ID: 915353470

View in Genome Browser
Species Human (GRCh38)
Location 1:155240956-155240978
Sequence TTGAGCAAGGCACAGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 2, 1: 0, 2: 2, 3: 22, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915353470_915353475 -4 Left 915353470 1:155240956-155240978 CCCTCCATCTGTGCCTTGCTCAA 0: 2
1: 0
2: 2
3: 22
4: 285
Right 915353475 1:155240975-155240997 TCAAAGAGCCATGATGGCCCTGG 0: 2
1: 0
2: 1
3: 9
4: 132
915353470_915353474 -10 Left 915353470 1:155240956-155240978 CCCTCCATCTGTGCCTTGCTCAA 0: 2
1: 0
2: 2
3: 22
4: 285
Right 915353474 1:155240969-155240991 CCTTGCTCAAAGAGCCATGATGG 0: 2
1: 0
2: 0
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915353470 Original CRISPR TTGAGCAAGGCACAGATGGA GGG (reversed) Intronic
901324229 1:8357424-8357446 TAGAGCAGGGCCCAGAGGGAGGG - Intronic
902652857 1:17847942-17847964 ATGAGTAATGTACAGATGGATGG - Intergenic
904601696 1:31676381-31676403 TTGAGCAAGGCACAGAGCTGAGG + Intronic
904929466 1:34074883-34074905 CTAAGCAAGGGGCAGATGGAGGG + Intronic
905084605 1:35360967-35360989 TTGAGCAAGGAAAAAATGTAGGG + Intronic
906947032 1:50303348-50303370 TTGAGGGAGGCAGAAATGGAGGG + Intergenic
907619879 1:55966389-55966411 TTGAGGAAAGAACAGATGGAAGG - Intergenic
907754605 1:57299395-57299417 TTCGGCAAGGCAAAGAGGGAGGG + Intronic
907778446 1:57541994-57542016 GTGTGCAAGGCACAGATGAATGG + Intronic
908141955 1:61194269-61194291 TTGGGCCAGTCACTGATGGACGG + Intronic
908432733 1:64074509-64074531 CTGTGCAAGGCACAGAGGGAGGG + Intronic
909568755 1:77084506-77084528 TTAAGCAAGGTACAGATGGTGGG - Intergenic
910522369 1:88137125-88137147 TTGTGCAAGGTACAAATGCATGG - Intergenic
910530009 1:88225193-88225215 TTGTGCAATGGGCAGATGGATGG + Intergenic
913531070 1:119734827-119734849 CTGGGGAAGGCCCAGATGGAGGG - Intronic
914245873 1:145885562-145885584 TTGAGGAAGGCAAAGCTGGCGGG + Intronic
915040530 1:152964718-152964740 GTGAGCAAGTGAAAGATGGAGGG - Intergenic
915182469 1:154074379-154074401 TTGAGGAAGGAAGAGAAGGAGGG - Intronic
915350072 1:155218718-155218740 TTGAGCAAGGCACAGATGGAGGG - Intergenic
915353470 1:155240956-155240978 TTGAGCAAGGCACAGATGGAGGG - Intronic
915971293 1:160356956-160356978 TAGAGCATGGCACTGATAGAGGG + Intronic
916717574 1:167458146-167458168 CTGAGCAGGGCACAGGTGGAAGG - Intronic
918036715 1:180880636-180880658 TTGGTCAAGGCATAGATGGCAGG - Intronic
918527119 1:185477301-185477323 GTGACCAAGGGACTGATGGAAGG - Intergenic
921904048 1:220477601-220477623 TGAAGCAAGGCACAGACTGATGG - Intergenic
922129199 1:222759953-222759975 TTTAGCAATGGACAGATTGATGG - Intergenic
923610669 1:235490032-235490054 CTGAGCAGGCCACAGAAGGAAGG - Intronic
923722876 1:236482329-236482351 TTGAGCAAGTCACTTATGGTGGG - Exonic
924514008 1:244751322-244751344 GTGAGCAGGGCAAAAATGGAGGG - Intergenic
924554825 1:245109326-245109348 TAGAGAGGGGCACAGATGGAAGG + Intronic
1063116345 10:3074527-3074549 AGGAGCAGGCCACAGATGGAAGG + Intronic
1064587305 10:16851940-16851962 TTGAGGGAGGGAAAGATGGAGGG - Intronic
1064587396 10:16852267-16852289 GTGAGGAAGGGAAAGATGGAGGG - Intronic
1066408651 10:35144229-35144251 GGGAGAAAGGCAGAGATGGAAGG - Intronic
1067168800 10:43887355-43887377 TTGATGAAGGCACAGAGAGAAGG + Intergenic
1067461487 10:46461659-46461681 TTGAGAAAGCCATAGATGAATGG + Exonic
1067625707 10:47922942-47922964 TTGAGAAAGCCATAGATGAATGG - Intergenic
1068587480 10:58815417-58815439 TGATGCCAGGCACAGATGGAGGG + Intronic
1070676055 10:78412002-78412024 TTCAGGAAGGACCAGATGGAGGG + Intergenic
1076529179 10:131133216-131133238 TTTAGCAAAGGACAGAAGGATGG - Intronic
1076712819 10:132347921-132347943 TTGAATAAGTCACAGAGGGATGG + Intronic
1076718946 10:132384417-132384439 TTGATCAAAACAAAGATGGAGGG - Intergenic
1078480635 11:11672366-11672388 TTGAGCAAGGCGGAGGTGCATGG - Intergenic
1083262359 11:61530206-61530228 AAGAGCAAGGCGCAGGTGGAAGG - Intronic
1086590979 11:88513235-88513257 ATTATGAAGGCACAGATGGAGGG + Intronic
1089500195 11:118927472-118927494 TTTAGGGAGGCACAGGTGGAAGG + Intronic
1090509809 11:127363144-127363166 TTAAGAAAAGCATAGATGGAGGG + Intergenic
1091346091 11:134855219-134855241 TTGAGCAAAGCACAGGTGGCTGG - Intergenic
1091808922 12:3378843-3378865 GTGAGCAAGGGAGAGAAGGAAGG - Intergenic
1092663107 12:10760986-10761008 TTGAGCAAGACACAAATAAATGG - Intergenic
1092849468 12:12613548-12613570 GTGAGGAAGTGACAGATGGAAGG + Intronic
1093711377 12:22333842-22333864 TTGGGAATGGCACAAATGGAGGG + Intronic
1095322840 12:40850512-40850534 ATGATAAAGGAACAGATGGAAGG - Intronic
1095651153 12:44610782-44610804 TAGAGGAAGGTAGAGATGGATGG + Intronic
1095822360 12:46492353-46492375 TCGAGCAAGGCAGGGAAGGAAGG - Intergenic
1097307442 12:58085172-58085194 TTGAACAGAGCACAGAGGGAGGG - Intergenic
1100104700 12:91156012-91156034 TTGAGAAAGGGACAGACTGAGGG + Intronic
1101747305 12:107552771-107552793 TAGAGGATGGCACAGAGGGAAGG - Intronic
1102785960 12:115605009-115605031 GTGGGCAATGCATAGATGGATGG + Intergenic
1102900189 12:116630644-116630666 TTGAACAAGTCACCTATGGAAGG + Intergenic
1103361408 12:120356608-120356630 TAGAGGAATGGACAGATGGAGGG + Intronic
1104121645 12:125805544-125805566 CTGAGCAACTCACAGGTGGAGGG + Intergenic
1104529710 12:129557761-129557783 TTGAGCATGGGGCTGATGGATGG + Intronic
1104897588 12:132171905-132171927 CTGAGCAAGCCTGAGATGGAGGG - Intergenic
1107932949 13:45321442-45321464 GGCAGCAAGGCACAGAAGGAGGG - Intergenic
1111089365 13:83423168-83423190 TTGTACTACGCACAGATGGAAGG + Intergenic
1115806157 14:37054344-37054366 TTGGGCAGGGCTCAGCTGGATGG - Intronic
1116325916 14:43533716-43533738 TTGAGCTAGACACAGAGTGATGG - Intergenic
1117159574 14:52975354-52975376 TTGAGCAAGTCATAAATGAAAGG - Intergenic
1119096430 14:71836627-71836649 TTGAAAAAGACACAGTTGGAAGG - Intergenic
1119591530 14:75892802-75892824 TTGAGACAGGAACAGTTGGAAGG - Intronic
1119828715 14:77681343-77681365 TTGAGCACGGCACTGAAGAATGG + Intronic
1122148260 14:99706991-99707013 TTGAGCAAGGGACAGGTGCAGGG + Intronic
1122374543 14:101249191-101249213 TTGACCAGGACAGAGATGGATGG - Intergenic
1122390406 14:101377263-101377285 CTGAGCAAGTCAGCGATGGAGGG + Intergenic
1125271232 15:37940766-37940788 GTGAGCAAGGCATACAGGGAGGG + Intronic
1125555362 15:40580280-40580302 TTGAGCTAGAGACACATGGATGG + Intergenic
1126739634 15:51764613-51764635 CTTAGCAAGGCGCAGAAGGAAGG + Intronic
1127635196 15:60862487-60862509 TGGATCAAGGCACTGATGGAGGG + Intronic
1129175966 15:73839890-73839912 TTCTGCAAGGCCCTGATGGAGGG + Intergenic
1129248597 15:74295595-74295617 GTGAGCAAGGGGCAGATGGTAGG + Intronic
1130151703 15:81316167-81316189 TTGAGCAAGGCACAAATGCAGGG - Intronic
1131023816 15:89122659-89122681 TTCAGCCAGGCCCAGAGGGAAGG - Intronic
1131275593 15:90978102-90978124 GTGTGTAGGGCACAGATGGAAGG - Intronic
1132486517 16:195089-195111 TGAAGCAGGGCACACATGGATGG + Intronic
1132938894 16:2497226-2497248 TTCAGCCATGCACAGATGGCTGG - Intronic
1134324525 16:13194853-13194875 TTGAACAAGTAACAAATGGATGG + Intronic
1134400850 16:13908326-13908348 ATGCTCTAGGCACAGATGGAAGG - Intergenic
1136265284 16:29113429-29113451 AAGAGGAAGGCACAGCTGGAAGG - Intergenic
1137463061 16:48683292-48683314 TTGAGCATGGACCAGATGCAAGG + Intergenic
1137668416 16:50265557-50265579 TTGAGGAGGGCAGAGATGGGAGG - Intronic
1137909070 16:52357615-52357637 TTGAGAAACGCACTGATGAAAGG + Intergenic
1138204677 16:55115799-55115821 ATGAGGAAGGCACCGATGCAAGG + Intergenic
1140040832 16:71406551-71406573 TGCAGCAAAGCACAGATGCAAGG - Intergenic
1141465208 16:84201080-84201102 TTGTGCATGGCACAGAGGGAAGG - Intergenic
1142164780 16:88580415-88580437 AAGAGCCAGTCACAGATGGAAGG + Intronic
1142478538 17:204318-204340 TGGAGCATTGGACAGATGGATGG - Intergenic
1142511246 17:394843-394865 TGGAGCACGGGACAGAGGGAAGG + Intergenic
1144073467 17:11695280-11695302 TTGAGGATGGCAAAGGTGGAAGG + Intronic
1146272743 17:31495053-31495075 TCCAGCTAGGCACAGGTGGATGG - Intronic
1146697093 17:34917721-34917743 TTGAGAAAGTCTCAGAAGGAAGG + Intergenic
1146826717 17:36029518-36029540 TTGATGAATGGACAGATGGATGG - Intergenic
1148811344 17:50293840-50293862 TTCAGCAACAGACAGATGGATGG + Intergenic
1149275966 17:55037292-55037314 ATGAGGAAGGCAAAGATGGTTGG + Intronic
1149425735 17:56552525-56552547 TTGGGCAGGGCACAGCTGGCTGG + Intergenic
1149554585 17:57564170-57564192 TGGAACAGGGCACAGATGGCTGG + Intronic
1150416919 17:64995439-64995461 CTGAGGAAGGGACAGAAGGATGG + Intergenic
1150824852 17:68465380-68465402 TTGGGCAATGCACAGATGTCTGG + Intergenic
1151426741 17:74035600-74035622 ATGAGCAAGGCACAGTGGGCAGG + Intergenic
1152292427 17:79447729-79447751 CTGAGCAATGCTCACATGGATGG - Intronic
1157452409 18:47798774-47798796 TTGTGCTTGGCACAGATGGTTGG + Intergenic
1157483315 18:48069785-48069807 TTGAGAAAGGCAAGGATGAAGGG + Intronic
1158687809 18:59630479-59630501 TTGGGCAAGGCTCAGCTGGGAGG + Intronic
1159124121 18:64203140-64203162 TTGCGCAAGGCAAAGAAGAATGG + Intergenic
1160007293 18:75076768-75076790 TTGGGAAAGGCACACATGGCTGG + Intergenic
1164484471 19:28643098-28643120 TTGAGAAAGGCACAGAGGACAGG + Intergenic
1165891886 19:39117551-39117573 TTGAGCAAGGGGGACATGGAGGG + Intergenic
1167213486 19:48148651-48148673 TTGAGCATGGCAGAGATGGGGGG + Intronic
1168251605 19:55145448-55145470 GTGAGAAAGGCAGAGATGGAGGG - Intronic
925587953 2:5482296-5482318 TTAAGCAAGGCACAGTTTGCTGG - Intergenic
926487241 2:13477317-13477339 ATGAGGAAGGCAGAGATAGAAGG - Intergenic
928337310 2:30408749-30408771 TTTTGCAAGGGACAGATGAAAGG + Intergenic
928425741 2:31176374-31176396 TTGTGCCAGGCACATATGAAAGG - Intronic
928664589 2:33537976-33537998 TTGAGCAAGGTGCAGACGTAAGG + Intronic
929618247 2:43329112-43329134 TTAAACAAGTCACAGAGGGAGGG - Intronic
929940511 2:46330344-46330366 TAGAGCTAGGCACACATAGATGG + Intronic
930380509 2:50621992-50622014 TTGAGAGAAGCACAGAAGGAAGG - Intronic
931648789 2:64450219-64450241 TGGACCAAGGCACAGACGAAAGG + Intergenic
932740428 2:74286894-74286916 GTGAGCAAGGGACAGAGAGATGG + Intronic
935537079 2:104307565-104307587 TTGAGCAAGGCACTGGAGGCAGG - Intergenic
935702658 2:105825721-105825743 ACCAGCAAGGCACAGAGGGATGG + Intronic
938774759 2:134531667-134531689 TGGAGCAAGGCACAGGAGAAGGG + Intronic
939561347 2:143735980-143736002 TGAAGAAATGCACAGATGGATGG - Intronic
940108928 2:150129036-150129058 TTGAGAAAAGCACAGAGGGTGGG + Intergenic
940136673 2:150444987-150445009 TTCAGCAAGGTACACATTGAAGG - Intergenic
942300476 2:174556545-174556567 TTGAGCAAGGCAGAATTGCAAGG + Intergenic
946059692 2:216931283-216931305 TTGAGTAGGGCTCAGCTGGATGG + Intergenic
946259186 2:218471610-218471632 ATGAGGAAGGCACAGTTGGTGGG - Intronic
948055877 2:235008978-235009000 TTGCCCAAGGGACAGGTGGACGG + Intronic
948330446 2:237160461-237160483 TGGGGCAAGGCAAAGATGGCTGG + Intergenic
949035987 2:241815972-241815994 TGGAGGAAGGCACAGGGGGACGG - Intronic
1170432266 20:16287013-16287035 TTGGGCAGGGCCCAGCTGGATGG - Intronic
1170786791 20:19474204-19474226 TGAAGCAAGGCACAGCAGGACGG + Intronic
1171367330 20:24634139-24634161 TTGATAAAGGCACAGAAAGACGG - Intronic
1171779804 20:29408717-29408739 AAGAGCAAGGGACAGAGGGATGG - Intergenic
1171823787 20:29876999-29877021 GAGAGCAAGGGACAGAGGGATGG - Intergenic
1171896301 20:30813338-30813360 GAGAGCAAGGGACAGAGGGATGG + Intergenic
1172145375 20:32754096-32754118 TTGGGCAAGGAACAGAGGGGAGG - Intergenic
1172483630 20:35286087-35286109 TTGAGCCAGGCCCTGAAGGATGG - Exonic
1173691348 20:44963552-44963574 TTGAGCATGGCTCAGCAGGAAGG - Intergenic
1173816887 20:45995292-45995314 TTTAGCCAGGCAAAGAGGGAGGG + Intergenic
1174278152 20:49418786-49418808 CTGACCAAGGCACAGAGGCAGGG + Intronic
1175125617 20:56749294-56749316 TGGAACAAGCCACAGATGAAAGG - Intergenic
1175781048 20:61682295-61682317 TGGACAAAGGGACAGATGGAAGG + Intronic
1176047134 20:63098567-63098589 GTGAGCAATGGACAGATGGATGG + Intergenic
1176937994 21:14888902-14888924 ATTAGCAAGGCACAGAAGCAAGG - Intergenic
1177203805 21:17987945-17987967 CTGAGAAAGGCACAAATTGAGGG + Intronic
1178037655 21:28602805-28602827 TTGAGGTAGCCACAGCTGGAGGG + Intergenic
1178614658 21:34121528-34121550 TTTGGCAAGGCACAGACTGAGGG - Intronic
1178665123 21:34540003-34540025 GTGAGCAAGGAATAGATGTAGGG - Intronic
1179335909 21:40453595-40453617 CTAAGCAATGCTCAGATGGATGG - Intronic
1179613066 21:42564867-42564889 TGGAGCACGGGCCAGATGGAAGG - Intronic
1179984689 21:44913869-44913891 ATGGGTAAGGCACAGATGTAGGG + Intronic
1181176464 22:21039919-21039941 TTGAGCAGAGCACAGGTGGGTGG - Intergenic
1181801627 22:25351544-25351566 TTGAGGCAGGTACAGAGGGAAGG + Exonic
1182080930 22:27528166-27528188 TTCCCCAAGGCTCAGATGGAAGG + Intergenic
1182978580 22:34646725-34646747 TTGAGGAAGGGACAGTTTGAAGG - Intergenic
1183456104 22:37924235-37924257 TGGAGACAGGCACAGATGCAAGG + Intronic
1183662763 22:39231176-39231198 TTGAGAAAGGCTCAGATGGGTGG - Intronic
1184977934 22:48076320-48076342 GAGAGCAAGGCCCAGAAGGAGGG + Intergenic
949291940 3:2476989-2477011 TTGAGAATGACACAGCTGGAAGG + Intronic
950050198 3:9982642-9982664 TTGTGGAAGGCCGAGATGGAAGG + Intronic
950987408 3:17389687-17389709 TTGAGCAGGGCTCAGTAGGATGG - Intronic
952730019 3:36628990-36629012 ATAAGCAAGGCAAAGATAGAAGG + Intergenic
953478080 3:43222895-43222917 CTGAGCAAAACACACATGGAGGG + Intergenic
953713079 3:45291574-45291596 TTGACCAAAGGACAGAAGGAAGG + Intergenic
954970497 3:54647687-54647709 TGGAGCAAGGCCCTGTTGGATGG - Intronic
955614082 3:60787322-60787344 TTGAGCAGTGCTCAGAAGGATGG - Intronic
956100113 3:65759378-65759400 TTGTGCTAAGCACAGATGTAAGG - Intronic
956170773 3:66431783-66431805 TTGCCCAAGGCTGAGATGGAAGG - Intronic
956225256 3:66950314-66950336 TTGAGTAAGGCACAGATGAGGGG + Intergenic
957085311 3:75671787-75671809 AAGAGCAAGGGACAGAGGGATGG + Intergenic
961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG + Intronic
962334748 3:134517148-134517170 GAGAGCAAGGCAGAGAAGGAAGG - Intronic
963260957 3:143190356-143190378 TTGAGCAAGGCTTGGCTGGATGG + Intergenic
965978142 3:174651680-174651702 TAGAGAAAAGCACAAATGGAAGG - Intronic
966464968 3:180221097-180221119 TTGAGGAAGACACAGATAAAAGG - Intergenic
966766576 3:183468636-183468658 TAGAGTAATGCACACATGGATGG + Intergenic
967666305 3:192176200-192176222 TTGAGCAAAGCACAGCTTGAGGG - Intronic
967938263 3:194746644-194746666 TTGAGGAGGGGACAGGTGGATGG - Intergenic
967982550 3:195074451-195074473 TTGGGCCAGGCACACATGCATGG - Intronic
968054396 3:195680468-195680490 TGGAGCAAAGCACAGTTAGAGGG + Intergenic
968069846 3:195778074-195778096 TTCAGCAAGGGATAGATGGACGG - Intronic
968101495 3:195968690-195968712 TGGAGCAAAGCACAGTTAGAGGG - Intergenic
969347784 4:6580155-6580177 TTGAGCAAAGTCCAGATGTAAGG - Intronic
970388663 4:15584002-15584024 TTGAGGAAGGCACAAATAAATGG + Intronic
971244357 4:24914646-24914668 TTGAGCAAGGCTCAGCTGGATGG - Intronic
971268728 4:25117422-25117444 CTGAGCAAGGCGCAGATATAAGG - Intergenic
972788015 4:42345542-42345564 TTCAGCAGGCTACAGATGGAAGG + Intergenic
975299306 4:72771051-72771073 TTGAGCAAGGGAGAGATGAGAGG - Intergenic
976904979 4:90226216-90226238 CTGAGCAAGGCTCAGCTGGCTGG - Intronic
977109182 4:92930021-92930043 GTGGGCAAGGCCAAGATGGAGGG - Intronic
981503385 4:145475877-145475899 TTGAGCAATGCCAAGATGTAGGG - Intergenic
981670592 4:147282031-147282053 TTAAGAAAGACACAGATAGATGG + Intergenic
981884584 4:149658626-149658648 TTGAGGAAGGCACAAATAAATGG - Intergenic
982759725 4:159266912-159266934 TTAAGCAAGTCTCAGAGGGATGG - Intronic
983297170 4:165880752-165880774 ATGAGGGAGGCAGAGATGGAGGG + Intronic
985208638 4:187568412-187568434 ATGAGGAAGGGAGAGATGGAGGG - Intergenic
985501464 5:250266-250288 TGGAGCAAAGCACAGTTAGAGGG + Intronic
985735418 5:1577368-1577390 TGGAGCAAAGCACAGTTAGAGGG - Intergenic
985794364 5:1950742-1950764 TTGGGAGAGGCAAAGATGGATGG + Intergenic
987109502 5:14672168-14672190 CTGAGCAAATCACAGATGTATGG + Intronic
987307382 5:16649952-16649974 GGGAGCAAGGCAGAAATGGATGG - Intergenic
989404209 5:41042379-41042401 TATAGGAGGGCACAGATGGAGGG - Intronic
989426077 5:41297583-41297605 TTCAGCAAGGCACCCATGAAGGG + Intergenic
990015848 5:51061565-51061587 TTGAGGAAGGCAGAGATGTAAGG + Intergenic
990447401 5:55905352-55905374 TGCAGCAAGGCAGAGGTGGAAGG - Intronic
993410896 5:87572248-87572270 ATGGCGAAGGCACAGATGGAAGG - Intergenic
995053341 5:107731340-107731362 TTGATTAAGGCACAGAAGCAGGG + Intergenic
995149352 5:108824444-108824466 TTGAAGAAGGCACAGATAAATGG - Intronic
995597029 5:113758379-113758401 GTGAGCAAGCCACAGATTGGGGG + Intergenic
995665428 5:114536412-114536434 ATGAGCAAGGCTCAGTGGGAAGG + Intergenic
995734288 5:115282346-115282368 CTGAGCAAAGCAAAGATAGATGG - Intronic
997380235 5:133430682-133430704 TTGAGGAAGGGAAAGAGGGAGGG - Intronic
997502833 5:134391238-134391260 TTGAGAAAGGCACATATTGGAGG + Exonic
997595583 5:135105141-135105163 TTGAACTAGACACACATGGATGG + Intronic
998603907 5:143614464-143614486 TTGACCTGGGCACAGGTGGATGG - Intergenic
998956262 5:147441561-147441583 TTGAGGAAGGCAGAGAGTGAGGG - Intronic
999561977 5:152813509-152813531 TTCAGAAAGGGACAGATGGGAGG - Intergenic
999953891 5:156679491-156679513 TTGGGCAATGCACAGCTGTATGG + Intronic
1002517978 5:179773691-179773713 TTCAGAAAGGCACAGAGGAAGGG - Intronic
1002662494 5:180801328-180801350 TTAAGCAAAGCAGAGATAGAAGG - Intronic
1003311336 6:4972097-4972119 TTGAGCAGGGCACAGGCTGAGGG + Intergenic
1003394050 6:5737773-5737795 ATCAGCAATGCACAGATAGACGG - Intronic
1003900736 6:10653109-10653131 TTTAGGAAGTCACAGAAGGATGG - Intergenic
1004279116 6:14265479-14265501 AGGGGCAAGACACAGATGGAGGG - Intergenic
1005010993 6:21335482-21335504 TTTATGAAGGCACAGAGGGAGGG + Intergenic
1006818230 6:36868286-36868308 TTGAGTAAGGCACAGAGTAAAGG + Intronic
1007192926 6:40035232-40035254 TTAAGCAAGACAGAGATAGATGG - Intergenic
1008549629 6:52615312-52615334 TTGAGCATGGCAATGATAGAAGG + Intergenic
1011679390 6:89768247-89768269 TTGTGCAAGGGACAGGTGGGAGG + Intronic
1011801378 6:91019835-91019857 TTGTTCAAGGCACAGAGAGAAGG - Intergenic
1012517177 6:100075869-100075891 ATGAGCAAAACATAGATGGATGG - Intergenic
1014605544 6:123469575-123469597 TTTAGCAACACACAAATGGAAGG - Intronic
1015426576 6:133076926-133076948 ATGAGCAAGAAACAGATTGATGG + Intergenic
1016457861 6:144249838-144249860 TTGAGCAAGGAAAAAAAGGAAGG - Intergenic
1017022739 6:150153380-150153402 TGGCGTAAGGCACAGATGTATGG + Intronic
1017784781 6:157746610-157746632 TGGGGCAAGACAGAGATGGAGGG + Intronic
1018112932 6:160553816-160553838 TAAAGCAAGTCACAGAAGGACGG - Intronic
1019875656 7:3808311-3808333 TTGAGTGAGGAGCAGATGGAGGG + Intronic
1019981824 7:4627316-4627338 GGGAACAAGGCACAGATGGGTGG + Intergenic
1024482745 7:49881615-49881637 ACAAGCAAGGCACAGATAGATGG - Intronic
1024850385 7:53708240-53708262 TTCAGTAAGGCACAGAGGGAAGG - Intergenic
1025613880 7:63101513-63101535 TTCAGGAAGGTACTGATGGAAGG + Intergenic
1028518954 7:91707755-91707777 TTGGCCAAGGCAGAGCTGGAAGG + Intronic
1028659882 7:93258352-93258374 TTCAGCAAAGAACAGATGTACGG + Exonic
1028809095 7:95063243-95063265 TTGAGTAAGGCACATATACAGGG - Intronic
1029106374 7:98179637-98179659 TTAAGCAAGGGAGAGAGGGAGGG - Intronic
1029177029 7:98672066-98672088 TTGAATCAGGCACAGATGGGTGG - Intergenic
1029276851 7:99410538-99410560 TTTAAAAAGGCAAAGATGGAAGG - Intronic
1030165614 7:106552214-106552236 TTGAGCCAGGCCCAGGTGGTAGG + Intergenic
1030287219 7:107838924-107838946 TGTAGCAAGGCAATGATGGAAGG + Intergenic
1032653469 7:133903541-133903563 TTGAGCAGTGAAAAGATGGATGG + Intronic
1033718933 7:144036206-144036228 GAGAGCAAGGTAAAGATGGAGGG - Intergenic
1034543767 7:151776697-151776719 TGGAGGAAGGCGCAGATGGCAGG + Intronic
1035059665 7:156059639-156059661 CTGAGCAGGGCACTGAAGGATGG - Intergenic
1036130859 8:6108644-6108666 TTAAGAAAGCCACAGATGAAGGG + Intergenic
1037496870 8:19448705-19448727 CTGAGAAAGACACAGATGCAAGG + Intronic
1037933523 8:22898878-22898900 TTCAGGAAGGCAGAGAGGGACGG + Intronic
1038284341 8:26193482-26193504 TTGGGAAAGGCACAGAGAGAGGG + Intergenic
1038408616 8:27341188-27341210 ATGTGCCAGGCACAAATGGATGG - Intronic
1039222851 8:35354775-35354797 TTGGGAAGGGCACAGCTGGATGG + Intronic
1039903937 8:41772784-41772806 GTGAGGATGGAACAGATGGAAGG - Intronic
1042035080 8:64524003-64524025 GAGAGCAATGCACCGATGGAGGG + Intergenic
1042391149 8:68236372-68236394 TTGTGCAAGGCACAGCTGTTGGG + Exonic
1043573659 8:81632061-81632083 TTGCCCAATGCACAGAAGGAAGG + Intergenic
1044277941 8:90323664-90323686 AGGAGAAAGGAACAGATGGAAGG - Intergenic
1044840716 8:96334451-96334473 TAGAGCATGGCACAGATGAAAGG - Exonic
1045017594 8:98012473-98012495 GTGAGCCAGCCAGAGATGGAGGG + Intronic
1047351404 8:124078170-124078192 TTGTGGAATGAACAGATGGATGG + Intronic
1048074462 8:131053958-131053980 CAGAGAAAGGAACAGATGGAGGG - Intergenic
1048174393 8:132138751-132138773 TTGCGCAAGCACCAGATGGAAGG - Intronic
1051281852 9:15449242-15449264 TTGAGCAATGTTCAGATGGTTGG - Intronic
1051538521 9:18188040-18188062 TAGAGCTAGGTACAGAGGGACGG + Intergenic
1051563291 9:18467660-18467682 TTTAGCAAGGCAAGGATAGAAGG + Intergenic
1052197591 9:25736400-25736422 TTGAGAAAGGGAGAGAAGGAAGG + Intergenic
1054715646 9:68555635-68555657 TTGGGCTAGTCACAGCTGGAAGG + Intergenic
1054845597 9:69793695-69793717 TTGAGAAAGAAACAGAAGGAAGG - Intergenic
1056051867 9:82777495-82777517 AATATCAAGGCACAGATGGAGGG - Intergenic
1057822281 9:98341988-98342010 TTGAGCCAGGCACTGGTGGTGGG + Intronic
1058372168 9:104282040-104282062 GTGAGGAAGGCTCAGATGCAAGG - Intergenic
1058662012 9:107275198-107275220 TAGAGGAAGGCAAGGATGGATGG - Intergenic
1059407079 9:114108031-114108053 TTGAGGATAGGACAGATGGAAGG + Intergenic
1059614895 9:115938850-115938872 TTCACCAGAGCACAGATGGAGGG - Intergenic
1060766403 9:126297507-126297529 TGGAGCAGGACACAGAGGGAGGG + Intergenic
1061501429 9:131005013-131005035 TTGACCAAGGTACAGGTGGAAGG - Intergenic
1203376864 Un_KI270442v1:383515-383537 GAGAGCAAGGTACAGAGGGATGG - Intergenic
1186356309 X:8794758-8794780 TTGGGCAGGGCATAGATGCAGGG - Intronic
1186530121 X:10286887-10286909 TTGGGCAGGGCTCAGATGGATGG + Intergenic
1188340012 X:28987908-28987930 TTGAGCAAGCCACAGTGGGTTGG + Intronic
1188663568 X:32790863-32790885 TTGTGCAATGCTCAGGTGGAAGG - Intronic
1189578505 X:42381275-42381297 TTGATCAATGCACAGATATAAGG - Intergenic
1190093769 X:47462621-47462643 GTGAGCCAGGAACAGCTGGAAGG - Intronic
1194921444 X:99771362-99771384 TAGAGGAAGGCAGAGAGGGAGGG + Intergenic
1195113092 X:101666875-101666897 GTGAGCCAAGCAAAGATGGAAGG + Intergenic
1195921624 X:109989577-109989599 TGGAGGAAAGAACAGATGGAGGG + Intergenic
1196912645 X:120499657-120499679 TTGAGTCAGGCAAAGATGGAGGG - Intergenic
1198304867 X:135370329-135370351 GTGAGGAAGCCACAGAAGGAAGG + Intergenic
1199492067 X:148411189-148411211 TTGAGCAAGGAGCCGAAGGAGGG - Intergenic
1199692336 X:150318109-150318131 TTGAGCATTGCTGAGATGGAGGG - Intergenic
1201064880 Y:10088413-10088435 GTGAACAAGGGACAGAGGGATGG + Intergenic