGAAGGAGATACTGGAGGG - Intergenic
1043781792 8:84345625-84345647 AATGAGAGGGAGATGCTGGAGGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047452083 8:124973633-124973655 TACAAGTTGGAGACGCTGGGGGG - Intronic
1049138493 8:140928768-140928790 TTCCAGAGGATGAGGCTGGAAGG + Intronic
1049536601 8:143185531-143185553 AACCAGAGGGAGATGTTGGCTGG - Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051428605 9:16959871-16959893 AAACAGAGGGAGAAGCAGGAGGG - Intergenic
1052986828 9:34493991-34494013 CGCCACAGGGAGACGCTGAAGGG + Intronic
1055496892 9:76864290-76864312 TACCAGAGGGGGTAGCAGGAAGG + Intronic
1056813142 9:89779981-89780003 TCCCACAGGGAGACTCTGGTGGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189299769 X:39944047-39944069 TTCTAGAAGGAGACACTGGAGGG + Intergenic
1189427164 X:40911891-40911913 AACCAGAGTGAGACTCTGAAAGG + Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191182283 X:57576437-57576459 TACTAGAGGGGGACGGGGGAGGG + Intergenic
1191215279 X:57927072-57927094 TACTAGAGGGGGACGGGGGAGGG - Intergenic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192751827 X:74000009-74000031 TACCAGATGGAGAAGATAGAGGG + Intergenic
1198219828 X:134589056-134589078 CACCAGTGGGAGAAACTGGAGGG - Intronic
1199313902 X:146354489-146354511 AACCAGAGGGAGATCCTGTAAGG + Intergenic
1199403342 X:147426483-147426505 TACCAGTAGAAGACGCTGGGGGG - Intergenic
1200014890 X:153152432-153152454 TGACAGAGGGAGAAGCTGGCAGG + Intergenic
1200897437 Y:8390615-8390637 TATCAGAAGGAGATCCTGGATGG + Intergenic
1201076720 Y:10195245-10195267 CACCTGAGGGATAAGCTGGAGGG - Intergenic