ID: 915349982

View in Genome Browser
Species Human (GRCh38)
Location 1:155218212-155218234
Sequence CTGTTTGGAGAGACTGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 355}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915349982 Original CRISPR CTGTTTGGAGAGACTGAAGA CGG Intergenic
900317588 1:2066807-2066829 GTGTTTTGGGAGGCTGAAGAGGG + Intronic
900742870 1:4341347-4341369 CATTTTGTAAAGACTGAAGATGG + Intergenic
900861977 1:5240348-5240370 CTGTTGGGAAAGACTGTAGAAGG + Intergenic
901492895 1:9605673-9605695 CAGTTTGGTGCCACTGAAGATGG - Intronic
902657885 1:17882027-17882049 CTGATTGGTGAGTCTGGAGAGGG - Intergenic
904124754 1:28230318-28230340 CTGTTTTCATAGAGTGAAGAGGG - Intronic
904159322 1:28511058-28511080 CTGTTTGGAAAGTCTAAAAAAGG - Intronic
905615456 1:39394509-39394531 CTGTTTGGGGAGGCTGAGGCAGG + Intronic
907510082 1:54951354-54951376 CTGGTTGGTGAGATTGGAGATGG + Intergenic
909325441 1:74346280-74346302 GTGTTTGGAGAGACAGTAGATGG + Intronic
909390676 1:75117593-75117615 CTGTGTTGAGACACTTAAGAAGG - Intergenic
910086476 1:83409287-83409309 CAGTTTGGAGAAATTCAAGAAGG - Intergenic
910315812 1:85882351-85882373 CTACTTGGAGAGGCTGAGGAAGG + Intronic
911551013 1:99280655-99280677 CTGAGTGGAGAGCCTGGAGAAGG + Intronic
911719477 1:101175045-101175067 CTATGTGGAGAGACAAAAGAGGG - Intergenic
913041836 1:115034490-115034512 CTGTTAGGAGAGACTGTTCAAGG - Intergenic
913172149 1:116242831-116242853 CTTTTTGGAGAGAGTTCAGAAGG - Intergenic
913792929 1:122561479-122561501 CTGTTTGTAAAGTCTGAAGGTGG + Intergenic
913845644 1:123506437-123506459 CTGTTTGTAAAGTCTGAAGGTGG + Intergenic
913887091 1:124250011-124250033 CTGTTTGTAAAGACTGCAGGTGG + Intergenic
913887969 1:124265463-124265485 CTGTTTGTAAAGACTGCAGGTGG + Intergenic
913901847 1:124514464-124514486 CTGTTTGTAAAGTCTGAAGGTGG + Intergenic
913908941 1:124641580-124641602 CTGTTTGTAAAGTCTGAAGGTGG + Intergenic
914381323 1:147119012-147119034 TTGTTTGCAGAGAATGATGAAGG - Intergenic
915192493 1:154163574-154163596 CTGATTGGAGGGAAAGAAGACGG - Intronic
915349982 1:155218212-155218234 CTGTTTGGAGAGACTGAAGACGG + Intergenic
915353328 1:155240138-155240160 CTGCTAGGAGAGACTGAACACGG + Intronic
916013876 1:160731061-160731083 CACTTTGGAGAGGCTGAGGAGGG - Intergenic
917579033 1:176355322-176355344 CTGTTTGGAGGGACTGATGCAGG + Intergenic
918685635 1:187411275-187411297 CTGTGTGGAGAGAAATAAGAGGG - Intergenic
920425233 1:205869699-205869721 CTTTCTGGAGAGACTCAGGAAGG - Intergenic
921069820 1:211649597-211649619 CTGGCTGGAGAGTCTGGAGATGG - Intergenic
922068528 1:222168245-222168267 TTGTGAGGAGAGAATGAAGATGG - Intergenic
922448554 1:225718186-225718208 CTGCTGGGAGAGACATAAGAGGG + Intergenic
923644885 1:235809202-235809224 CCATTTGAAGAGACTGCAGATGG - Exonic
1063044046 10:2373597-2373619 CTGTTTGGAAAAAAAGAAGAAGG + Intergenic
1065434886 10:25695598-25695620 GTGATTGGAGAGAGTGAAGATGG + Intergenic
1066812829 10:39363243-39363265 CTGTTTGTAGAATCTGAAGAGGG - Intergenic
1066929752 10:41742656-41742678 CTGTTTGTAGAAACTGCATAGGG + Intergenic
1068141470 10:53013577-53013599 CTGTCTGGAGAGACAAAAAAAGG - Intergenic
1068647867 10:59489185-59489207 CAGTTTTTAGAGACTGAAAAGGG - Intergenic
1068739773 10:60455935-60455957 TTGGTTGGATAGATTGAAGAGGG - Intronic
1069496337 10:68906831-68906853 CTAAATGGAGACACTGAAGAAGG + Exonic
1071567229 10:86677625-86677647 CTGTGTGGTTACACTGAAGATGG + Intronic
1072007721 10:91270491-91270513 CTCTTTGGAGAGAAAGGAGAAGG + Intronic
1072231626 10:93418682-93418704 CTGTATGGAGAGCCTGATGCAGG - Intronic
1073113417 10:101076426-101076448 GAGTTTGGAGAGACTGATGAGGG + Intergenic
1073546608 10:104354482-104354504 CTCATTGGAGAGGCTGAAAATGG - Intronic
1074733400 10:116401620-116401642 TGGTCTGGAGAGAATGAAGAAGG + Intergenic
1074908653 10:117887219-117887241 CTGCTTTGTGAGACTGGAGAAGG - Intergenic
1075488404 10:122846405-122846427 ATGTCTGGAGAGACTGAAGCAGG + Intronic
1076570446 10:131429331-131429353 CTGTCTGGAGAGTGAGAAGAGGG - Intergenic
1077474814 11:2781383-2781405 CCGTATGGAGAGGCTGAGGAGGG + Intronic
1077561005 11:3261012-3261034 CTGTTTAGGAACACTGAAGAAGG - Intergenic
1077566902 11:3306842-3306864 CTGTTTAGGAACACTGAAGAAGG - Intergenic
1078600634 11:12727309-12727331 CTGGATGGAGAGACTGACGCAGG + Intronic
1079371359 11:19855722-19855744 CTCCTTGGAGAGACAGAAGGGGG - Intronic
1080464708 11:32485956-32485978 CAGTCTGGAGACACTGGAGACGG + Intergenic
1080866324 11:36198627-36198649 CTGTCAGGTGAGAGTGAAGAAGG - Intronic
1081626541 11:44659338-44659360 AGGGATGGAGAGACTGAAGAAGG + Intergenic
1082132989 11:48513778-48513800 CTCTTTGCAGAGACTGGAAAGGG + Intergenic
1082134080 11:48527717-48527739 ATCTTTGGAGAGACTGGAAAGGG + Intergenic
1082139468 11:48591280-48591302 CTCTTTGCAGAGACTGGAAAGGG + Intergenic
1082234196 11:49803094-49803116 CTGTCTGGTGAAACTGGAGAAGG - Intergenic
1082277923 11:50241679-50241701 CTGCTTTGAGAGTCTGAAGCGGG - Intergenic
1082566417 11:54684336-54684358 CTCTTTGCAGAGACTGGAAAGGG + Intergenic
1082567104 11:54694102-54694124 ATCTTTGGAGAGACTGGAAAGGG + Intergenic
1082569925 11:54726425-54726447 CTCTTTGCAGAGACTGGAAAGGG + Intergenic
1082612624 11:55320015-55320037 CTCTTTGCAGAGACTGGAAAGGG + Intergenic
1082613181 11:55327399-55327421 ATCTTTGGAGAGACTGGAAAGGG + Intergenic
1082618333 11:55390085-55390107 CTCTTTGCAGAGACTGGAAAGGG + Intergenic
1082620302 11:55412298-55412320 ATCTTTGGAGAGACTGGAAAGGG + Intergenic
1082624649 11:55468323-55468345 CTCTTTGCAGAGACTGGAAAGGG + Intergenic
1083221368 11:61254911-61254933 GTGTTTGGAGAGACAGCTGATGG - Intergenic
1084502686 11:69544280-69544302 CTCTATGGAGAGAATGAAGCAGG + Intergenic
1084756196 11:71240392-71240414 CTGTTTGGAGGAACAGGAGAGGG - Intronic
1085089419 11:73697591-73697613 GTGTTTTGGGAGACTGAAGCAGG - Intronic
1085126178 11:74004209-74004231 CTGTTTGAGGAAACTGAAGTCGG + Intronic
1085350596 11:75795843-75795865 CAGTTTGGAGAGACTGACAGTGG + Intronic
1086187461 11:84035722-84035744 TTGTGTGAAGAGACTGTAGAGGG + Intronic
1086480290 11:87228620-87228642 GTCTTTGGAGATACTCAAGAAGG + Intronic
1086617391 11:88838337-88838359 CTGTCTGGTGAAACTGGAGAAGG + Intronic
1086943479 11:92821853-92821875 CTGGTTGCAGACACTGTAGAAGG - Intronic
1088657500 11:112014574-112014596 CTGTATTGGAAGACTGAAGATGG - Intronic
1088809870 11:113385048-113385070 TTGTTTGGGCAGATTGAAGATGG - Intergenic
1089103308 11:115982188-115982210 CTGCTTGGAGTGGCTGGAGAAGG + Intergenic
1089111959 11:116064284-116064306 CTGTTTTGGGAGAGTAAAGAGGG - Intergenic
1090333311 11:125947474-125947496 CTGTTTGGATGCACTGAAGGAGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091343546 11:134837977-134837999 CTGATTGGACCCACTGAAGAGGG - Intergenic
1092783078 12:12005229-12005251 CAGGTTTGAGAGACTGAAGTGGG - Intergenic
1092940705 12:13404569-13404591 GTGTTTGGAGAGCATGAACAAGG - Intergenic
1093790808 12:23248033-23248055 GTGCTTTGAGAGACTGAAGCAGG + Intergenic
1094717910 12:33031981-33032003 TTGTTTGAGGAGGCTGAAGATGG + Intergenic
1094877183 12:34662640-34662662 CTTTTTGTAGAATCTGAAGAGGG + Intergenic
1094879001 12:34692157-34692179 CTGTTTGTAAAGTCTGAAGGTGG + Intergenic
1095494476 12:42770129-42770151 CTGTTTGCAGTGTCTGAAGTAGG + Intergenic
1095755707 12:45764527-45764549 CGGTTGCCAGAGACTGAAGATGG - Intronic
1096191944 12:49624975-49624997 CTGTTTGGGGCAGCTGAAGAAGG + Intronic
1096511573 12:52132640-52132662 TTGCTTGGAGAAACTGTAGATGG + Intergenic
1099115890 12:78623509-78623531 CTATTTCAAGAGACTTAAGAAGG - Intergenic
1100152821 12:91761580-91761602 TTGTTTGGAAAGGCTGAAGGAGG - Intergenic
1103231713 12:119336551-119336573 CTCTATGGAGAGGCTGCAGAGGG + Intronic
1103482156 12:121257675-121257697 CTGGTTGATGAAACTGAAGATGG - Intronic
1103590712 12:121990280-121990302 CTGTTTGGAGAGTATAGAGAAGG - Intronic
1103748569 12:123143156-123143178 CTGTCTAGAGAGACAGCAGAGGG + Intronic
1103876546 12:124131903-124131925 CTGATTGGCCAGACTGGAGATGG - Intronic
1104657951 12:130587958-130587980 CTGTGTGGAGGGACAGAGGAAGG - Intronic
1105978261 13:25492813-25492835 CTGTTTGGAGTGTCTGAGGCAGG + Intronic
1106090117 13:26583799-26583821 CTATTTGAAGAGACTGAAACAGG - Intronic
1106247932 13:27964760-27964782 ATCTGTGGAGAGACTGAAGCAGG - Intronic
1107222115 13:37995271-37995293 CTGTTCTGAGAGACTGCACATGG - Intergenic
1109682394 13:65769779-65769801 CAGTTAGGAGATACTAAAGATGG + Intergenic
1111124745 13:83899818-83899840 CTGTTTGGAGAATCAGATGAAGG - Intergenic
1113845466 13:113387116-113387138 TTGTTTGAGGAGGCTGAAGATGG + Intergenic
1113998442 14:16117338-16117360 CTTTTTGTAGAATCTGAAGATGG + Intergenic
1114063498 14:19039707-19039729 CCGTGTGTAGAGACTGAAAAAGG - Intergenic
1114098758 14:19360289-19360311 CCGTGTGTAGAGACTGAAAAAGG + Intergenic
1114417006 14:22551658-22551680 CTGTTTGGAGAGGGAGAAGAGGG - Intergenic
1114492841 14:23113964-23113986 CTGTGGGGAGACACTGCAGAGGG - Intergenic
1114560819 14:23589192-23589214 CTGGTGGGAGAGGGTGAAGATGG + Intergenic
1115607784 14:35022190-35022212 ATGTTTGGAGGGCCTGGAGAGGG + Intronic
1118108056 14:62682985-62683007 CTATCTGAAGAGACGGAAGATGG + Intergenic
1118477232 14:66128841-66128863 TTGGTTTGAGAGACTGAAGCAGG - Intergenic
1120391133 14:83909959-83909981 TTGTTTGGTGAGAGTGAAGGTGG + Intergenic
1120901164 14:89576778-89576800 CAGTTGGGAGAGACGGAGGAGGG - Intronic
1122410121 14:101521536-101521558 CTGTTAGGAGACACGGGAGAAGG + Intergenic
1124263827 15:28215790-28215812 CTGTTTGGAGAAGCTGCAGGAGG + Exonic
1124314249 15:28654264-28654286 CTGTTTGGAGAAGCTGCAGGAGG - Intergenic
1127181111 15:56419052-56419074 CTGCTTGGAAAAATTGAAGAAGG - Intronic
1128358047 15:66942210-66942232 CTGTTTGGTGAGGCTGAGGTAGG + Intergenic
1130263160 15:82375443-82375465 TCGTTTGGAGAGAGTGTAGAAGG + Intergenic
1131082946 15:89552294-89552316 CTGTTTTAACAGACTCAAGAGGG - Intergenic
1133143517 16:3766014-3766036 TTGTTTGAAGAGACTGATGGTGG + Intronic
1134027208 16:10963588-10963610 CTGGGTGGAGGGACTGAAGCAGG - Intronic
1134430829 16:14204220-14204242 GTGTTTGGGGAGGCTGAAGAGGG - Intronic
1136097336 16:27966618-27966640 CTGGGAGGAAAGACTGAAGAGGG - Intronic
1136467508 16:30455123-30455145 CTGATCAGAGAGACTGAGGAAGG + Intergenic
1136765521 16:32773472-32773494 CTGTTTGGAGAAGCTGCGGAAGG - Intergenic
1136802578 16:33096907-33096929 CTGTTTGGAGAAGCTGCGGAAGG + Intergenic
1137115776 16:36629212-36629234 CTGTTTGGAAAGTCTGCACATGG + Intergenic
1137156342 16:37300512-37300534 CTGTTTGGAAAGTCTGCACATGG + Intergenic
1137198030 16:37990409-37990431 CTGTTTGGAAAGTCTGCAGGTGG + Intergenic
1139531026 16:67542843-67542865 GTGTTTGGAGGGGCTGGAGAGGG - Exonic
1140208814 16:72954832-72954854 CTGTTTGATGATACTAAAGAGGG + Intronic
1140516558 16:75547036-75547058 CTGTTTGGCAAGACTGTGGATGG - Intronic
1140891949 16:79292394-79292416 CTTTTCCGAGAGCCTGAAGAGGG + Intergenic
1143214048 17:5210764-5210786 CTTTTTGGCAAAACTGAAGAGGG - Exonic
1143386770 17:6535560-6535582 GTGTGTGGAGAGGCAGAAGATGG + Intronic
1144443020 17:15301065-15301087 CTGTTTAGAGAGAGGGATGAGGG + Intergenic
1146866906 17:36344662-36344684 CTACTTGGGGAGACTGAAGCAGG + Intronic
1147291070 17:39443559-39443581 CTGTTTGGAGACATTGCAGAAGG - Exonic
1147779994 17:42934319-42934341 CTGTGTTGAGAGACTGTAGGGGG - Intergenic
1148188278 17:45660417-45660439 TTGTTTGCAGAGACAGAACAGGG - Intergenic
1148581422 17:48746783-48746805 TTCTTTGGAGGGACTGATGAGGG + Intergenic
1152299681 17:79487798-79487820 CTGCTTGGAGAGGCTGAGGCAGG + Intronic
1152366034 17:79856996-79857018 ATGGTAGAAGAGACTGAAGAGGG + Intergenic
1155053721 18:22168548-22168570 CTGTTTGGAGGGAGCGAAGAGGG + Intergenic
1155438567 18:25837723-25837745 GTGTTTTGAGAGGCTGAAGCAGG + Intergenic
1156474703 18:37398137-37398159 CTGTTGGGAGAGAGTGAAGGAGG + Intronic
1157117953 18:44880114-44880136 CTGTTTGGAGAGACTGCACTAGG + Intronic
1157439471 18:47699321-47699343 ATGTTAGGAGAGACTTCAGAGGG - Intergenic
1157969750 18:52252976-52252998 TTGTTAGGATAGACTGGAGAAGG - Intergenic
1158701126 18:59748087-59748109 GTGTTTGAAGAAACTGAACATGG - Intergenic
1158829096 18:61258429-61258451 GTCTTTGTAGAGACTCAAGAAGG - Intergenic
1162193896 19:8968660-8968682 CTGTTGGGGGAGGCTGAAGTTGG + Intronic
1163183060 19:15617564-15617586 ATCTATGGAGAGACAGAAGAGGG + Intronic
1163695641 19:18761993-18762015 CTATCTGGAGACAATGAAGAGGG - Intronic
1164251877 19:23484508-23484530 TTGTTTGAGGAGGCTGAAGATGG - Intergenic
1164364034 19:27553731-27553753 CTGTTTGTAGAATCTGAAAAGGG + Intergenic
1164828650 19:31303233-31303255 CTCTGGGAAGAGACTGAAGATGG + Intronic
1164920098 19:32082933-32082955 ATGTTTGGACAGACTCAAGGTGG - Intergenic
1165993230 19:39827510-39827532 CTCATTGGAGCCACTGAAGAGGG + Exonic
1166126492 19:40718015-40718037 CTCTTGGGAGAGCCTGAGGATGG + Exonic
1166643235 19:44512260-44512282 CTGTTTGGTGACACAGATGAGGG + Intronic
1166938174 19:46347429-46347451 CTCAGTGGAGAGACTGAGGAGGG + Intronic
1167494844 19:49811639-49811661 CAACGTGGAGAGACTGAAGAAGG - Exonic
1167566971 19:50262708-50262730 CTGATAGGAGAGGCTGGAGAAGG + Intronic
924998782 2:387068-387090 CTGTTTGGAGAAAGTGAAGGGGG - Intergenic
926855444 2:17251365-17251387 TGGGTGGGAGAGACTGAAGAAGG + Intergenic
927142179 2:20137887-20137909 GTTTTTGGAGAGAATGAATAAGG - Intergenic
927558343 2:24050969-24050991 CAGGGAGGAGAGACTGAAGATGG - Intronic
927631245 2:24776098-24776120 TTGTTTAGAGAGAGTGTAGAGGG - Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927995994 2:27486776-27486798 TTATTTTGAGAGACTGAAGGAGG + Intronic
928532003 2:32201919-32201941 CTAAATGGAGACACTGAAGAAGG + Intronic
928538503 2:32262526-32262548 GTGCTTGGGGAGACTGAGGAGGG + Intronic
928872358 2:35995070-35995092 AGGTTTGGAGAGGGTGAAGAGGG - Intergenic
929458923 2:42086848-42086870 CTGACTGGAGGGACTGATGAAGG - Intergenic
930385166 2:50685273-50685295 ATTTTTAGAGAGACTGTAGAAGG - Intronic
931570565 2:63664957-63664979 CTGCATGGAGAGGATGAAGATGG + Intronic
933191535 2:79339117-79339139 CTGTAGGGAGAGAGTGAACAGGG + Intronic
933553245 2:83802172-83802194 CTGCTTGGAGAGGCTGAGGCAGG - Intergenic
933940239 2:87239163-87239185 CTGTTTGGCCACACTGAAGTTGG - Intergenic
936352899 2:111726613-111726635 CTGTTTGGCCACACTGAAGTTGG + Intergenic
936601188 2:113896391-113896413 CTGATTTGAGAGATTGAAGGAGG + Intronic
937081815 2:119145626-119145648 CTGTTTGGAGAAAGCGAAGAAGG + Intergenic
938009212 2:127815100-127815122 GTGTTTTGAGAGGCTGAAGTGGG - Intergenic
938108678 2:128550183-128550205 CTTTTGGGAAAGGCTGAAGAGGG + Intergenic
938710651 2:133973672-133973694 CTGTTGGGAGACACTGAGGAAGG - Intergenic
938973575 2:136454526-136454548 CTATTTAGAGACACTGATGAAGG - Intergenic
939548797 2:143588020-143588042 CTGTTTGGAAAGAAGGAAGAGGG - Intronic
940279819 2:151977580-151977602 TTGTTTGGACAGAGAGAAGAAGG + Intronic
942486758 2:176447985-176448007 CTATCTTGAGAGACTGAAGATGG + Intergenic
942803053 2:179898231-179898253 CTGTTTGGAAAGAGTGAAAATGG - Intergenic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
946224876 2:218259121-218259143 CTGGATGGAGCGTCTGAAGACGG + Intergenic
947496231 2:230639450-230639472 CTATTTGGGGAGGCTGAGGAGGG - Intergenic
947651113 2:231786804-231786826 CTATTTGGATGGACTGGAGAGGG - Intronic
947703731 2:232257507-232257529 CTGTTTGGAGTGACGGAGGGTGG - Intronic
948232450 2:236360138-236360160 CTGTTTGGTGAGTCAGAAAATGG + Intronic
1169180315 20:3560136-3560158 CTGGTGGGGGAGAATGAAGAAGG - Intronic
1171146469 20:22788186-22788208 CTGCTGGGAGAGACTGAGGCTGG - Intergenic
1171764266 20:29246333-29246355 CTTTTTGTAGAATCTGAAGATGG - Intergenic
1171788555 20:29497195-29497217 CTGTGCGGAGAGGCTGAAGCCGG + Intergenic
1171809378 20:29729846-29729868 CTTTTTGTAGAATCTGAAGATGG - Intergenic
1173033813 20:39389352-39389374 CTGTCTAGAGAGAGAGAAGAAGG - Intergenic
1173383054 20:42563714-42563736 CCTTTTTGAGAGACTGAAGTAGG + Intronic
1174098286 20:48106937-48106959 CTGGCTGGAGAGACAAAAGACGG - Intergenic
1174902996 20:54520671-54520693 CTACTTGGAAAGACTGAAGCAGG + Intronic
1176324965 21:5386538-5386560 CTTTTTGGAGAATCTGAAAAGGG - Intergenic
1176483041 21:7326264-7326286 CTTTTTGTAGAATCTGAAGATGG - Intergenic
1176531459 21:7964667-7964689 CTTTTTGTAGAATCTGAAGATGG + Intergenic
1176762188 21:10811891-10811913 CTTTTTGTAGAATCTGAAGATGG - Intergenic
1177625680 21:23656448-23656470 CACTTTGGAGAGACTGACAAAGG - Intergenic
1178301013 21:31453078-31453100 CTGTTTGGAGAGGATAAAGAAGG + Intronic
1179210185 21:39317937-39317959 CTATTTGGGGAGACTGAGGCAGG + Intronic
1179588021 21:42386157-42386179 ATGTTTGGAGAGTCACAAGATGG + Intronic
1180481992 22:15762341-15762363 CCGTGTGTAGAGACTGAAAAAGG - Intergenic
1181883524 22:26000321-26000343 CTGATTGGAGTGACAGAGGAAGG + Intronic
1182652742 22:31865380-31865402 GTTATTTGAGAGACTGAAGAGGG + Intronic
1183148645 22:36018960-36018982 GGGTTTGAAGAGACTGAAAAGGG + Intronic
1183539667 22:38422857-38422879 CAGGATGGAGAGAATGAAGAGGG - Intergenic
1184978421 22:48079487-48079509 CTACTTGGAGAGACTGAGGCAGG + Intergenic
950140791 3:10613746-10613768 CTGTTTGGAGAGTCTGCTGCAGG - Intronic
950221045 3:11196311-11196333 CTGCTTAGGGAGGCTGAAGAGGG - Intronic
950876813 3:16282933-16282955 CTGCTTTGAGAGACACAAGAAGG + Intronic
951837851 3:27002546-27002568 CTTTCTGGAGAGACTAAAGGAGG + Intergenic
952073048 3:29662323-29662345 CTGTTTATAGACACTGAAAAGGG + Intronic
952192115 3:31034818-31034840 CAGTTTGGGGGGACTGATGAAGG + Intergenic
952261564 3:31745417-31745439 CTGTTTGGGGAATTTGAAGAAGG + Intronic
953328132 3:42029880-42029902 CTGTGTGGAGAGCCAGAATAGGG + Intronic
953823140 3:46226435-46226457 CTTTTTGGAGCAACTGAAAATGG + Intronic
954009004 3:47618433-47618455 CTGCTTGGGGAGGCTGAGGAGGG + Intronic
954362625 3:50130290-50130312 CAGTTTCAAGAGGCTGAAGAAGG - Intergenic
956093630 3:65693618-65693640 CTCTTTGGAGAGACCAAAGGCGG + Intronic
956191241 3:66610341-66610363 CTGGTTGGTGGGAGTGAAGAGGG + Intergenic
956232093 3:67028935-67028957 GTGTTTTGGGAGGCTGAAGAGGG + Intergenic
956247753 3:67203287-67203309 CTGTTAGGAGACAATCAAGAGGG + Intergenic
956935468 3:74095970-74095992 CTGTTTGTACAGTCTGAAAAGGG - Intergenic
956952157 3:74295200-74295222 CTATTTGCAGAGACTTGAGATGG + Exonic
957846572 3:85744593-85744615 ATGTTTGGACAGAATGAAGGTGG + Intronic
958039525 3:88209273-88209295 CTGATTAGAGAGACTGGACAGGG - Intergenic
959948651 3:112153316-112153338 ATATTTGGAGGGATTGAAGAAGG - Intronic
961714338 3:128848395-128848417 CTTCTGGGAGAAACTGAAGAGGG - Intergenic
961842148 3:129723675-129723697 CTATTTGGACAGAATGTAGAGGG - Intronic
962033422 3:131625271-131625293 TTGTTTAGAGAGAATGGAGAAGG - Intronic
962902604 3:139774353-139774375 CTGATGGGAGAAACAGAAGAAGG - Intergenic
963610130 3:147456676-147456698 TTGTTTGGGGAGACTGCAGGGGG + Intronic
964221679 3:154354100-154354122 CTAAATGGAGACACTGAAGAAGG - Intronic
966353213 3:179054025-179054047 ATGTTTGGGGAGTCTGAATAAGG + Intronic
966876285 3:184323711-184323733 CTGTTGGGAGGGACAGGAGAGGG - Intronic
968484131 4:850592-850614 GTGTTTGCAGAGACTGTTGAGGG - Intronic
968980992 4:3849235-3849257 GAGATGGGAGAGACTGAAGAAGG - Intergenic
970513360 4:16802539-16802561 CTGTTTGAAGAGACACAAAAGGG + Intronic
970838384 4:20438139-20438161 CTGTTTGGAGAATCATAAGAAGG - Intronic
972452111 4:39211658-39211680 TTCTTTGGAGTGACTGAAAATGG - Intronic
972967686 4:44531703-44531725 GTATCTGGAGAGGCTGAAGAGGG - Intergenic
973153368 4:46915409-46915431 ATGTTTAGAGCAACTGAAGAGGG - Intergenic
974206889 4:58715601-58715623 CTGTTTGGGAAGAATGAATATGG - Intergenic
977423651 4:96837393-96837415 CTTTTTGGAAGGACTGAAGGAGG - Intergenic
978813797 4:112879854-112879876 CTGGCTGGAGACACAGAAGAAGG - Intronic
979047960 4:115893983-115894005 CTCTCAGGAGAGAATGAAGAGGG - Intergenic
979127736 4:116997827-116997849 GTGTTTTGGGAGACTGAGGAAGG + Intergenic
980304325 4:131037771-131037793 TTGTTTGGAGAGAAAGAAGTAGG - Intergenic
981825011 4:148929950-148929972 TTGTTTGAGGAGGCTGAAGATGG - Intergenic
983566734 4:169161008-169161030 CAGTTTGGAAAGCCTGCAGAAGG - Intronic
983795019 4:171851420-171851442 CAATATGGAGAGACTGATGAGGG - Intronic
983976451 4:173940021-173940043 CTGTTTGGATAAACTAAAGCTGG + Intergenic
987264082 5:16234220-16234242 CAATTTAGAGAGACAGAAGAAGG - Intergenic
990112800 5:52348668-52348690 CTCTTTGGAGATGGTGAAGATGG + Intergenic
994028677 5:95114942-95114964 CTGTTTGGAGAAAGTAAGGAAGG + Intronic
994527401 5:100924174-100924196 TTGTTTGAGGAGACTGCAGATGG + Intergenic
995358713 5:111269238-111269260 CTGATTGGAGAGAATTGAGAAGG + Intronic
997619557 5:135276937-135276959 CTGTTTGGAAAGATGGCAGATGG - Intronic
997640620 5:135446531-135446553 CTGTTAGGAGAAAGTGAAGGTGG + Exonic
998164853 5:139837109-139837131 GGGGTTGGAGAGACTGCAGAGGG + Intronic
998521166 5:142801923-142801945 CTGTCTGGTGAGACTGGAGTGGG + Intronic
998907410 5:146920922-146920944 CTCTTTGGAGAGAATTAAAATGG + Intronic
999450007 5:151670877-151670899 GTCTCTGGAGAAACTGAAGATGG + Intronic
1000965274 5:167648544-167648566 CTGTTAGGAGAAAATGAGGAAGG - Intronic
1002018851 5:176348758-176348780 TGGCTTGGAGAGACTGAGGATGG - Intronic
1004435344 6:15587228-15587250 CTGCTTAGAAAAACTGAAGATGG + Intronic
1005072668 6:21876013-21876035 TTGTTTGAGGAGGCTGAAGATGG - Intergenic
1006298903 6:33182928-33182950 CTGTTTGGTCAGAATGAAGGTGG - Intronic
1006415191 6:33899504-33899526 GTATTTGGAGAGACTTTAGATGG + Intergenic
1006528025 6:34625055-34625077 CTCTTTGGAGAGAATGTTGATGG - Intronic
1007451450 6:41942597-41942619 CTGTTTGGAGAAACTGTGGACGG + Intronic
1007491974 6:42230176-42230198 CTGCTTGGACACACTGAAAATGG + Intronic
1007518252 6:42430376-42430398 CTTTTTGGAGTGAGGGAAGATGG - Intronic
1008217151 6:48806639-48806661 CTGTCTTTAGAGACTGGAGAGGG + Intergenic
1009253760 6:61348149-61348171 CTTTTTGTAGAAACTGCAGAGGG + Intergenic
1009258446 6:61449970-61449992 CTTTTTGTAGAAACTGCAGAGGG + Intergenic
1009453347 6:63826582-63826604 TTGTTTGAGGAGGCTGAAGATGG - Intronic
1010153732 6:72767104-72767126 GAGTTGGGAGAGACTGGAGAAGG + Intronic
1010782069 6:79955080-79955102 CTCTTTGGAGAAACAGAAGGAGG - Intergenic
1012037041 6:94155467-94155489 CTCTTATGAGAGTCTGAAGAAGG + Intergenic
1012843531 6:104361217-104361239 CTCTTTGTAAAGACTGAAGTTGG - Intergenic
1015111796 6:129600824-129600846 CTCTTTGGAGAAATTCAAGAAGG + Exonic
1016343270 6:143084698-143084720 CTTTCTGGAGAGACTAAGGAAGG - Intronic
1016594189 6:145780992-145781014 CTGTTTGAAGATACTACAGAGGG - Intergenic
1017172823 6:151473884-151473906 CTATTTGGGGAGGCTGAAGCAGG - Intergenic
1017298024 6:152821835-152821857 CTCTCTGGAGAGGCTGCAGATGG - Intergenic
1017366677 6:153649856-153649878 CTGTTTGGATAGATTAAAGGTGG - Intergenic
1017905576 6:158755605-158755627 CTGTTTGCAGAGGCTGAAGGAGG + Intronic
1019353028 7:564092-564114 CTCTGTGGGGAGACTGAACAGGG - Intronic
1023317212 7:38951717-38951739 CTATATGGAGACACAGAAGACGG + Intergenic
1023553746 7:41398601-41398623 TACTTTGAAGAGACTGAAGAAGG - Intergenic
1024550535 7:50559269-50559291 CTGTGTTGAGAGACAGCAGAGGG - Intronic
1024782474 7:52867005-52867027 CTGTTTAAGGAGATTGAAGATGG - Intergenic
1025518418 7:61685801-61685823 CTGTTTGTAGAAACTGCAAAGGG - Intergenic
1025522137 7:61749625-61749647 CTTTTTGTAGAGACTGCAAAAGG - Intergenic
1025542743 7:62114448-62114470 CTGTTTGTAGAAACTGCAAAGGG - Intergenic
1025545868 7:62167743-62167765 CTTTTTGTAGAGACTGCAAAAGG - Intergenic
1026309896 7:69174356-69174378 CTATTTGGGGAGTCTGACGAAGG - Intergenic
1026583113 7:71634217-71634239 CCGTGTGGAGCCACTGAAGATGG + Intronic
1026671249 7:72392461-72392483 CTGATGGGAGAGACTGAGGAAGG + Intronic
1027146705 7:75700596-75700618 GTGTTTTGAGTGACTGTAGATGG - Intronic
1027303359 7:76865774-76865796 CAGTTTGGAGAAATTCAAGAGGG - Intergenic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1029084994 7:98004329-98004351 GTGTTTGGGGAGGCTGAAAAAGG - Intergenic
1029284281 7:99455355-99455377 CTGTATGGAGAGGCTGCCGATGG - Intronic
1029361652 7:100092586-100092608 CTGTTTGGAGATACTTAAGATGG - Intergenic
1030707421 7:112708676-112708698 CTGTTTTGAGAGCTTGAAGTGGG + Intergenic
1031046031 7:116888721-116888743 CTGTTTTGAGAGGCTGAGGTTGG + Intronic
1031066827 7:117114512-117114534 GTGATGGCAGAGACTGAAGAAGG - Intronic
1031571574 7:123365866-123365888 CTGATTTGGGAGACTAAAGAAGG - Intergenic
1033564036 7:142561292-142561314 GAGTTAGGAGAGAATGAAGAGGG - Intergenic
1033564419 7:142564603-142564625 GAGTTAGGAGAGAATGAAGAGGG - Intergenic
1036889182 8:12584446-12584468 CTGTTTGCAGAGTCTTAAAATGG - Intergenic
1036954763 8:13175883-13175905 GTGTTTGCAGGGACTGGAGAAGG - Intronic
1037350992 8:17955460-17955482 CTTTGTGGAGAGGCTGAAGAAGG - Exonic
1038670355 8:29578109-29578131 CTGTTTAGAGAGAATGAAAGAGG - Intergenic
1039265836 8:35823011-35823033 CTGAGTGGACAGACTGAGGAGGG - Intergenic
1039552315 8:38451932-38451954 TTGTTTGGAAAGACTGAAGCCGG - Intronic
1040127243 8:43751841-43751863 CTTTTTGGAGAGTCTGTAAAGGG + Intergenic
1040615952 8:49038652-49038674 CAGTGTGGAGACACTGAACAAGG - Intergenic
1043496439 8:80805940-80805962 CTGTTTGAAGACACTGATGATGG - Intronic
1044303080 8:90607915-90607937 AAGTTTGGAGAAATTGAAGAGGG - Intergenic
1044356462 8:91228229-91228251 ATGGTTGGAGTGAGTGAAGATGG + Intronic
1045541319 8:103088809-103088831 TTGTTTGTTGAGACTGATGAAGG - Intergenic
1045855913 8:106765378-106765400 CTGTATGGAGAAAGTGAAAATGG + Intronic
1046846926 8:118927708-118927730 CTGTTTGGGGAGAGTCAAGCTGG + Intronic
1050987878 9:12105690-12105712 TTGTTTAAAGAGACTAAAGATGG - Intergenic
1051538251 9:18184506-18184528 CTTTTTGGAGTGAGTAAAGAAGG + Intergenic
1052937003 9:34101317-34101339 GTATTTCGAGAGACTGAAGCAGG - Intronic
1053714422 9:40872112-40872134 CTTTTTGGAGAAACTCAAAATGG + Intergenic
1055190404 9:73514243-73514265 CTGTCTGGAATGTCTGAAGAAGG - Intergenic
1055426215 9:76199701-76199723 CTCCTTGGAGAGAGTGTAGAAGG - Intronic
1056888824 9:90470244-90470266 CTGCTGGGACAGACTGAAGTGGG + Intergenic
1056937018 9:90923450-90923472 CTGTGTGGTGAGGCTGCAGAGGG - Intergenic
1057059842 9:91993936-91993958 CAGCTTGGAGAGGCTGAAGCAGG + Intergenic
1057278328 9:93689124-93689146 CTGTCAAGAGAAACTGAAGAAGG + Intergenic
1059613955 9:115928922-115928944 CTTTTTAGAGATATTGAAGAGGG - Intergenic
1062234835 9:135502785-135502807 GTGTTTGGAGTCAGTGAAGAGGG + Intronic
1203383207 Un_KI270435v1:82765-82787 CTTTTTGTAGAATCTGAAGATGG - Intergenic
1203402829 Un_KI270519v1:130416-130438 CTTTTTGTAGAATCTGAAGATGG - Intergenic
1185751318 X:2611710-2611732 CTGTATGAAGAATCTGAAGATGG - Intergenic
1186098570 X:6130132-6130154 GTGTTTTGAGAGGCTGAGGAAGG - Intronic
1187498595 X:19818184-19818206 CTTTTGGGAGAGACTGTACATGG + Intronic
1191270775 X:58465466-58465488 CTTTTTGGAGAATCTGAAAAAGG + Intergenic
1191574555 X:62683831-62683853 CTTTTTGTAGATACTGCAGAGGG + Intergenic
1191583344 X:62790471-62790493 CTGTTTGTAGAAACTGCAAAAGG - Intergenic
1192047888 X:67695720-67695742 GTGTTTAGACAGACTGGAGAAGG - Intronic
1192051916 X:67732328-67732350 CTCTTTGGAGAGAGTGATGTGGG - Intergenic
1193137004 X:77983637-77983659 CTCATAGGAAAGACTGAAGATGG - Intronic
1193590847 X:83386940-83386962 TTATTTAGAGAGGCTGAAGATGG + Intergenic
1194537426 X:95122051-95122073 CTGATTAAAGAAACTGAAGAGGG + Intergenic
1194685442 X:96908708-96908730 CTGCTTGGAGAGGCTGAGGCAGG - Intronic
1196008789 X:110864253-110864275 ATTGTTGGAGGGACTGAAGATGG + Intergenic
1196606567 X:117663972-117663994 CTGTTTGTAAAGACTCAATAGGG + Intergenic
1198178046 X:134174364-134174386 TTGGTTGGAGAGACAGAAGAAGG + Intergenic
1198384332 X:136114182-136114204 CTTTTTAGAGAGAGTGAAGGGGG + Intergenic
1198462216 X:136874648-136874670 TTGTTTGAAAAGACTGAAGACGG + Intronic
1198730488 X:139722610-139722632 CTGACTGGTGAGACTGGAGAAGG - Intergenic
1201777543 Y:17682872-17682894 CTTTTTGGAGAAACTGCAAAGGG - Intergenic
1201824015 Y:18223120-18223142 CTTTTTGGAGAAACTGCAAAGGG + Intergenic