ID: 915346707

View in Genome Browser
Species Human (GRCh38)
Location 1:155201249-155201271
Sequence CAGGGAAAATATAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 526}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915346707_915346717 14 Left 915346707 1:155201249-155201271 CCCTCCTCCCTATATTTTCCCTG 0: 1
1: 0
2: 1
3: 54
4: 526
Right 915346717 1:155201286-155201308 CTCCCCACCAAACAGTTCCTGGG 0: 1
1: 0
2: 2
3: 31
4: 156
915346707_915346716 13 Left 915346707 1:155201249-155201271 CCCTCCTCCCTATATTTTCCCTG 0: 1
1: 0
2: 1
3: 54
4: 526
Right 915346716 1:155201285-155201307 TCTCCCCACCAAACAGTTCCTGG 0: 1
1: 0
2: 2
3: 16
4: 167
915346707_915346721 20 Left 915346707 1:155201249-155201271 CCCTCCTCCCTATATTTTCCCTG 0: 1
1: 0
2: 1
3: 54
4: 526
Right 915346721 1:155201292-155201314 ACCAAACAGTTCCTGGGCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915346707 Original CRISPR CAGGGAAAATATAGGGAGGA GGG (reversed) Intronic
900613688 1:3554955-3554977 CAGGGAAAAGACAGGGCGGCTGG + Intronic
900993305 1:6107675-6107697 GAGGGATAATATAGGGATGGAGG + Intronic
901057934 1:6457494-6457516 CTGGGGTATTATAGGGAGGAAGG - Intronic
901765740 1:11498983-11499005 CAGGCAAAATCTAGTGAGGATGG + Intronic
902476419 1:16690969-16690991 CTGGGATATTATAGGGAGGAAGG + Intergenic
902818770 1:18930814-18930836 CTGGGCAAATATAGACAGGAGGG - Intronic
902831144 1:19013640-19013662 CAAGAAAAATATATCGAGGAAGG - Intergenic
902971193 1:20052538-20052560 AAGAGAAAATACGGGGAGGAAGG - Intronic
903538058 1:24080425-24080447 CAGGGAAGCTACCGGGAGGAGGG - Intronic
904198918 1:28806508-28806530 CAGGGATTATAAAGGAAGGATGG + Intergenic
905592072 1:39172914-39172936 CAAGGACAAAAAAGGGAGGAGGG - Intronic
905898309 1:41563439-41563461 CAGGAAAAAGTCAGGGAGGAGGG - Intronic
906232250 1:44173753-44173775 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
906701157 1:47859209-47859231 CAGGAAAAAGAAAGGAAGGATGG - Intronic
908365166 1:63414866-63414888 GAGGGAATATCTAGGGGGGAAGG + Intronic
909164651 1:72204316-72204338 GAGGGAAAAAATGGTGAGGAAGG - Intronic
909480545 1:76125269-76125291 CAGGGAACAGGTAAGGAGGAGGG - Intronic
910554641 1:88517763-88517785 GAGAGAAAAAATAGGAAGGAAGG + Intergenic
910891432 1:92024436-92024458 GAGGGAGAAGAGAGGGAGGAGGG + Intergenic
911311634 1:96299853-96299875 AAGGGAAAAAATAGAGAGAATGG - Intergenic
911403876 1:97411381-97411403 GAGGGAAATTGTAGTGAGGATGG - Intronic
911449902 1:98049149-98049171 GAGAGAAAAAATCGGGAGGAGGG + Intergenic
911627821 1:100145997-100146019 CAGGGAATGTAAAGAGAGGAAGG - Intronic
912022603 1:105123754-105123776 CAATGAAAATATAGAGAAGATGG + Intergenic
912385122 1:109267654-109267676 CAGGGAAAAGATGGAGATGAGGG - Intronic
912981309 1:114375844-114375866 AAGAGAAAATAAGGGGAGGAAGG - Intergenic
915046409 1:153021077-153021099 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915367069 1:155322648-155322670 CAGGGAAAATTGATGGAGGATGG + Exonic
917621114 1:176796904-176796926 AAAAGAAAATAGAGGGAGGAAGG - Intronic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920574638 1:207050644-207050666 CAGGGAAAGTCCCGGGAGGATGG - Intronic
920713406 1:208316843-208316865 GAGGGAAAATATGGGGAAGATGG + Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920915899 1:210257764-210257786 CAGGGAAAATACTGGCAGGAAGG + Intergenic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
920983615 1:210862902-210862924 CAGGGAATCTGTAGGGAAGAAGG - Intronic
921599110 1:217088755-217088777 AAGGGAAAAGAAAGGGAGGAGGG + Intronic
921926764 1:220717145-220717167 AAGAGAAAATAAGGGGAGGAAGG - Intergenic
922030151 1:221789887-221789909 CAGAGGAAATGTGGGGAGGAGGG + Intergenic
1062778626 10:179277-179299 CAGGAAAATTATTGGGAGGTGGG + Intronic
1063649252 10:7917229-7917251 GAGGGAAAAGAGAGCGAGGATGG + Intronic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065438575 10:25726467-25726489 GTGGGAAAATAAAGGGAGGGAGG - Intergenic
1065638289 10:27753194-27753216 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638307 10:27753272-27753294 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638317 10:27753311-27753333 GAGGGAAAAGAGAGAGAGGAAGG - Intergenic
1066275617 10:33865639-33865661 CAGGGAAAAGAAAGGAAGGAAGG - Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1067040762 10:42952034-42952056 CTGGGACTATTTAGGGAGGAGGG + Intergenic
1067460406 10:46454056-46454078 AAGGGAAGAGAGAGGGAGGATGG + Intergenic
1067626786 10:47930547-47930569 AAGGGAAGAGAGAGGGAGGATGG - Intergenic
1069250943 10:66266064-66266086 AAGGGAAAAGAGAGAGAGGAAGG + Intronic
1069327168 10:67245330-67245352 CAGAGAAAATAAAGCAAGGAAGG - Intronic
1070165382 10:73893675-73893697 CAGGGAAAGTATAAGGAGCAAGG - Intergenic
1070325957 10:75389302-75389324 CTGGGAAACTAGAGGGAGTAAGG - Intergenic
1071024559 10:81097465-81097487 GAGGGAAAGAATAAGGAGGAAGG - Intergenic
1071431882 10:85612928-85612950 CAGGAGGAATATAGGGAGAAAGG + Intronic
1071848041 10:89540021-89540043 CAGAGAAAAGAAAGGAAGGAAGG - Intronic
1071941850 10:90599372-90599394 GATAGAAAATATATGGAGGAGGG - Intergenic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072522016 10:96237382-96237404 CAGAGCAAATATAGGGTGGAGGG - Intronic
1072543267 10:96414451-96414473 CAGGGAGAAGACAGTGAGGAGGG - Intronic
1072805163 10:98419384-98419406 AAGGGAAAAGACAGAGAGGAGGG + Intronic
1073643444 10:105276042-105276064 CAAGGAAAATACATGGAGCATGG - Intergenic
1074323887 10:112429458-112429480 CAGGTAAAATATATGTAAGATGG - Intergenic
1074649184 10:115500055-115500077 AAGAGAAAATAGGGGGAGGAAGG + Intronic
1074707878 10:116151597-116151619 ATGGGAAAATAGAGGGAAGAGGG + Intronic
1074813777 10:117129854-117129876 CAGGAAAAAAAAAGGAAGGAGGG + Intronic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075145490 10:119879444-119879466 TAGGCAAAAAATAGGGAAGATGG + Intronic
1076181509 10:128412587-128412609 CAGGGAAAAGCCAGGGAGGGTGG - Intergenic
1076370527 10:129949976-129949998 AGAGGAAAATATAGGCAGGAGGG + Intronic
1077783832 11:5361179-5361201 AAAAGAAAATGTAGGGAGGATGG - Intronic
1078153394 11:8777838-8777860 CAGGTAGATTACAGGGAGGATGG - Intronic
1078758300 11:14232217-14232239 CGGGGAAAATATAGCCGGGAAGG - Intronic
1078944373 11:16047047-16047069 TGGGGAAATTATGGGGAGGAAGG + Intronic
1079496034 11:21045088-21045110 CAGGGCAAGTAAAGGCAGGAGGG + Intronic
1081612276 11:44569690-44569712 CAAGGTAAAAATAGGGAGGTAGG - Intronic
1082105638 11:48218251-48218273 CAGGGAATATTTAGGAAGGAGGG + Intergenic
1084164003 11:67366751-67366773 CAGGGAAAGAAAAGGGAGGAGGG - Intronic
1084695397 11:70750606-70750628 CAGGGAGACTGTAGTGAGGAGGG + Intronic
1085202419 11:74709670-74709692 CACTGAAAAGATAGGGAGGCAGG + Intronic
1085660892 11:78365642-78365664 CAGGGAAAATTCTGGGAGGTAGG + Intronic
1085821685 11:79800763-79800785 TGGGGGAAATCTAGGGAGGAGGG - Intergenic
1086083781 11:82934002-82934024 CAGGGAAATGATAGGCAGCAAGG - Exonic
1086855926 11:91865774-91865796 CAGGGAAAGTGAAGGGAGGAGGG + Intergenic
1087047414 11:93853683-93853705 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
1087078918 11:94151223-94151245 GAAGGAAAATAGAGAGAGGAGGG - Intronic
1087390478 11:97524653-97524675 CAGGAAAGATATAGGAATGAAGG + Intergenic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1088904289 11:114142719-114142741 AAGGGAGGATGTAGGGAGGATGG + Intronic
1089303223 11:117511158-117511180 TAGGGAAAAATTAGGGAGGGAGG + Intronic
1089303444 11:117512452-117512474 CAGGGAAAAAATGGGGATGAGGG + Intronic
1089569241 11:119392137-119392159 CAGGGAAAAGGGTGGGAGGAAGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090505267 11:127304977-127304999 CGGGCAAAATTTAGGGAGGGAGG + Intergenic
1091021514 11:132104334-132104356 GGGGGAAAATGGAGGGAGGAAGG - Intronic
1091386062 12:95570-95592 CAGGGAAAAAACATGGAGGTAGG - Intronic
1091392652 12:135235-135257 AAGGGGAAATGTAGAGAGGAAGG - Intronic
1091831820 12:3555491-3555513 CAGGGATCAGAGAGGGAGGAGGG + Intronic
1092173939 12:6390353-6390375 CAGGGAGAAGAGAGGAAGGATGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092671579 12:10867802-10867824 AAGAGACAAAATAGGGAGGAGGG - Intronic
1092942306 12:13421266-13421288 CAGGGAACATATAGTGAGAAAGG - Intergenic
1095268486 12:40187828-40187850 AAGAGAAAATACAGAGAGGAAGG + Intergenic
1095498268 12:42808467-42808489 CAGAGAATATATAGGTAGAAAGG + Intergenic
1095861836 12:46925910-46925932 TAGGGAAACTGTAGGGTGGAGGG + Intergenic
1095932158 12:47637674-47637696 GAGGGACAATCTAGGGATGAAGG - Intergenic
1097492575 12:60289581-60289603 CAGGTAAGAGATAGTGAGGAAGG - Intergenic
1097536868 12:60883325-60883347 CAGGGGAAAGGTTGGGAGGAGGG - Intergenic
1097920146 12:65063313-65063335 CACCTAAAATAGAGGGAGGATGG + Intronic
1099342518 12:81455561-81455583 CTTGGATAATAAAGGGAGGAAGG - Intronic
1099669830 12:85675593-85675615 AAGGGAAATGATAGGGAAGAAGG + Intergenic
1099698992 12:86060919-86060941 GGGGGAACATGTAGGGAGGAAGG + Intronic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1100012778 12:89973244-89973266 CAGGGAAAATGGAGGTGGGATGG + Intergenic
1101177877 12:102174967-102174989 GAGGGAAGAGACAGGGAGGAAGG - Intronic
1102039826 12:109793794-109793816 ATGGGAAAATAAAAGGAGGAAGG + Intronic
1102433717 12:112903715-112903737 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
1103134262 12:118493976-118493998 CAGGGAAAAGGCAGGGAGAAGGG + Intergenic
1103437491 12:120937976-120937998 CATGGAAATGAAAGGGAGGAAGG + Intergenic
1104073761 12:125371367-125371389 CTGGGAAGAGACAGGGAGGAAGG + Intronic
1104149583 12:126069852-126069874 AAGGGAAATTCTAGGGAAGATGG + Intergenic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1106496641 13:30284277-30284299 CACGGAAATAATAGGGAGAAAGG + Intronic
1106587891 13:31073038-31073060 CAGGGAAAGAATAGAGAGCAGGG - Intergenic
1107217996 13:37944931-37944953 CAGGGAAAGAATTTGGAGGAAGG + Intergenic
1108439710 13:50438447-50438469 CAGAGAAAATGTGTGGAGGAGGG + Intronic
1108685084 13:52812626-52812648 ATGGGAAAATATGGTGAGGAGGG - Intergenic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1110019529 13:70453080-70453102 CAGGAAAAAGAGAGAGAGGAGGG - Intergenic
1110447798 13:75606715-75606737 CATGGATAATATATTGAGGATGG + Intergenic
1110709777 13:78637589-78637611 CAGGGAAATTAAAGGGAACAAGG + Intronic
1111020634 13:82444780-82444802 CAAGGAAAAAATCAGGAGGAGGG - Intergenic
1111856040 13:93639125-93639147 CAGGGAAAATAAAGCAAGGAGGG + Intronic
1113973522 13:114209032-114209054 AAATGAAAATTTAGGGAGGAAGG + Intergenic
1115146442 14:30231835-30231857 CAGTGGAAATCTAGAGAGGAGGG - Intergenic
1115147234 14:30239621-30239643 GAGTAAAAATATAAGGAGGAGGG - Intergenic
1115772972 14:36685936-36685958 CAGGGAAAAGATAGGGTGGGGGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118523288 14:66611787-66611809 CAGGGCAATGATAGGGAGAATGG - Intronic
1118631396 14:67706933-67706955 CAGAGAAATTAGGGGGAGGAAGG + Intronic
1118938871 14:70314290-70314312 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
1119892738 14:78195064-78195086 CAGGGAAAAAAAAGGGTGGGGGG - Intergenic
1120286647 14:82510951-82510973 CAGGGAAAAAAGAGGGAAAAAGG - Intergenic
1121091783 14:91187986-91188008 CAGGGAAAACATAAGAGGGAAGG - Intronic
1121110195 14:91307397-91307419 AAGGGAAAATGTAGGGCAGAGGG - Intronic
1121497343 14:94402983-94403005 CAGGGGAAAGAAAGGAAGGAAGG - Intergenic
1121638346 14:95468712-95468734 CTGGGAGAATATGGGGAGGAAGG - Intronic
1122059345 14:99126193-99126215 CATGGAAAATCCATGGAGGATGG + Intergenic
1122115289 14:99524429-99524451 CAGGGAAATTATCTGGGGGAGGG - Intronic
1122186451 14:100001033-100001055 AAGAGAAAATAGGGGGAGGAAGG + Intronic
1122433467 14:101674399-101674421 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
1122550807 14:102548661-102548683 CAGGGAGAGTATGGGGAGGGGGG + Intergenic
1122627979 14:103093979-103094001 CAGGGAAAATCCAAGGAGAACGG - Intergenic
1122751778 14:103939655-103939677 CAGGGAGAATAAAGTTAGGAGGG + Intronic
1124012793 15:25852206-25852228 GAGGGAGGATAGAGGGAGGATGG - Intronic
1125164546 15:36686940-36686962 GAAGGAAAAGATAGGAAGGAAGG + Intronic
1125235305 15:37506059-37506081 CAGGGAAAATAAAGGGGTCATGG + Intergenic
1125718785 15:41835256-41835278 CAGGGAAGATATGGGAAGGAGGG + Intronic
1125834775 15:42739435-42739457 TAGGGAAAAAAGAGGGAGGGGGG - Exonic
1126566488 15:50106146-50106168 CAGGGACGATATTGGAAGGAAGG + Intronic
1126703365 15:51386467-51386489 CAGGAAAGGGATAGGGAGGAGGG + Intronic
1126707203 15:51416641-51416663 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1129121186 15:73397704-73397726 CAGGGGAAAAATAGGGAACAAGG + Intergenic
1129705835 15:77793542-77793564 CAGGGAAAGTTTAGGGTGGCAGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130164182 15:81436201-81436223 GAGGGAGAATATAGGGAGGTTGG - Intergenic
1130748076 15:86677410-86677432 CAGGGATAAGATTGAGAGGAAGG - Intronic
1131391902 15:92056620-92056642 AAGGGAAATTATAGGGAACATGG - Intronic
1131465720 15:92653694-92653716 CAGGAAAACTATACAGAGGAAGG + Intronic
1131488749 15:92843887-92843909 GAGGGAAAAAAAAGGTAGGAAGG - Intergenic
1131830049 15:96348424-96348446 CAGAGAAAATGTAGTGGGGAGGG - Intergenic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1132997537 16:2830969-2830991 AAGGGAGAAGGTAGGGAGGACGG - Intronic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1133663754 16:7944951-7944973 CAGGGAGATTATTGGCAGGAAGG - Intergenic
1135405197 16:22192562-22192584 CAGGGAGAAGAAAGAGAGGAAGG - Intergenic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1137801040 16:51262205-51262227 CAGGAAGAAGACAGGGAGGAAGG - Intergenic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138653127 16:58473139-58473161 AAGGGAAGAGAAAGGGAGGAAGG - Intronic
1138672667 16:58628462-58628484 CAAGTAAAATATTAGGAGGAAGG - Intronic
1138818094 16:60225870-60225892 GAGGGAAAATATAGGTAAAAAGG + Intergenic
1138845846 16:60564767-60564789 CTGGGAATAAATATGGAGGAGGG + Intergenic
1138860254 16:60747310-60747332 AAGGGAAACTCTAGGGAAGAGGG + Intergenic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140806201 16:78534581-78534603 AAGGTGAAATATAGGGAAGATGG + Intronic
1140818920 16:78645583-78645605 CAGAGAACATATAGGGAGAAAGG + Intronic
1140967696 16:79983111-79983133 GAGGGAAGAGAGAGGGAGGAAGG - Intergenic
1141059445 16:80852480-80852502 CAGGGAAAGTTCAGGAAGGAGGG - Intergenic
1142753583 17:2002643-2002665 CAGAGAAAAGAAAGGAAGGAAGG - Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1143120272 17:4602282-4602304 CAGGGACAATCTGGGGTGGAAGG + Intronic
1143260410 17:5594443-5594465 CAAGGCTAAGATAGGGAGGAGGG + Intronic
1143598900 17:7931472-7931494 CAGAGAAGATGTTGGGAGGAGGG - Intronic
1143961733 17:10726904-10726926 CAGGGAATAAGTAGGGAGGGTGG + Intronic
1144483014 17:15643016-15643038 CAGCGAAAATACAGTGAGCACGG + Intronic
1144915668 17:18722015-18722037 CAGCGAAAATACAGTGAGCACGG - Intronic
1146113926 17:30117018-30117040 CCGGGAAAATGTACGGGGGAGGG - Intronic
1146619305 17:34385195-34385217 AAGGGAAAAAAAAGGAAGGAAGG - Intergenic
1146702320 17:34971871-34971893 CTGGGAAAAGATAGAGACGATGG + Intronic
1146988606 17:37246227-37246249 CAGAGAAAATACATGGAGGTGGG - Intronic
1147515666 17:41115408-41115430 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
1148088833 17:45010424-45010446 CAGTAAGAATATTGGGAGGAGGG + Intergenic
1148383299 17:47216443-47216465 CAAGGAAATGATGGGGAGGAAGG - Intronic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1149013292 17:51880204-51880226 CAGGAGGAATAAAGGGAGGAGGG - Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1152146138 17:78570029-78570051 GAGGGAAAAGAAAGGGAAGACGG - Intronic
1152164165 17:78690975-78690997 AAGGCAAAATATAGGGCAGAAGG + Intronic
1154345800 18:13542644-13542666 CAGGGAGAAGATAAGGAGGCGGG + Intronic
1155004444 18:21715366-21715388 GAGGGAAAGTCTAGGGATGAAGG - Intronic
1156341581 18:36214509-36214531 CAGGGAAGAGACAGGGAGGGTGG - Intronic
1156472597 18:37387198-37387220 CCGGGAAAAGGCAGGGAGGAAGG - Intronic
1156584707 18:38419278-38419300 CAGAGAAAATATAAAAAGGAAGG - Intergenic
1156805374 18:41172798-41172820 TAGGGAAAAGAATGGGAGGAGGG - Intergenic
1156953550 18:42934431-42934453 CAGGAAAAATATGGGGATAATGG + Intronic
1157305697 18:46515863-46515885 CAGGGACAAAATAGGGAAGCTGG - Intronic
1157380076 18:47206331-47206353 CAGGCAAAGTACAGAGAGGAAGG + Intergenic
1157772150 18:50358633-50358655 GAGGGAAAAGAAAGGGAAGATGG - Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158021175 18:52843858-52843880 CAGGAAATATGTAGGGAAGAGGG + Intronic
1158082893 18:53615422-53615444 CATGGCTAATACAGGGAGGAAGG - Intergenic
1158783766 18:60683891-60683913 CAAGGAAAATTTTGGGATGATGG + Intergenic
1159020010 18:63135685-63135707 CAGGGACAATTGACGGAGGAAGG - Intronic
1159923356 18:74246627-74246649 CAGGGAGAGTATGGGGAGGTGGG - Intergenic
1160265925 18:77340879-77340901 CAGTGAGAAATTAGGGAGGAAGG + Intergenic
1160820783 19:1056765-1056787 CAGGGGCAATTTAGGGATGAGGG - Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1161756619 19:6138587-6138609 GAGGGAAGAGAGAGGGAGGAAGG + Intronic
1163102031 19:15103637-15103659 CAGGGATCTCATAGGGAGGAGGG + Intergenic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1163755738 19:19105343-19105365 CCCAGAAAACATAGGGAGGAAGG + Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1165211532 19:34239943-34239965 TAGTGAAAGTACAGGGAGGATGG - Intergenic
1165293297 19:34906096-34906118 CAGAGAAGATGCAGGGAGGAAGG + Intergenic
1166975744 19:46604121-46604143 CAGGGAAAGAACAGAGAGGAGGG - Intronic
1167046012 19:47049096-47049118 CGGGGAAAAAAAAGGAAGGAGGG - Intergenic
1167086067 19:47310417-47310439 CAGAGAAAATGTTGGGAGGCTGG + Intronic
1202710440 1_KI270714v1_random:16810-16832 CTGGGATATTATAGGGAGGAAGG + Intergenic
925575633 2:5357189-5357211 CATGGAAAATAGAGGGAGGGGGG + Intergenic
925600734 2:5606483-5606505 CAGGGAAGCTATTGAGAGGAGGG + Intergenic
926296187 2:11570628-11570650 AAGGGTAAAACTAGGGAGGAAGG - Intronic
926527378 2:13997959-13997981 AAGGGAAAATGGAGGGAGAAAGG + Intergenic
926531930 2:14058434-14058456 TAGCAAAAAAATAGGGAGGAAGG + Intergenic
926558163 2:14384807-14384829 CAGGGAAAATACGGGTAGAATGG + Intergenic
926672288 2:15587699-15587721 CTGGGAAAGTGTAGAGAGGATGG - Intergenic
926889305 2:17625763-17625785 CAGGGAAGATATAGAGAAAAGGG + Intronic
926924585 2:17974449-17974471 CTGTGAAAATATAGCAAGGATGG - Intronic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927542254 2:23923530-23923552 CAGGGAAACTTTAGGAATGACGG + Intronic
928189915 2:29154631-29154653 CAGGGAAATCATAGAGAGGAGGG + Intronic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928692638 2:33816737-33816759 GAGGGAAAAAAAAGGAAGGAAGG - Intergenic
928823176 2:35387785-35387807 CAAGGAAAATTTGGGAAGGATGG + Intergenic
928921777 2:36534467-36534489 GAAGGAAAATATAGGCAGGAAGG + Intronic
929535611 2:42782368-42782390 AAGAGAAAATAGGGGGAGGAAGG - Intronic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
930662006 2:54063890-54063912 CAGGGGAAATATTTGAAGGAAGG + Intronic
930982835 2:57548117-57548139 AAGGGAAAAAAGAGGAAGGAAGG + Intergenic
931643874 2:64404408-64404430 CAAGAACAATAAAGGGAGGAGGG - Intergenic
932226777 2:70047665-70047687 AAGGGAAAATAAAGGGGAGAGGG + Intergenic
932360056 2:71097375-71097397 AAGGAAAAATAAAGGAAGGAAGG + Intergenic
933270351 2:80226637-80226659 GAGGGAAAAAGTAGGGTGGAGGG - Intronic
933516411 2:83309320-83309342 GAGGGAAACAATAGTGAGGAGGG - Intergenic
934108436 2:88717843-88717865 AAGAGAAAATAGGGGGAGGAAGG + Intronic
934812334 2:97291081-97291103 CAGTGAAAATATAAGTAAGATGG + Intergenic
934825360 2:97416842-97416864 CAGTGAAAATATAAGTAAGATGG - Intergenic
935400320 2:102653601-102653623 CAGGGAAAAGAGAGAAAGGAAGG - Intronic
935665615 2:105509726-105509748 CAGGGCAATTATCGGGAGGAGGG - Intergenic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
936229772 2:110690005-110690027 CAGGGAAATTATAGACAGGAAGG - Intergenic
936478433 2:112862888-112862910 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937379710 2:121365543-121365565 AAGGGAAAAGATAGCAAGGAAGG - Intronic
937639386 2:124194166-124194188 CAGAGAAAATAAATGGGGGAGGG - Intronic
937665701 2:124484357-124484379 CAGGAAATATATATGGATGAAGG + Intronic
938555496 2:132419660-132419682 AAGGGAATATTTATGGAGGAAGG - Intronic
939633495 2:144552984-144553006 AAGGGAAAAGAAAGGAAGGAAGG + Intergenic
939751576 2:146053915-146053937 CATGGAAAATATAAGCAGAAAGG + Intergenic
940029334 2:149244313-149244335 AAGGGAAGAAAGAGGGAGGAGGG - Intergenic
940638599 2:156326644-156326666 AAAGGAAAAGAAAGGGAGGAAGG - Intronic
940987904 2:160066644-160066666 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
942182585 2:173394618-173394640 CAGAGAAGATTTAGGGAGAAAGG + Intergenic
942385213 2:175435476-175435498 AAGGGAAGATCCAGGGAGGATGG - Intergenic
942468811 2:176238430-176238452 AAGGGTAAATATAAGGAGGGGGG - Intergenic
942745930 2:179233116-179233138 CAGGGAAAATTTAGGAAGAAAGG + Intronic
943598123 2:189881458-189881480 AAGAGAAAATAAGGGGAGGAAGG + Intronic
944486811 2:200215461-200215483 CAAGCCAAATAGAGGGAGGAAGG - Intergenic
944617400 2:201475854-201475876 AAGTGAAAATTGAGGGAGGAAGG + Intronic
944970305 2:204985189-204985211 GAGGGAAAAAACAGGCAGGAGGG - Intronic
945538504 2:211051146-211051168 TAGGAATGATATAGGGAGGAGGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946170610 2:217893128-217893150 AAGGGAGAACATAAGGAGGAAGG + Intronic
946451118 2:219780309-219780331 CAGGGCAAATATCAGGAGAAAGG + Intergenic
946777150 2:223155291-223155313 CAGGGAAACCATAGAGAGGGGGG - Intronic
946780451 2:223189180-223189202 CAGAGAAAATTTTGGGGGGATGG + Intronic
946973696 2:225123450-225123472 GAAGGAAAAGAAAGGGAGGACGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947705613 2:232273168-232273190 CAGGGAAACCCTAGGAAGGAGGG - Intronic
947935763 2:234002115-234002137 CAGGGAAGATTTATGGAGGAAGG + Intronic
1169719381 20:8657109-8657131 CAGAGAAAAAACAGGGAGGGAGG + Intronic
1169945695 20:10985685-10985707 CAGGGAAAAGAAATAGAGGACGG - Intergenic
1170781595 20:19430423-19430445 AAGAGAAAAAATAGGGAGGGAGG + Intronic
1170907517 20:20529072-20529094 CACGGAAACTAGAGGGAGGCAGG + Intronic
1171093837 20:22312444-22312466 TAGAGAATATATGGGGAGGAAGG - Intergenic
1171170286 20:23010105-23010127 CAGGGAGAGTAAAGGGAGAAAGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1172064426 20:32208908-32208930 AAGGGAAAATAAAGAGAGCAGGG + Intronic
1172563421 20:35909358-35909380 CAGGCACATTCTAGGGAGGAGGG - Intronic
1174687085 20:52466358-52466380 CAGACAGAATAGAGGGAGGATGG + Intergenic
1175231563 20:57476773-57476795 CAGAGACAATCTAGGGAGGCAGG - Intergenic
1175767230 20:61599898-61599920 CTTGGAAAATAAAGGGAGGAAGG + Intronic
1177589186 21:23139719-23139741 AAGAGAAAATAAGGGGAGGAAGG + Intergenic
1178480669 21:32977143-32977165 GAGGGAAAAAGAAGGGAGGAGGG - Intergenic
1178575102 21:33780166-33780188 CCTGGAAAATTTAGGGATGAAGG + Intronic
1178687724 21:34724296-34724318 TAAGGAAGAGATAGGGAGGAAGG + Intergenic
1178777553 21:35566551-35566573 GAGGAAGAATAGAGGGAGGAAGG - Intronic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1179030028 21:37712471-37712493 GAGGGAAGAGAAAGGGAGGAGGG - Intronic
1179030043 21:37712516-37712538 GAGGGAAGAGAAAGGGAGGAAGG - Intronic
1179030089 21:37712656-37712678 GAGGGAAGAGAAAGGGAGGAAGG - Intronic
1179030102 21:37712701-37712723 GAGGGAAGAGAAAGGGAGGAAGG - Intronic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1179570226 21:42274187-42274209 AAGGGAAAATACAGGGAAGGTGG + Intronic
1179651634 21:42813333-42813355 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
1181021684 22:20106858-20106880 CAGGGAAAGTGCAGGCAGGACGG - Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181660200 22:24341167-24341189 CAGGGCAGATACTGGGAGGAGGG + Intronic
1182099215 22:27646058-27646080 CTGGGAGAAACTAGGGAGGATGG + Intergenic
1182385168 22:29932868-29932890 CAGGGAAAAAATATGGAGAAAGG - Intronic
1182829971 22:33297195-33297217 CAGGGAAAATGTAAGGGGGTAGG + Intronic
1183085378 22:35483693-35483715 GAGGGAAGAAAGAGGGAGGAAGG + Intergenic
1183467670 22:37987819-37987841 CAGGGAAACTGGAGGTAGGAGGG - Intronic
1184529143 22:45043367-45043389 CAGGGAAGGTGTGGGGAGGAGGG + Intergenic
1184781139 22:46650278-46650300 CAGGGAAGTTACTGGGAGGAAGG - Intronic
1184917855 22:47585214-47585236 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
949427239 3:3930873-3930895 TAGTGAAAAAATATGGAGGATGG + Intronic
950211421 3:11126446-11126468 GAGGGAAACTATAGGGAGAGTGG + Intergenic
950599937 3:14024945-14024967 AAGAGAAAATAGGGGGAGGAAGG + Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950880872 3:16321783-16321805 CAGGGAAAATTCAGAGAGGATGG - Intronic
951111923 3:18813772-18813794 CCGGGAAAATACAGACAGGAGGG - Intergenic
951203220 3:19897487-19897509 CAGGGAAAATGAAGAGAGGCAGG - Intronic
951298041 3:20963433-20963455 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
951658630 3:25037354-25037376 CAGGGCAAACATGGGGTGGAGGG + Intergenic
952000375 3:28778399-28778421 GAGGGAAAATAAAGGGAAAAGGG - Intergenic
953565945 3:44032211-44032233 CATGATCAATATAGGGAGGAGGG + Intergenic
954651401 3:52166159-52166181 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
954843069 3:53530273-53530295 CAGGAAAAATACAGGGAAAAAGG + Intronic
954984403 3:54776818-54776840 CAGGGATAGTCTATGGAGGAAGG - Intronic
955409151 3:58644657-58644679 CAGGGATAATTTAGACAGGAAGG + Intronic
955628779 3:60949577-60949599 CAGCGACAGGATAGGGAGGAGGG - Intronic
955866131 3:63386623-63386645 GAGGGAAAATAAAGAAAGGAAGG - Intronic
956361966 3:68458192-68458214 AAGGGGAAATATAGAGAGAAGGG - Intronic
957178286 3:76841500-76841522 CAGGAAAAATAAAAGGGGGAGGG - Intronic
957434861 3:80161610-80161632 CAGGCAAAATCCAGGGAGAAGGG + Intergenic
957954168 3:87162095-87162117 GAGGGAGGATAAAGGGAGGAGGG - Intergenic
958659934 3:97053525-97053547 CAGGTAAACTATAGAGAGTAAGG + Intronic
959966605 3:112362893-112362915 GAGGGGAAAGATAGAGAGGAGGG - Intergenic
959970245 3:112400923-112400945 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
960228150 3:115191911-115191933 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
960701989 3:120448682-120448704 CAGGCAAACTACAGGGAAGAAGG - Intronic
960704022 3:120464750-120464772 CTGGGAGAATGTGGGGAGGATGG + Intergenic
961347723 3:126274882-126274904 GAGGGAAGAAAGAGGGAGGAAGG - Intergenic
961910261 3:130307603-130307625 CAGGGAGAAGAATGGGAGGAGGG + Intergenic
962188080 3:133281198-133281220 CAGGGCAAAAAAAGAGAGGATGG + Intronic
962437871 3:135383149-135383171 CAGGGAGAATGCAGGGCGGAAGG + Intergenic
962918780 3:139933327-139933349 TAGAGAAAATGAAGGGAGGAGGG + Intergenic
963470627 3:145736974-145736996 TAGGGAAAATGTGGGGAGGTAGG + Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
964053376 3:152422221-152422243 AAGGGAAAATAAAGGGATGGAGG + Intronic
964450064 3:156803534-156803556 CAGGGAAAAAATAAGTAGAATGG - Intergenic
964640748 3:158907606-158907628 CATGAAAGATAAAGGGAGGATGG - Intergenic
964861705 3:161209662-161209684 CAGGGAAAAGGTAGGGATCAAGG + Intronic
965277250 3:166701325-166701347 CAGTGACAATAAAGTGAGGATGG + Intergenic
965716144 3:171605259-171605281 CAGTGAAAAGAAACGGAGGAGGG + Intronic
965779822 3:172273423-172273445 CGGGGAATATACAGGGAGCAGGG - Intronic
966623827 3:181995167-181995189 GAGGGAAGATCTAGGGATGAAGG - Intergenic
967465286 3:189798016-189798038 CAGTCAAAGGATAGGGAGGAAGG - Intronic
967597950 3:191349970-191349992 CAGGAAAAAAAAAGGGAGGGGGG - Intronic
967828265 3:193896293-193896315 CGGGGAAGACACAGGGAGGAGGG + Intergenic
968005532 3:195240203-195240225 AAGGGACAGTGTAGGGAGGAGGG + Intronic
968043687 3:195611382-195611404 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
968881974 4:3305615-3305637 GAGGGAAAATGGAGGCAGGAAGG + Intronic
969108974 4:4829462-4829484 CAGGGAAAATGCAGGGAAGAGGG - Intergenic
970049757 4:11900398-11900420 CAGGGAAAAAAATGGGAAGAAGG - Intergenic
970853334 4:20627344-20627366 AAGAGAAAATATGGGGAGAAAGG + Intergenic
970868675 4:20788007-20788029 AAAGAAAAAAATAGGGAGGAAGG - Intronic
970918795 4:21368663-21368685 TAGGGAAAATCTAGGTAGTATGG - Intronic
972227579 4:37031439-37031461 CAGGGATAATAAAAGGAGAAAGG + Intergenic
972842451 4:42947307-42947329 CAGGGAAAACTTAGGGACGAGGG + Intronic
972886281 4:43493218-43493240 CAGGAAAAATAGAGGGAGCTGGG + Intergenic
973139541 4:46749404-46749426 TTGGGAAAATAGATGGAGGATGG - Intronic
973786206 4:54335017-54335039 CAGGAAAAATGAAGGAAGGAAGG - Intergenic
976408235 4:84683586-84683608 TAGGGAAAACATAGTGAGCAGGG - Intronic
976611396 4:87034259-87034281 CAGGGAGGATAGGGGGAGGAAGG + Intronic
977666990 4:99653662-99653684 GAGAGAAAATATCAGGAGGAGGG - Exonic
977724707 4:100282379-100282401 CAGGTAAACGATGGGGAGGATGG + Intergenic
977840206 4:101693945-101693967 CAGGAATAATAAAGGGAGGGAGG - Intronic
979024023 4:115544691-115544713 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
980884001 4:138742435-138742457 CAGGGAAATTTTAGGAAGAAAGG + Intergenic
980933635 4:139205637-139205659 TAGGTAAATTATTGGGAGGAGGG - Intergenic
981193679 4:141893063-141893085 CAGGAAGACTAAAGGGAGGAGGG + Intergenic
981459987 4:145001996-145002018 CATGGAAAATAAAAGAAGGAAGG + Intronic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
982475873 4:155849945-155849967 AAGAGAAAATAGTGGGAGGAAGG - Intronic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
987733194 5:21803813-21803835 TGGGGAAAATAAAGGAAGGATGG + Intronic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
989069647 5:37497233-37497255 AAGGGAAAAGGGAGGGAGGAGGG - Intronic
989069658 5:37497260-37497282 GAGGGAAAAGGGAGGGAGGAAGG - Intronic
989291521 5:39771614-39771636 CAGAGAAACTTTAGAGAGGAAGG + Intergenic
989299765 5:39876976-39876998 CAGAGAAAAAAGAGGAAGGAGGG + Intergenic
989316960 5:40092565-40092587 AAGAGAAAATAGTGGGAGGAAGG - Intergenic
989665227 5:43846301-43846323 AAGGAAAAAGAGAGGGAGGAAGG - Intergenic
990752684 5:59035088-59035110 CATGGAAAGTATATTGAGGATGG - Intronic
991423555 5:66466409-66466431 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
991727860 5:69554228-69554250 CAGAAAAAAAATAGGGAGGCTGG - Exonic
991867097 5:71073648-71073670 CAGAAAAAAAATAGGGAGGCTGG + Intergenic
992603247 5:78426679-78426701 CAGGGAAATTTTGGGAAGGATGG - Intronic
993339681 5:86708000-86708022 TAGGAAAAACATAGAGAGGAGGG + Intergenic
993340547 5:86719968-86719990 CTGAGAAAATGTAGGAAGGAGGG + Intergenic
993704291 5:91152207-91152229 AAGGGAAAGTACAGGAAGGAAGG + Intronic
993823779 5:92655404-92655426 CATGGAGAATAAAGGGAAGAGGG - Intergenic
994030526 5:95136530-95136552 CAGGGAAAATTCAAGGGGGAGGG + Intronic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
995955409 5:117770441-117770463 GAGGGAAAGTCTAGGGATGAAGG - Intergenic
996136243 5:119845983-119846005 AAGGGAAAAAATAGGGTGGGAGG - Intergenic
996305389 5:122040497-122040519 GAGGGTCAATAAAGGGAGGAGGG + Intronic
996375497 5:122802357-122802379 GAGGGAAATGATGGGGAGGAGGG + Intronic
997580775 5:135015472-135015494 CCGGGAAAATGGAGGGAAGAAGG + Intergenic
997748447 5:136320633-136320655 CAGGGAGAAAATGGGGAGGCTGG - Intronic
999521990 5:152360094-152360116 TAGGGAAAATTGAGGGAGCAGGG + Intergenic
999770247 5:154770182-154770204 CAGGAAAAAGATGGAGAGGAGGG + Intronic
1000912996 5:167044935-167044957 CAGAGAAAATGGAGGGAGCAAGG + Intergenic
1001065625 5:168532971-168532993 CAGGAAAAATATAGGAATAAGGG + Intergenic
1001144690 5:169173544-169173566 CTGGGAAAATAATGTGAGGAAGG - Intronic
1001298377 5:170515338-170515360 AAGGGAAAAACCAGGGAGGAGGG - Intronic
1001304352 5:170560891-170560913 GAGGGAGAATCTGGGGAGGAAGG - Intronic
1001991514 5:176119845-176119867 CAAGGGAAAGATAGGAAGGAGGG - Intronic
1002225362 5:177718281-177718303 CAAGGGAAAGATAGGAAGGAGGG + Intronic
1002268482 5:178052833-178052855 CAAGGGAAAGATAGGAAGGAGGG - Intronic
1002703751 5:181146779-181146801 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
1002778500 6:348838-348860 CTGGGTAAATATAAGGAGCAAGG + Exonic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1003274394 6:4636978-4637000 CAGGGTAAATATAGTCAGGAAGG - Intergenic
1003381443 6:5628257-5628279 CAGGGAAAATTTCTGAAGGAAGG + Intronic
1003694088 6:8385147-8385169 CAGGGACAATTTAGTGAGAAAGG + Intergenic
1004673943 6:17823437-17823459 AAGGAAAAAGAGAGGGAGGAAGG - Intronic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005322640 6:24669722-24669744 AAGAGAAAATAGGGGGAGGAAGG + Intronic
1007013269 6:38438162-38438184 CAGGAAAAAAAAAGGAAGGAAGG + Intronic
1007220584 6:40275769-40275791 CAGGGTAAAGAAAGGGAGTAGGG - Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007501701 6:42303440-42303462 CAGGGGAAAGATAGAGAGCAAGG + Intronic
1008217791 6:48816472-48816494 CAGAAAAAATATAGGGAGTTAGG + Intergenic
1008699311 6:54079815-54079837 CAGGACAAATACAGGGATGATGG - Intronic
1009872696 6:69470205-69470227 AAGGGGAGATATAGGGAGGCTGG - Intergenic
1009938357 6:70260003-70260025 CAAGGCAAAGACAGGGAGGATGG - Intronic
1011123267 6:83978219-83978241 AAGGGAAAATGTAGGCTGGAGGG + Intergenic
1011303274 6:85899024-85899046 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012271874 6:97223194-97223216 CAGAGAAATTATAGGTAGGAAGG - Intronic
1013685994 6:112583771-112583793 CAGGGAAAAAACTGGGAGGTGGG - Intergenic
1014041295 6:116829488-116829510 CAGGAAAAATAAAAGCAGGATGG - Intergenic
1014211067 6:118708771-118708793 TAGGGAAAAGGGAGGGAGGAAGG - Intronic
1015015918 6:128412841-128412863 AAGGGAAGAAATAGGGAGAAAGG - Intronic
1015054263 6:128881115-128881137 CTGGGAAAATGTAAAGAGGAAGG + Intergenic
1015114087 6:129627616-129627638 AAGGAAAAATAGAGAGAGGAAGG + Intronic
1016758313 6:147710996-147711018 GAAGGAAAATAAAGGAAGGAAGG + Intronic
1017462381 6:154663481-154663503 AATGGAAAATATGGGAAGGAAGG - Intergenic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1019233494 6:170588077-170588099 AAGAGAAAATTTGGGGAGGAAGG + Intergenic
1020167264 7:5817708-5817730 CAGGGAAAAGATAGGACGCAGGG - Intergenic
1020383588 7:7572187-7572209 CATGGGAAATATAGCCAGGATGG + Intronic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1022100713 7:27167391-27167413 CAAGGAAAATATTAGGGGGAGGG - Intronic
1022120751 7:27305844-27305866 CAGGGTAACTGTTGGGAGGAGGG - Intergenic
1022224397 7:28348005-28348027 CAGGGAAATTGTAGGGAGAGAGG + Intronic
1022458734 7:30584090-30584112 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
1023629866 7:42153531-42153553 CAGCCAAAATGAAGGGAGGATGG + Intronic
1024851981 7:53729568-53729590 CAGGGCAAATGGTGGGAGGAGGG - Intergenic
1024876514 7:54030330-54030352 GAGGGAAAAAAAAGGGAGGAAGG + Intergenic
1024920153 7:54546320-54546342 AAAGGAAAATAGCGGGAGGAGGG + Intronic
1024935440 7:54707228-54707250 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
1025231751 7:57207245-57207267 GAGGGAAAAAAAAGGAAGGAAGG - Intergenic
1026652025 7:72223998-72224020 GAGGGAGGATGTAGGGAGGAAGG + Intronic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1026889857 7:73975361-73975383 CAGGCAAACAATAGGGAAGACGG - Intergenic
1027143545 7:75677987-75678009 CAGAGAAAAAATAGTGAGTAAGG - Intronic
1028001723 7:85506792-85506814 AAGTGAAAAAATAGGGAAGATGG + Intergenic
1028102658 7:86839865-86839887 CACATAAAATATAGGGAGGAAGG - Exonic
1028210568 7:88069196-88069218 AAGGAGAAACATAGGGAGGAAGG - Intronic
1028245732 7:88474693-88474715 TACAGAAAATATAGGGGGGACGG - Intergenic
1029551616 7:101239740-101239762 CAGGGAAAGGACAGCGAGGATGG + Exonic
1029875047 7:103741676-103741698 AAGGGAAAAGACAGGGAGGGAGG + Intronic
1029923531 7:104291597-104291619 CAGGGAAGATGTGGGGAGGTGGG - Intergenic
1030677976 7:112404836-112404858 CATGAAAGATAAAGGGAGGAGGG + Intergenic
1032439744 7:131933312-131933334 CAGGGAAGGAATAGGAAGGAAGG + Intergenic
1032529279 7:132606757-132606779 CTGAGAAAAATTAGGGAGGAGGG + Intronic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1034093040 7:148381748-148381770 CAGAGAAAATCTAGGCAGAAAGG - Intronic
1034240332 7:149605876-149605898 CAGGGAAAGGCTAAGGAGGAAGG - Intergenic
1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG + Intergenic
1037170693 8:15887886-15887908 CAGAGAAAATGGAGGGAGGGAGG + Intergenic
1037529894 8:19762863-19762885 CAGGGAAAATAGCCTGAGGAAGG + Intergenic
1038607469 8:29022863-29022885 CAGGGAAAAAATGGGGGGGAGGG + Intronic
1038669792 8:29573608-29573630 CAGGGAAAATCTTTGGAGGAAGG - Intergenic
1039164849 8:34666607-34666629 CAGTGAAAATAAAGGGTGGGGGG + Intergenic
1039864195 8:41487114-41487136 CAGAGAAGATACAGGGAAGAAGG + Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1042624845 8:70746909-70746931 AAGGGAGAAGACAGGGAGGAGGG - Intronic
1043044639 8:75306306-75306328 CAGGGAACAAATAGGGTGAAAGG - Intergenic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043969894 8:86517078-86517100 AAGGGAAAATATTGGTGGGAAGG - Intronic
1043994273 8:86793532-86793554 CTTGGAAAATATTGGAAGGAAGG + Intergenic
1045403870 8:101845807-101845829 GAGGGTAAATATAGAGAGGGTGG - Intronic
1045615656 8:103907515-103907537 CAGAGAAAAAAAAGGAAGGAAGG - Intronic
1046222544 8:111235072-111235094 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
1046438337 8:114225401-114225423 CAGAGAAAGGAAAGGGAGGAAGG - Intergenic
1046597374 8:116276325-116276347 GAGGGAAGAGATAGGGAGAAGGG + Intergenic
1046819157 8:118617634-118617656 TATGAAAAAAATAGGGAGGATGG - Intronic
1046893765 8:119450809-119450831 CAGGGAGAATACATGGAGCAAGG - Intergenic
1047817626 8:128482139-128482161 CAGGGATAATCTAGGGAAGGAGG + Intergenic
1048391561 8:133970583-133970605 GAGAGAAAATAAAGGAAGGAAGG + Intergenic
1048874768 8:138828051-138828073 CGAGGAAAACATGGGGAGGATGG - Intronic
1049908586 9:243659-243681 CAGGGGAAAGGTAGGGAAGAAGG - Intronic
1050721581 9:8597541-8597563 CAGTGAAAATAAAAGGAAGAAGG + Intronic
1050990418 9:12144369-12144391 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
1053317462 9:37064116-37064138 GAGGGAAAAGGGAGGGAGGAAGG - Intergenic
1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG + Intronic
1054771299 9:69086599-69086621 AAGGGGAAATAAAGGGATGAGGG - Intronic
1056075877 9:83039708-83039730 AAGGGAAAAAATAGTGAAGAAGG - Intronic
1056217062 9:84415305-84415327 AAGGGAAATGAAAGGGAGGATGG - Intergenic
1056604639 9:88076642-88076664 CAGGGGAAATGAAGGGAGGGTGG - Intergenic
1057433099 9:95013363-95013385 GATGGAAAATAAAGAGAGGAGGG - Intronic
1057467131 9:95324331-95324353 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
1058814470 9:108670674-108670696 CAAGGAAACTATGGGGATGAAGG + Intergenic
1058935821 9:109768198-109768220 CAGGGAGAAAAAAGGAAGGAAGG + Intronic
1058984722 9:110200113-110200135 GAGAGAAAAGATAGGCAGGAAGG + Exonic
1059172048 9:112134593-112134615 GAGGACAAATAGAGGGAGGAGGG + Intronic
1059404464 9:114091573-114091595 GTGGGAAATTAGAGGGAGGAAGG - Intronic
1059903773 9:118958621-118958643 CAAGCAAATTCTAGGGAGGAGGG + Intergenic
1061612804 9:131759546-131759568 CAAGGAAAAAGAAGGGAGGAAGG + Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1187440588 X:19314579-19314601 AAGGAAAAATATGGGGAGGAAGG - Intergenic
1188255321 X:27955706-27955728 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
1188277316 X:28216061-28216083 CAAGGAAAAAAAAGGAAGGAAGG - Intergenic
1188758309 X:33992879-33992901 CAGGGAAAATATGAAGAGAACGG - Intergenic
1188849108 X:35110380-35110402 AAGGGAAAATATGGGGCTGAAGG - Intergenic
1190129310 X:47732516-47732538 CAGAGAAAATATAGAAAGAATGG + Intergenic
1190304308 X:49073540-49073562 CAAGGAAGATATGGGGAGGATGG - Intronic
1190755029 X:53394301-53394323 ATGGGTAAATATGGGGAGGAAGG + Intronic
1190787452 X:53665432-53665454 CAAGGAAAATATGGGCAGGGAGG + Intronic
1191626941 X:63279780-63279802 TAAGGAAAATAAAGGGAGTAAGG - Intergenic
1193389840 X:80913578-80913600 GAGGGAAAATCTAGGGCTGAAGG + Intergenic
1194070981 X:89325918-89325940 CAGGGAAAAGGTAAAGAGGAAGG - Intergenic
1194701399 X:97119192-97119214 GAGGGAAAATCTAGGGCTGAAGG + Intronic
1195150659 X:102066448-102066470 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
1195152073 X:102082252-102082274 CAGGGACAAGATAGGGAGTGGGG - Intergenic
1195977506 X:110543532-110543554 CAAGGAAATAATAAGGAGGAAGG + Intergenic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196388469 X:115185636-115185658 CAGAGAAAAGATGGGGAGGAGGG - Intronic
1196542341 X:116924400-116924422 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
1196653298 X:118190524-118190546 AAGGGAAAAGAAAGAGAGGAAGG + Intergenic
1198012827 X:132576265-132576287 CAGAGAAAGTATTGGGAGGGAGG + Intergenic
1198321584 X:135522370-135522392 CAGGAGAAAAGTAGGGAGGACGG + Intronic
1198422695 X:136483288-136483310 CAGGGAATATTTAGGAAAGATGG - Intergenic
1198952374 X:142086385-142086407 AAGAGAAAATAAGGGGAGGAAGG - Intergenic
1199462130 X:148096399-148096421 CAGATAAAATTTTGGGAGGAGGG + Intergenic
1199887197 X:152031886-152031908 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
1200725211 Y:6661659-6661681 CAGGGAAAAGGTAAAGAGGAAGG - Intergenic
1200838947 Y:7760849-7760871 AGGGGAAAATATAAGGAGCAAGG + Intergenic
1201889968 Y:18931928-18931950 CAAGAAAAATATTGGGAGGTAGG - Intergenic