ID: 915352428

View in Genome Browser
Species Human (GRCh38)
Location 1:155234817-155234839
Sequence AGCCCCTGGCACCACCTAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 2, 1: 0, 2: 0, 3: 22, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915352428 Original CRISPR AGCCCCTGGCACCACCTAGA GGG Exonic
900315908 1:2056228-2056250 AGCCCTGGGCACCACTTGGAGGG - Intronic
900532785 1:3162896-3162918 AGCCCCTGGCATGGTCTAGAGGG + Intronic
900532797 1:3162944-3162966 AGCCCCTGGCATGGTCTAGAGGG + Intronic
900532810 1:3162992-3163014 AGCCCCTGGCATGGTCTAGAGGG + Intronic
900532822 1:3163040-3163062 AGCCCCTGGCATGGTCTAGAGGG + Intronic
900532834 1:3163088-3163110 AGCCCCTGGCATGGTCTAGAGGG + Intronic
900532846 1:3163136-3163158 AGCCCCTGGCATGGTCTAGAGGG + Intronic
900532858 1:3163184-3163206 AGCCCCTGGCATGGTCTAGAGGG + Intronic
900532870 1:3163232-3163254 AGCCCCTGGCATGGTCTAGAGGG + Intronic
900532882 1:3163280-3163302 AGCCCCTGGCATGGTCTAGAGGG + Intronic
900972667 1:6000172-6000194 AGCCCCCCGCACCCCCTAGAGGG + Intronic
901940695 1:12659417-12659439 AGCCCCGGCCCTCACCTAGAAGG - Intronic
903162330 1:21498006-21498028 AACACCTGGGACCACGTAGAAGG + Intergenic
903625409 1:24726730-24726752 AGACCCTGGCTCCACCTGGAAGG + Intergenic
904500250 1:30908901-30908923 AGCCCCCGCCCCCACCCAGAGGG + Intergenic
905247812 1:36627023-36627045 AGCCCCTGGCCCCAGTAAGAGGG + Intergenic
905749840 1:40452375-40452397 AGCACCTGGTACCACCTACAAGG + Intronic
908909930 1:69061670-69061692 ATCAGCTGGCACCACCCAGATGG + Intergenic
912581942 1:110728883-110728905 ATCAGCTGGCACCACCCAGATGG - Intergenic
914198965 1:145467469-145467491 ATCAGCTGGCACCACCCAGATGG - Intergenic
914478076 1:148040605-148040627 ATCAGCTGGCACCACCCAGATGG - Intergenic
914511529 1:148336441-148336463 ATCAGCTGGCACCACCCAGATGG - Intergenic
915144232 1:153785369-153785391 AGCCCCTGGAACCTCTAAGAAGG - Intergenic
915349241 1:155214190-155214212 AGCCCCTGGCACCACCTAGAGGG + Intergenic
915352428 1:155234817-155234839 AGCCCCTGGCACCACCTAGAGGG + Exonic
915554491 1:156653871-156653893 GACCCTTGGCACCACCAAGATGG - Intronic
917638292 1:176958190-176958212 AGACCCTGGCACAACATAGGGGG + Intronic
918951469 1:191145601-191145623 AGAACCTGGCATCACCTTGAAGG + Intergenic
920314438 1:205067292-205067314 AGACCCTGGCACCACTTATAGGG + Intronic
921335539 1:214082005-214082027 AGCCCCAGCCAACACCTTGACGG + Intergenic
922517107 1:226215587-226215609 AGCCCCTGGCTCCACAGGGAGGG + Intergenic
923022845 1:230178304-230178326 GGCCCCTGGCAGTACCTGGAGGG - Exonic
923826934 1:237510724-237510746 ACGCCGTGGCAGCACCTAGATGG - Intronic
924807812 1:247375202-247375224 ATCAGCTGGCACCACCCAGATGG + Intergenic
1063195844 10:3741906-3741928 AGCAGCTGGCACCACACAGATGG - Intergenic
1067868237 10:49931460-49931482 ATCAGCTGGCACCACCCAGATGG + Intronic
1068985751 10:63106320-63106342 ATCAGCTGGCACCACCCAGATGG + Intergenic
1070551567 10:77494560-77494582 AGCACCTTTCACCACCCAGATGG + Intronic
1071601678 10:86961581-86961603 AGCCCTTGGAGCCACCTCGAGGG + Intronic
1073027143 10:100496338-100496360 AGGCCCTGCCACAACCTACAGGG - Exonic
1073066820 10:100765697-100765719 AGCCCCTGCCACTGCCCAGATGG + Intronic
1075008767 10:118850649-118850671 AGCCCGTGGCGCCACCTGGTGGG + Intergenic
1077046788 11:550251-550273 GGCCCCTGGCCCCACCAACAAGG + Exonic
1079484568 11:20922010-20922032 AGACCTTGGCACCAGCTAGAAGG - Intronic
1079981289 11:27154022-27154044 ATCCCCAGGCACCACCTGGGAGG + Intergenic
1081481914 11:43497372-43497394 AGACACTGGCACCAACTAGCTGG + Intergenic
1081715884 11:45250094-45250116 AGCCCCTCGCCCCAGCTAGAGGG - Intronic
1082700542 11:56424401-56424423 AGACCCTGGGACCTCCTTGAAGG + Intergenic
1083683223 11:64360782-64360804 CTCCCCTGGCACCTCCTCGAAGG + Intronic
1083696841 11:64448973-64448995 CGCCCCTGGCACCCACTAGATGG + Intergenic
1083981271 11:66172586-66172608 AGCCCCAGCCACCAACTGGATGG + Intronic
1086288965 11:85283067-85283089 AGACACTGGCACCTACTAGAGGG + Intronic
1087541948 11:99532086-99532108 AGCCCCTGAAACCAGCCAGAAGG + Intronic
1087686596 11:101272556-101272578 AACCCCTGGCACCAGGTGGAAGG + Intergenic
1089184233 11:116604006-116604028 AGCCCCAGGCAGAACCTGGAGGG + Intergenic
1090964229 11:131584397-131584419 CGCCCCTGCCTCCACCAAGAAGG - Intronic
1091597425 12:1887301-1887323 AGTCCCAGGCACCACCTATGTGG - Intronic
1094581017 12:31733948-31733970 ATCAGCTGGCACCACCCAGATGG - Intergenic
1102224355 12:111217426-111217448 AGCCCCGGGCGACACCTTGAAGG + Intronic
1104128233 12:125867738-125867760 ATCAACTGGCACCACCCAGATGG - Intergenic
1104355604 12:128082551-128082573 ATCAACTGGCACCACCCAGATGG + Intergenic
1104789182 12:131471301-131471323 AGCTCCTGGGAACATCTAGAGGG + Intergenic
1104852756 12:131885345-131885367 ATCAGCTGGCACCACCCAGATGG - Intergenic
1104952222 12:132446380-132446402 CTCCGCTGGCACCACCCAGACGG + Intergenic
1112167689 13:96937061-96937083 AGCCCCAGCCACCACCTTGATGG - Intergenic
1112287370 13:98116230-98116252 AGGCCCTGGCTCCATCTTGAAGG - Intergenic
1113386978 13:109857870-109857892 ATCAGCTGGCACCACCCAGATGG + Intergenic
1113701106 13:112388942-112388964 ATCAGCTGGCACCACCCAGATGG - Intronic
1117989415 14:61419052-61419074 GGGCCCTGTCACCACCTAGTAGG - Intronic
1118860652 14:69660403-69660425 AGCCCCTGGCACAGCCCAGGGGG + Intronic
1120088675 14:80305940-80305962 AGCCCAAGCCACCACCTTGAAGG - Intronic
1120268082 14:82276502-82276524 ACCAGCTGGCACCACCAAGATGG - Intergenic
1121889333 14:97574423-97574445 GGCCCCTGGCACCAAGGAGAAGG + Intergenic
1122356429 14:101125736-101125758 AGGCCATGCCACCCCCTAGACGG - Intergenic
1123115172 14:105891260-105891282 AGCCCCTGCCCCCACCCAGGAGG - Intergenic
1125029442 15:35061600-35061622 ATCAGCTGGCACCACCCAGACGG + Intergenic
1125041750 15:35195820-35195842 AGCCACTGGCAGCACCCAGGAGG - Intergenic
1125687080 15:41569932-41569954 AGCCCCTTGAACCAGCTGGATGG + Intronic
1125889761 15:43256787-43256809 GGCCCCTGGCGACACCAAGAGGG + Intronic
1128751794 15:70155374-70155396 AGGCACTGGCACCACCAATATGG + Intergenic
1130837847 15:87669238-87669260 ATCAGCTGGCACCACCCAGATGG + Intergenic
1133046992 16:3093623-3093645 AGCACATGGCACCATCAAGATGG + Intronic
1133451829 16:5910348-5910370 AGGCTCTGGTACCTCCTAGAGGG - Intergenic
1133680089 16:8113210-8113232 ATCAGCTGGTACCACCTAGATGG + Intergenic
1134771743 16:16815140-16815162 AGCCCATGGGACCACCTCCATGG + Intergenic
1134908879 16:18006126-18006148 ATCCTCAGGCACCACCTACAAGG + Intergenic
1141307433 16:82878928-82878950 AGCCCCTGTCACCTCAGAGAAGG - Intronic
1142363966 16:89640108-89640130 AGCCCCAAGCTCCACCTAGGAGG - Intergenic
1142473332 17:175647-175669 AGCTCCTGGGAGCACCTGGAGGG - Intronic
1142951068 17:3480506-3480528 ATCAGCTGGCACCACCCAGATGG - Intronic
1144849591 17:18237376-18237398 AGCCCCAGCCACCACCAAGGTGG - Intronic
1150214642 17:63459852-63459874 AGGCCCTGTCACCACCAGGAAGG - Intergenic
1151255482 17:72873217-72873239 ACCGGCTGGCACCACCTGGATGG + Intronic
1152922773 17:83074029-83074051 TGCCCCTGGCACCACCCCGAAGG - Intergenic
1160854451 19:1210133-1210155 ACCCCCTGGCAGCACCCAGGGGG - Intronic
1160922190 19:1526243-1526265 CGCACCTGGCACCACCTTGAGGG - Intronic
1161203259 19:3027927-3027949 AGACCCTGGCATCACCTATCTGG - Intronic
1161288524 19:3480605-3480627 CGCCCCTGGCACCACCTGATTGG + Intergenic
1161325581 19:3662123-3662145 AGCCCCGGGGACCACCAGGAGGG - Intronic
1162501818 19:11058468-11058490 AGCCCAAGGCACCGCCTAGGTGG - Intronic
1162534163 19:11253353-11253375 AGCCACCTGGACCACCTAGATGG - Intronic
1163277341 19:16293630-16293652 AGCCCCTGGAAACAACTAGACGG + Intergenic
1163698262 19:18774791-18774813 GGCCCCTGGAACCTCCCAGACGG - Intronic
1163823590 19:19510513-19510535 AGCCTCTGGCCCCAGCTACACGG - Intergenic
1165490058 19:36118174-36118196 AACCCCTGGCACAACACAGATGG - Intronic
1167464507 19:49642958-49642980 AGGACCTGGAACCATCTAGATGG + Intronic
1167702672 19:51059858-51059880 AACCCCTGGCACCACCTGTCGGG - Exonic
1167805885 19:51785015-51785037 ATCAGCTGGCACCACCCAGATGG + Intronic
929535952 2:42784193-42784215 AGCCCCTGGCACCCAGTAAATGG - Intronic
931472491 2:62553124-62553146 AGCTCCTGTCACCACATAGTTGG + Intergenic
931938508 2:67225469-67225491 AGACCTTGGCACACCCTAGAGGG - Intergenic
933045384 2:77528814-77528836 ATCAGCTGGCACCACCCAGATGG - Intronic
933837982 2:86261166-86261188 GGCCCCTAGCACCACACAGAAGG + Intronic
934670544 2:96209561-96209583 GGATCCTGGCACCACCCAGATGG + Intergenic
934670966 2:96212549-96212571 ATCGGCTGGCACCACCCAGATGG + Intergenic
937347264 2:121133698-121133720 AGCCCCTGGCTCCAGCTGGATGG + Intergenic
938144502 2:128822332-128822354 TGCCCCTGGCAGCACCAGGAGGG - Intergenic
940612843 2:156011790-156011812 ATCAGCTGGCACCACCCAGATGG - Intergenic
943758938 2:191587790-191587812 ATCAGCTGGCACCACCCAGATGG + Intergenic
945268271 2:207912973-207912995 AGCCCTTGGAATCACCCAGATGG - Intronic
945392352 2:209279568-209279590 ATCACCTGACACCACCCAGATGG + Intergenic
945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG + Intronic
946570011 2:221014155-221014177 ATCAGCTGGCACCACCCAGATGG + Intergenic
1169927673 20:10799906-10799928 AGCCACTGACACTACCTAGTAGG - Intergenic
1172173428 20:32958509-32958531 CTCCACTGGCACCACCCAGAAGG + Intronic
1172549153 20:35785443-35785465 AGCCCGTAGCACCACCTACTCGG - Intronic
1172666614 20:36604950-36604972 TGAGCCTGGCACCACCTGGAGGG + Intronic
1175191163 20:57212937-57212959 AGTCCCTGGCATCCCCCAGACGG + Intronic
1175981158 20:62739373-62739395 AGCCCCTGGAATCACACAGAAGG + Intronic
1178370334 21:32021800-32021822 AGCTGTTGGCACCACATAGACGG - Intronic
1180046618 21:45309196-45309218 AGCCCCTGGCGCCCCCTGGAGGG + Intergenic
1180200237 21:46219767-46219789 AGCCACTGGTTCCACCTAGGGGG - Intronic
1181617349 22:24064099-24064121 AGCCCCTGCCTCCACCTGGATGG - Exonic
1184373387 22:44096969-44096991 ACCCCCCGGCACCCCCTGGATGG + Intronic
1185373779 22:50472833-50472855 AGCCCCAGGCACCCCTTAGAAGG - Intronic
950780626 3:15388575-15388597 ATCAACTGGCACCACCCAGATGG - Intronic
952382419 3:32816031-32816053 GGCCTCGGGCACCACCCAGATGG + Intergenic
952920170 3:38278508-38278530 AGCCCCTGACCCAACCAAGATGG + Intergenic
955605785 3:60701596-60701618 ATCAGCTGGCACCACCTAGATGG - Intronic
959295238 3:104527404-104527426 ATCAGCTGGCACCACCGAGATGG + Intergenic
961032708 3:123620382-123620404 AGCCCCTCGCACTACCCAGCTGG - Intronic
962348390 3:134639246-134639268 AGTCCCTGTCACCATCTAGCAGG - Intronic
964357317 3:155862664-155862686 ATCAGCTGGCACCACCCAGATGG + Intergenic
966533898 3:181009576-181009598 ATCAGCTGGCACCACCCAGATGG - Intergenic
967915514 3:194575411-194575433 ATCAGCTGGCACCACCCAGATGG - Intergenic
968146443 3:196303085-196303107 ATCAGCTGGCACCACCCAGATGG + Intronic
968163250 3:196444137-196444159 ATCAGCTGGCACCACCCAGATGG - Intergenic
968210494 3:196844678-196844700 ATCAGCTGGCACCACCCAGATGG - Intergenic
968688421 4:1976903-1976925 AGCCCCTGGAACCTCCAGGAGGG + Intronic
969613699 4:8240512-8240534 CGGCCCTGGCACCCCCTGGAAGG - Intronic
976202767 4:82596227-82596249 AGTCCCTGGCTCCTCCTGGAAGG - Intergenic
982500899 4:156153361-156153383 ATCCACTGGCACCACCCAGATGG - Intergenic
985426993 4:189840886-189840908 ACCAGCTGGCACCACGTAGAAGG + Intergenic
985749634 5:1667026-1667048 TGCCTGTGGCACCTCCTAGAAGG + Intergenic
985859464 5:2459106-2459128 TGCCCCTGCCACCAACCAGAAGG - Intergenic
987753082 5:22066522-22066544 AGCCACTGGCTCCACTGAGATGG - Intronic
988466818 5:31499466-31499488 AGCCCCTGGCACCAGATGGCAGG + Intronic
989156349 5:38348261-38348283 AGCTTCTGGCACCACCTTCAGGG - Intronic
990006858 5:50954233-50954255 TGGCCCTGGCACCACGTACAAGG - Intergenic
990622641 5:57577457-57577479 AGCCCCTGGCAACACCCTCATGG - Intergenic
992722836 5:79577802-79577824 ATCAGCTGGCACCACCCAGATGG + Intergenic
992723208 5:79580840-79580862 ATCAGCTGGCACCACCCAGATGG + Intergenic
995397373 5:111701732-111701754 AGCACCTGGAACCACCCATAAGG - Intronic
997589391 5:135063654-135063676 AGCCCCAGGCAGCTCCTAGAGGG + Intronic
997767387 5:136518787-136518809 TGCCCCTGCCCCCACCTATAGGG - Intergenic
998094167 5:139388006-139388028 AGCCCCGGGCATCACCTGGTAGG + Exonic
998856820 5:146401774-146401796 AGCACCTGGCAGCACCTCAAGGG + Intergenic
1001270331 5:170306455-170306477 AGCCCCTGGCACACTATAGATGG + Intergenic
1001529647 5:172453401-172453423 AGGCCCTGGGACCACCTCGCAGG - Intronic
1003140639 6:3468585-3468607 AGCCTAGGGGACCACCTAGAGGG - Intergenic
1004202126 6:13558674-13558696 AGCACCTGGCAGCACCTGGAAGG - Intergenic
1004445438 6:15693526-15693548 ATCAGCTGGCACCACCCAGATGG + Intergenic
1005354182 6:24966930-24966952 AGCTCCTGAGACCACCTTGAAGG - Intronic
1005433766 6:25786516-25786538 GGCCCAAGGGACCACCTAGAAGG + Intronic
1005661737 6:28005183-28005205 ATCAGCTGGCACCACCCAGATGG + Intergenic
1010999323 6:82570058-82570080 AGGCCCTGGCATCACTCAGATGG + Intergenic
1013006372 6:106078120-106078142 AGCCTCTGGCAGCACCCAGCAGG - Intergenic
1014132094 6:117846379-117846401 TGTCCCTGGCAACACCCAGATGG + Intergenic
1016164018 6:140917430-140917452 ATCAGCTGGCACCACCCAGATGG + Intergenic
1016495846 6:144660898-144660920 GGCTCCTGGCACAATCTAGATGG + Intronic
1018126824 6:160690547-160690569 AGGCCCTGGCCCCACCTGGCTGG - Intergenic
1019538730 7:1541912-1541934 GGCCCCAGGCACCACCTTGCAGG - Exonic
1020763970 7:12298533-12298555 ATCACCTGACACCACCCAGAAGG + Intergenic
1020991231 7:15198783-15198805 ATCAGCTGGCACCACCCAGATGG - Intergenic
1023125628 7:36951513-36951535 GGCCACTGGAACCACCTGGAGGG + Intronic
1026044123 7:66893987-66894009 AGCCCCTGACTCCATCTTGAAGG - Intergenic
1026827159 7:73591611-73591633 ATCCACTGGAACCACCCAGAAGG - Intergenic
1029050684 7:97683370-97683392 TGCTCCTGGCACTACCAAGAGGG - Intergenic
1029225871 7:99028128-99028150 ATCGCCTGGGACCACCGAGAGGG + Exonic
1029509545 7:100985319-100985341 ATCAGCTGGCACCACCCAGATGG - Intronic
1029559499 7:101293175-101293197 ATCAGCTGGCACCACCCAGATGG + Intergenic
1029582952 7:101449375-101449397 GGCCCCTGGCAGGATCTAGATGG - Intronic
1030155574 7:106451088-106451110 ATCAGCTGGCACCACCCAGATGG - Intergenic
1032138915 7:129308421-129308443 ATCCCCTGGCAGCACCCACATGG - Intronic
1034245734 7:149643099-149643121 TGCCCCTGCCACCAGCTGGAGGG + Intergenic
1036047993 8:5165409-5165431 ATCAGCTGGCACCACCCAGATGG - Intergenic
1039546171 8:38413128-38413150 AGCCACTGGCACCACCTATCTGG + Exonic
1040386328 8:46917342-46917364 ATCAGCTGGCACCACCCAGATGG + Intergenic
1041402173 8:57457468-57457490 TGCCCCTGCCACCACCATGAAGG - Intergenic
1045034063 8:98163893-98163915 AGGTCTTGGCACCACCTAGTGGG - Intergenic
1048631104 8:136243402-136243424 AGACCCTGGCAACACATAGCAGG + Intergenic
1049693145 8:143971491-143971513 AGCCCCTTGGACCTGCTAGAGGG - Intronic
1053003030 9:34588168-34588190 AGCCCCTGGCACCAGCTGAGAGG + Intronic
1053074709 9:35122966-35122988 ATCAGCTGGCACCACCCAGATGG - Intergenic
1056213900 9:84390559-84390581 ATCAGCTGGCACCACCCAGATGG - Intergenic
1059637685 9:116186983-116187005 TGCCTCTGGGACCACCTCGAGGG - Intronic
1061482631 9:130904536-130904558 AGCCCCAGGCACGCCCGAGAAGG - Intronic
1061753299 9:132795629-132795651 AGTGCCTGGCACAGCCTAGATGG - Intronic
1061843306 9:133372952-133372974 ATGCTCTGCCACCACCTAGACGG + Intronic
1062348337 9:136125890-136125912 GGCCCCTGACACCACTTACAAGG - Intergenic
1185522187 X:748701-748723 AGCACATGGCACCTGCTAGAAGG + Intergenic
1186062628 X:5726498-5726520 ATCAGCTGGCACCACCCAGATGG - Intergenic
1187496009 X:19796442-19796464 AGCCCAAGGCACCACCTAAATGG - Intronic
1191778528 X:64843977-64843999 AGCCCCTGCAACCTCCTGGAGGG - Intergenic
1192180901 X:68914898-68914920 TGCCCCAGGCCACACCTAGATGG - Intergenic
1200053874 X:153448688-153448710 AGCCCCAGGCACCACCAGGATGG + Intronic