ID: 915349312

View in Genome Browser
Species Human (GRCh38)
Location 1:155214581-155214603
Sequence TCCCGATGGCTCTGCTGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915349312_915349314 0 Left 915349312 1:155214581-155214603 CCACAACAGCAGAGCCATCGGGA No data
Right 915349314 1:155214604-155214626 TGCATCAGTGCCACTGCGTCCGG 0: 1
1: 0
2: 2
3: 3
4: 112
915349312_915349317 17 Left 915349312 1:155214581-155214603 CCACAACAGCAGAGCCATCGGGA No data
Right 915349317 1:155214621-155214643 GTCCGGGTCGTTCTTCTGACTGG 0: 1
1: 1
2: 0
3: 0
4: 22
915349312_915349315 1 Left 915349312 1:155214581-155214603 CCACAACAGCAGAGCCATCGGGA No data
Right 915349315 1:155214605-155214627 GCATCAGTGCCACTGCGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915349312 Original CRISPR TCCCGATGGCTCTGCTGTTG TGG (reversed) Intergenic