ID: 915349459

View in Genome Browser
Species Human (GRCh38)
Location 1:155215309-155215331
Sequence GTGAAGATCCAGGCATCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 2, 1: 0, 2: 3, 3: 8, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915349451_915349459 19 Left 915349451 1:155215267-155215289 CCTGTGAGGGGCACATTCCTTAG 0: 2
1: 0
2: 0
3: 7
4: 89
Right 915349459 1:155215309-155215331 GTGAAGATCCAGGCATCTCAAGG 0: 2
1: 0
2: 3
3: 8
4: 144
915349455_915349459 2 Left 915349455 1:155215284-155215306 CCTTAGTAGCTAAGGAGTTGGGG 0: 2
1: 0
2: 0
3: 11
4: 89
Right 915349459 1:155215309-155215331 GTGAAGATCCAGGCATCTCAAGG 0: 2
1: 0
2: 3
3: 8
4: 144
915349450_915349459 20 Left 915349450 1:155215266-155215288 CCCTGTGAGGGGCACATTCCTTA 0: 2
1: 0
2: 0
3: 7
4: 94
Right 915349459 1:155215309-155215331 GTGAAGATCCAGGCATCTCAAGG 0: 2
1: 0
2: 3
3: 8
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915349459 Original CRISPR GTGAAGATCCAGGCATCTCA AGG Intergenic
900975338 1:6012879-6012901 GTGGAGAGCCAGGCATCTCATGG - Intronic
901180152 1:7336214-7336236 GTAGAGCTCCTGGCATCTCAGGG - Intronic
901957192 1:12795049-12795071 TTGCAGATGCAGGCATGTCAGGG + Intronic
901965206 1:12860827-12860849 TTGCAGATGCAGGCATGTCAGGG + Intronic
901967550 1:12880799-12880821 CTGATGATACAGGCATGTCAGGG - Intronic
902017624 1:13320986-13321008 CTGATGATACAGGCATGTCAGGG + Intronic
902020724 1:13343460-13343482 TTGCAGATGCAGGCATGTCAGGG - Intronic
904850376 1:33454814-33454836 GTGAAGGACCAGGCACCCCATGG + Intergenic
906289187 1:44608955-44608977 GTGAAGATCCAGTGAAATCAGGG - Intronic
909366321 1:74827171-74827193 GTGAAGTTTCAGGCATCTGCTGG - Intergenic
912439859 1:109689516-109689538 GACACGATCCAGGCATCCCAGGG + Intronic
912443216 1:109714199-109714221 GACACGATCCAGGCATCCCACGG + Intronic
914357455 1:146899029-146899051 GTGTGGATCCAGAGATCTCATGG - Intergenic
915075584 1:153306122-153306144 GGGAAGACCCAGCCATCCCAGGG + Intronic
915349459 1:155215309-155215331 GTGAAGATCCAGGCATCTCAAGG + Intergenic
915352657 1:155235991-155236013 GTGAAGATCCAGGCATCTCAAGG + Intronic
915832182 1:159141484-159141506 GAGAAGGTCCAGGATTCTCAAGG + Intronic
916088664 1:161289981-161290003 GTGAAGTTTCAGGCAGCTAAAGG + Intergenic
920717578 1:208355193-208355215 GTGGACATCCAGGCATCCCAAGG - Intergenic
921887206 1:220319004-220319026 GTGAAGCTCTAGGGATTTCAGGG + Intergenic
922340091 1:224648062-224648084 GTGAAGAACCAGCCATGTCCAGG + Intronic
1063020346 10:2120689-2120711 GTGAAAATCCAGGCTTTTCCAGG - Intergenic
1063364944 10:5485024-5485046 GAGGAGATACAGGCACCTCAGGG - Intergenic
1063865090 10:10355416-10355438 GAGAAGAGCCAGGTATCACAAGG - Intergenic
1070321505 10:75358269-75358291 GGCAAGGTCCAGGCAGCTCAGGG - Intergenic
1076829602 10:132987607-132987629 AGGAAGGACCAGGCATCTCAGGG + Intergenic
1083024770 11:59541139-59541161 GTGATGATCCAGCCATATCCTGG - Intergenic
1083088653 11:60176877-60176899 GTGAACATGCAGGAAGCTCAAGG - Intronic
1083103665 11:60336445-60336467 GTGAACATGCAGGAAGCTCAAGG + Intronic
1089534673 11:119153762-119153784 GGGAAAATCCACACATCTCATGG - Intronic
1092039268 12:5369176-5369198 GTGAAGGGCCAGGCATCACCTGG - Intergenic
1092087561 12:5775996-5776018 GTGAAGATCTAGGCCTGCCAAGG + Intronic
1096107277 12:49003707-49003729 GGGAAGATCCAGGCAAGTCAGGG - Intronic
1096475952 12:51908916-51908938 CTGAAAATCCAGGCATCACCTGG + Intronic
1096802110 12:54117522-54117544 GACAATATCCAGGCCTCTCATGG + Intergenic
1098606333 12:72395308-72395330 GAGAAGATTAAGGCCTCTCAAGG - Intronic
1099193429 12:79584821-79584843 TTGAAGATTCAGGCTCCTCAGGG + Intronic
1101436469 12:104668852-104668874 GAGAAGACCCAGGCAACTCTGGG + Intronic
1102041205 12:109801917-109801939 CTTAATATCCAGGCATCTGAAGG + Intronic
1103199209 12:119072780-119072802 GTGAAGTGCCTGGAATCTCAGGG - Intronic
1104530899 12:129570317-129570339 CTGTAGTTCCAAGCATCTCATGG + Intronic
1105343694 13:19553426-19553448 GTGAATATCCAGGAATCAAATGG - Intergenic
1105536350 13:21268208-21268230 GTGAATATCCAGGAATCAAATGG + Intergenic
1105591968 13:21800526-21800548 GTGAAAATCCAGGCGTCATAAGG - Intergenic
1108549831 13:51532838-51532860 GTGATGATTCACACATCTCATGG - Intergenic
1112170007 13:96961689-96961711 GTGAAGATCCAGCCCTCTCAAGG + Intergenic
1113773137 13:112924933-112924955 GGGAAGATCCATGTAGCTCAAGG + Intronic
1114482657 14:23045251-23045273 GTGAGGCGCCAAGCATCTCAGGG - Intergenic
1114522492 14:23348031-23348053 GGGAGGATCCTGGGATCTCAGGG - Intronic
1116137125 14:40940821-40940843 GGGAAGCTGCATGCATCTCATGG - Intergenic
1119604304 14:76001587-76001609 GTCAAGATCCAGCCTGCTCAGGG - Intronic
1121035527 14:90700259-90700281 GAAAAGTTCCAGGCATTTCAGGG + Intronic
1121838504 14:97113387-97113409 GTGGCGATGCAGGCATCTTAAGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122087000 14:99314731-99314753 GTGGAGCTCCAGGCATCTCCAGG - Intergenic
1122415964 14:101549591-101549613 GATAAAATCCCGGCATCTCAGGG - Intergenic
1124037652 15:26070931-26070953 GTGAAGACCCAGGCCTCCCAAGG + Intergenic
1125479966 15:40073101-40073123 GGGAAGAGCCTGGCATCCCAGGG + Intergenic
1128893197 15:71349557-71349579 GGGAAAATACAGGCTTCTCAAGG - Intronic
1131156394 15:90078646-90078668 GTGATGCTACTGGCATCTCATGG + Intronic
1134176317 16:12009521-12009543 GTGAAGATGGCAGCATCTCACGG - Intronic
1134310407 16:13070971-13070993 GAGAAGAACCAGGCAGGTCAAGG - Intronic
1136862521 16:33712180-33712202 GGGAAGGGCCAGGCATTTCAGGG - Intergenic
1138217351 16:55215813-55215835 GCGGAGCTCCTGGCATCTCATGG + Intergenic
1138388843 16:56655354-56655376 GTGAAGATCCAGTGATATGAAGG - Intronic
1139976730 16:70818265-70818287 GTGTGGATCCAGAGATCTCATGG + Intronic
1141655736 16:85415499-85415521 GAGCAGAGCCAGGGATCTCAGGG - Intergenic
1203124003 16_KI270728v1_random:1560340-1560362 GGGAAGGGCCAGGCATTTCAGGG - Intergenic
1142894672 17:2966084-2966106 GTGAACATCAGTGCATCTCAGGG - Intronic
1147279305 17:39345428-39345450 ATGAAGATCCTGGTATCTCATGG + Intronic
1150435060 17:65147273-65147295 GTGCAGACCCAGGCAGCTCCAGG - Intronic
1151183620 17:72347715-72347737 GTGATGATACCGACATCTCAGGG + Intergenic
1151279722 17:73064463-73064485 TTTAACCTCCAGGCATCTCAAGG - Intronic
1156233951 18:35183235-35183257 GTGAAGATCCAGGGCTCTGGGGG - Intergenic
1158049819 18:53203448-53203470 GTTAAGAACAAGGAATCTCAAGG + Intronic
1160928810 19:1560111-1560133 GTGAAGAAACAGGCATAGCAAGG - Intronic
1163267054 19:16227795-16227817 CTGCAGAGCCAGGCAGCTCATGG - Intronic
1164585726 19:29474445-29474467 GTGAAAATCCATACATCTGATGG + Intergenic
1164911777 19:32018535-32018557 GTGAAACTCCAGCCACCTCAAGG - Intergenic
1166971061 19:46568213-46568235 CTGGAGCTGCAGGCATCTCAGGG + Intronic
1167862967 19:52299932-52299954 TTGAAGTTCCAGGCATCCAATGG + Intronic
925874255 2:8298538-8298560 GTGAAGATCTGGGTATCACATGG - Intergenic
928279391 2:29930727-29930749 CTGAGGCTCCAGGCATCTGAAGG - Intergenic
928432433 2:31232088-31232110 GTGAAGCTGCAGGGATTTCAGGG - Intronic
930524423 2:52509265-52509287 TTGAAGAACCAAGCATATCATGG - Intergenic
932021778 2:68094813-68094835 GAGCAGCTCCAGGAATCTCAGGG + Intronic
933809984 2:86027141-86027163 GTGAGGCCCCAGCCATCTCAGGG + Exonic
938591113 2:132737050-132737072 ATCAAGACCCAGGCACCTCATGG + Intronic
942921346 2:181376881-181376903 ATGAAGATCCAGACATGTAAAGG - Intergenic
943624038 2:190179931-190179953 GGGCAGATGCAGGCATCACATGG + Intronic
947244308 2:228030162-228030184 GGGATGATCCAGGCTTCTTAAGG + Intronic
948630880 2:239301887-239301909 GTGAGGAGCAAGGCATCTGATGG - Intronic
1168864963 20:1078470-1078492 GAGGAGAGCCAGGCATTTCAAGG + Intergenic
1171349535 20:24492134-24492156 GTGAAACTCCAGGCACCGCAGGG + Intronic
1171794601 20:29556941-29556963 GACAATATCCAGGCCTCTCATGG - Intergenic
1171853851 20:30327323-30327345 GACAATATCCAGGCTTCTCATGG + Intergenic
1174082845 20:47983216-47983238 GTGGAGAGCCAGGGCTCTCAGGG + Intergenic
1174133111 20:48359766-48359788 GTGGAGAGCCAGGGCTCTCAGGG - Intergenic
1177928012 21:27242896-27242918 GTCAAGCTACTGGCATCTCAGGG + Intergenic
1178798940 21:35773697-35773719 CTGAATATCTAGGCATCCCATGG + Intronic
1179818580 21:43923423-43923445 GGAAACATCCACGCATCTCACGG - Intronic
949996143 3:9618950-9618972 GTCAAGACCCAGCCAGCTCAAGG - Intergenic
952225841 3:31374970-31374992 GTAAACTTCTAGGCATCTCATGG - Intergenic
953186263 3:40641014-40641036 CTGAGGCTGCAGGCATCTCAAGG - Intergenic
953358192 3:42272152-42272174 TTGATGATGCAGCCATCTCAGGG - Intergenic
953496485 3:43391784-43391806 CTGAGGCTGCAGGCATCTCAAGG - Intronic
955752323 3:62195623-62195645 ATCTAGATCCAGGAATCTCAAGG - Intronic
957890849 3:86355347-86355369 GTGAATATCCAGGCACATGAAGG - Intergenic
961483064 3:127196470-127196492 GCCAAGATCAAGGCATCTCCAGG - Intronic
961488153 3:127232009-127232031 GAGAAGCTGCAGGCATCCCAGGG - Intergenic
962375327 3:134854117-134854139 TTGAAGCTCCAGGCATATGACGG + Intronic
963460092 3:145601453-145601475 TTGAAGCTCCAGGCATTTCTTGG - Intergenic
966729812 3:183141236-183141258 GAGAATACCCAGGGATCTCAGGG - Intronic
968959502 4:3735717-3735739 TTGAATGTCAAGGCATCTCAGGG - Intergenic
969593002 4:8132544-8132566 GGGATGCTCCAGGCACCTCACGG + Intronic
970695829 4:18675938-18675960 GTCAAGATCCATGAATTTCAGGG + Intergenic
974746071 4:66078154-66078176 GTGAATATCCAGTTTTCTCAAGG - Intergenic
978561245 4:110035677-110035699 GTGAAGTGCCAGGGATCTCAGGG + Intergenic
983974352 4:173915031-173915053 GTGAAGTTGCGGTCATCTCAAGG + Intergenic
986176767 5:5359177-5359199 GAGAAGAACGAGGCATCACAGGG + Intergenic
988685173 5:33518808-33518830 GTGAAGATCCATTCTTCTTACGG - Intergenic
988685679 5:33523016-33523038 GGGAAGAGCCAGGCCTCTCCAGG - Intergenic
989026293 5:37072229-37072251 GTGGAGATCAAGGAATCACATGG + Intergenic
991528644 5:67591771-67591793 GTAAAGCTGCAGGCATCTCCTGG - Intergenic
992007232 5:72489923-72489945 ATCAGGATACAGGCATCTCATGG + Intronic
992485392 5:77189717-77189739 GTGGAGAGCCAGGCTGCTCAGGG + Intergenic
995774868 5:115714014-115714036 GTGAAAATCAAGGCATCTCATGG + Intergenic
1008109292 6:47475676-47475698 GTGAAGATCCTGGAATTTCTAGG + Intergenic
1011399363 6:86943260-86943282 GTGAAGATATTTGCATCTCATGG + Intronic
1018688562 6:166323659-166323681 GTGAAGATTCAGTCATGTCCTGG - Intronic
1019800390 7:3084166-3084188 ATGAAGAATCAGACATCTCATGG + Intergenic
1022974600 7:35545749-35545771 GGGAGGGTCCAGGCATCCCACGG + Intergenic
1033144063 7:138855901-138855923 TTGAGGAACCAGTCATCTCATGG - Intronic
1033149022 7:138897028-138897050 GTAAAGATCCTGGGATCTCAGGG - Intronic
1035577513 8:717218-717240 GTGAAGAGCCCGGGGTCTCAGGG - Intronic
1037513527 8:19607445-19607467 GTGAAGATACAGACAGCTGATGG + Intronic
1038398083 8:27261776-27261798 GTGGAGTTCCAGACTTCTCAGGG - Intergenic
1039947209 8:42140345-42140367 GTGACGGGCCAGGCATCTAAAGG - Intergenic
1040482225 8:47836448-47836470 GTGGAGACCCAGGCCTCCCAGGG - Exonic
1041465965 8:58157900-58157922 GTGATGAACCAAGCATCTCTAGG + Intronic
1047380147 8:124354181-124354203 GTCAAGATCAATGCAACTCAAGG + Intronic
1053122784 9:35558956-35558978 GTGAAAGTACAGGCAGCTCAGGG - Intronic
1053791650 9:41690615-41690637 GACAATATCCAGGCCTCTCATGG + Intergenic
1054153508 9:61624155-61624177 GACAATATCCAGGCCTCTCATGG - Intergenic
1054180051 9:61902630-61902652 GACAATATCCAGGCCTCTCATGG + Intergenic
1054473300 9:65555356-65555378 GACAATATCCAGGCCTCTCATGG - Intergenic
1054657540 9:67678511-67678533 GACAATATCCAGGCCTCTCATGG - Intergenic
1055115132 9:72597792-72597814 GAGAAGATACAGATATCTCAGGG - Intronic
1057578614 9:96265121-96265143 GTGAAGGTGCAGACAGCTCACGG + Intronic
1059334711 9:113561728-113561750 GTGAAGACCAATGCACCTCATGG - Intronic
1186568804 X:10692807-10692829 GTGTAGCTTCAGGCATCTTATGG + Intronic
1189351547 X:40279447-40279469 GTGAAGTTGCAGGCATCTCTGGG + Intergenic
1192777775 X:74262955-74262977 GTTAAGAACCAGACATCTCTTGG - Intergenic
1193052954 X:77120855-77120877 GTGAAGAACCATTCATGTCAAGG - Intergenic
1193608441 X:83597576-83597598 GTGAAGAACCAGGCAAGGCAGGG + Intergenic
1198241493 X:134791655-134791677 GTGAAGCTAAAGGCATTTCAAGG + Intronic
1201702399 Y:16898753-16898775 CTGAAGATCCAGGCCCCACAAGG + Intergenic