ID: 915350072

View in Genome Browser
Species Human (GRCh38)
Location 1:155218718-155218740
Sequence TTGAGCAAGGCACAGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915350072_915350077 -4 Left 915350072 1:155218718-155218740 CCCTCCATCTGTGCCTTGCTCAA No data
Right 915350077 1:155218737-155218759 TCAAAGAGCCATGATGGCCCTGG No data
915350072_915350076 -10 Left 915350072 1:155218718-155218740 CCCTCCATCTGTGCCTTGCTCAA No data
Right 915350076 1:155218731-155218753 CCTTGCTCAAAGAGCCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915350072 Original CRISPR TTGAGCAAGGCACAGATGGA GGG (reversed) Intergenic
No off target data available for this crispr