ID: 915354084

View in Genome Browser
Species Human (GRCh38)
Location 1:155245300-155245322
Sequence CAGTGGGTCTAACACTCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915354084_915354087 1 Left 915354084 1:155245300-155245322 CCTACTGAGTGTTAGACCCACTG 0: 1
1: 0
2: 0
3: 14
4: 107
Right 915354087 1:155245324-155245346 AATGAGCAAGTTTCTGATCTTGG 0: 1
1: 0
2: 4
3: 32
4: 246
915354084_915354090 20 Left 915354084 1:155245300-155245322 CCTACTGAGTGTTAGACCCACTG 0: 1
1: 0
2: 0
3: 14
4: 107
Right 915354090 1:155245343-155245365 TTGGGACCTTAACATTCTATGGG 0: 1
1: 0
2: 0
3: 12
4: 145
915354084_915354089 19 Left 915354084 1:155245300-155245322 CCTACTGAGTGTTAGACCCACTG 0: 1
1: 0
2: 0
3: 14
4: 107
Right 915354089 1:155245342-155245364 CTTGGGACCTTAACATTCTATGG 0: 1
1: 0
2: 0
3: 6
4: 76
915354084_915354088 2 Left 915354084 1:155245300-155245322 CCTACTGAGTGTTAGACCCACTG 0: 1
1: 0
2: 0
3: 14
4: 107
Right 915354088 1:155245325-155245347 ATGAGCAAGTTTCTGATCTTGGG 0: 1
1: 0
2: 1
3: 19
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915354084 Original CRISPR CAGTGGGTCTAACACTCAGT AGG (reversed) Intergenic
903027052 1:20436859-20436881 CTGTGGGCCTCACACACAGTAGG - Intergenic
903063212 1:20684484-20684506 GAGTGGGTCTCACATTCAGGAGG + Intronic
904330309 1:29754256-29754278 CGGTGGGCCTGGCACTCAGTGGG - Intergenic
904374278 1:30070046-30070068 CAGTGCACTTAACACTCAGTAGG - Intergenic
913319041 1:117575951-117575973 CGGTGGGTGTAACACTCAACAGG - Intergenic
915354084 1:155245300-155245322 CAGTGGGTCTAACACTCAGTAGG - Intergenic
920946260 1:210531735-210531757 CACAGGGTCTAAAACTTAGTAGG + Intronic
1079913113 11:26335262-26335284 CAGTTTGTCTGACACACAGTTGG + Intronic
1083301783 11:61743490-61743512 CAGGGGGTATAAGACTCAGAAGG - Intronic
1084018678 11:66403632-66403654 AAGTGGGTCTAACAAGCAGGGGG + Intergenic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1086063713 11:82725543-82725565 CAGTGAGTCTAAAATTGAGTTGG - Intergenic
1088846844 11:113675412-113675434 CAGTGGCTCTCCCACGCAGTTGG + Intergenic
1092206912 12:6620364-6620386 CAGCGGGTCCAGCACGCAGTTGG + Exonic
1093336141 12:17906428-17906450 CAGTGGGTGCAGCCCTCAGTGGG - Intergenic
1094490746 12:30959136-30959158 CACTGAGTCTCACACTCACTGGG + Intronic
1103226897 12:119295586-119295608 CACAGAGCCTAACACTCAGTCGG - Intergenic
1105482887 13:20795366-20795388 CATTGTGTCTGACAATCAGTAGG - Intronic
1106030717 13:25999700-25999722 CATTGGGTCTCACACACAGTAGG + Intronic
1106607913 13:31248787-31248809 CAGAGTGTTTAACACTTAGTAGG + Intronic
1107807864 13:44171889-44171911 CAGTGGGTAGAACACCAAGTGGG - Intergenic
1108574706 13:51781391-51781413 CACTGGGTCTGGCACTCAGTGGG - Intronic
1109251955 13:60030963-60030985 CAGTGGCTCTAACATTCTTTTGG + Intronic
1109648379 13:65291589-65291611 CAGTGGGTTGAACTCTCACTCGG - Intergenic
1110303648 13:73958683-73958705 CAGTGGCTCTCACACTGAATTGG + Intronic
1110663474 13:78086811-78086833 CAGTGGCTCAAACACTCAAATGG - Intergenic
1115821008 14:37212246-37212268 CGGTGGGTAGAACACTAAGTGGG + Intronic
1117850151 14:59958922-59958944 CAGTGGGTCCAACCCACAGAGGG - Intronic
1119931639 14:78553405-78553427 GAGTGGGTCTTAAACTCAGTGGG - Intronic
1120484442 14:85093730-85093752 CAGTGGGTCTAACATTCCACAGG + Intergenic
1121282246 14:92707350-92707372 CTGCTGGTCTAACACACAGTGGG - Intronic
1121935846 14:98017785-98017807 CACTGGGTCTCACACACAGTAGG - Intergenic
1122030412 14:98907865-98907887 CAGAGGGTCTCACACATAGTAGG - Intergenic
1122683611 14:103486765-103486787 CAGTAGGCCTAACACCCAGAAGG - Intronic
1124232682 15:27959010-27959032 CAGTAGGTCTGCCACGCAGTGGG - Intronic
1130971793 15:88739516-88739538 CTGTGGGTCTAACAGGCAGTGGG + Intergenic
1139292755 16:65873227-65873249 CAGTGAGTCTAAGGCTCAGAGGG - Intergenic
1139451011 16:67028452-67028474 ATGTGGGTCTAGCACACAGTGGG - Intergenic
1139681383 16:68566830-68566852 CAGTGGGGGCAGCACTCAGTTGG - Exonic
1143286175 17:5790848-5790870 CAGTGGCTCTAGCTCTCACTGGG + Intronic
1146061246 17:29608534-29608556 CAGTGGCTGGAACACTCAGTAGG + Intronic
1148230984 17:45934914-45934936 CCGTGGGTATTAAACTCAGTAGG - Intronic
1148791015 17:50172684-50172706 CAGTGGCTCAAAAACCCAGTGGG - Intronic
1152373414 17:79904728-79904750 CATTGGGGCTACCACTTAGTTGG + Intergenic
1157881767 18:51327611-51327633 CAGTGTGTATAAGACTCATTAGG + Intergenic
1158527416 18:58227661-58227683 CAGTGGGTAAAACACTCACTGGG - Intronic
1158744679 18:60186548-60186570 CATTGCTTCTAACACCCAGTAGG - Intergenic
1161180273 19:2876115-2876137 CAGTGGGTCTATTTCTCAGCAGG + Exonic
1164447889 19:28333255-28333277 TAGTGGGCCTAGCACTCAATAGG + Intergenic
1166397519 19:42452710-42452732 CGGCAGCTCTAACACTCAGTGGG - Intergenic
926933688 2:18065786-18065808 CAGTGGTCCTAGCATTCAGTTGG + Intronic
932277135 2:70459984-70460006 CAGTGGGTCTCACCTACAGTTGG + Intronic
932327969 2:70876028-70876050 CAGTGGGTATAGCACTCGGAGGG + Intergenic
937975837 2:127581688-127581710 CGGTGGGTCAAGCCCTCAGTGGG - Intronic
938828228 2:135028197-135028219 CAGAGTGTCTAACACACAGTAGG + Intronic
939079219 2:137639547-137639569 CAGTGGGTCTACCATTCACGAGG - Intronic
939140835 2:138352829-138352851 CAGAGTATCTAACACTCAGTGGG - Intergenic
941048734 2:160706607-160706629 CAGTGAGTATAACACCCAGTAGG + Intergenic
946049941 2:216854263-216854285 CCCTGGGTCTAACACACAGGAGG - Intergenic
946649095 2:221871876-221871898 CAGTGGGTCCAACCCACAGAGGG + Intergenic
1169421416 20:5463681-5463703 CAGTGGGTCCAACCCACAGAAGG - Intergenic
1169972407 20:11282452-11282474 CAGTGGGGATACCCCTCAGTGGG + Intergenic
1171277050 20:23866326-23866348 AAGTAGTTCTCACACTCAGTTGG + Intergenic
1174305166 20:49609841-49609863 CACTGTGTCTGGCACTCAGTAGG - Intergenic
1179123104 21:38567026-38567048 CAGTGAGGCTGACATTCAGTAGG - Intronic
1182000365 22:26914893-26914915 CTGTGGGGTTTACACTCAGTGGG + Intergenic
1182058517 22:27380010-27380032 CATTGAGTCTAAAACTCACTGGG - Intergenic
1185125023 22:49005183-49005205 CAGTGGCTCTGCCACCCAGTGGG + Intergenic
955494107 3:59513099-59513121 CAGTGGTTCTAACTCTAAGTGGG + Intergenic
955750373 3:62180432-62180454 CTGTGGTTCAGACACTCAGTTGG + Intronic
957396733 3:79649173-79649195 CAGTGGTTCTCAAATTCAGTTGG - Intronic
957625248 3:82646839-82646861 CAGTGGATCTAACATTCTGGGGG - Intergenic
962609212 3:137059274-137059296 CATTGTGTTTGACACTCAGTGGG - Intergenic
969063052 4:4454499-4454521 CACTGGGTCTCACACTCACCAGG - Intronic
970345562 4:15149342-15149364 CAGGGAGTCTCACACGCAGTGGG - Intergenic
975060770 4:69995743-69995765 CAGTGGGATTAACATGCAGTGGG + Intergenic
975576717 4:75870324-75870346 CAGTAGGTCTGACATTCACTTGG + Intronic
976411931 4:84723784-84723806 CAGTGAGTTTAAGACTGAGTAGG + Intronic
976760038 4:88539073-88539095 CAGTGGGTGCAACACACAGAGGG + Intronic
976799047 4:88967681-88967703 CAATGGGTAGAAAACTCAGTGGG + Intronic
977024605 4:91801289-91801311 CAGTGGATCTGACACATAGTAGG + Intergenic
983332312 4:166346271-166346293 ACGTGGGTCTTCCACTCAGTGGG + Intergenic
985922950 5:2993867-2993889 CAGTGGGACTAGCACTCTGATGG + Intergenic
986646534 5:9921634-9921656 CAGTGGGTCAGTCACTCATTAGG - Intergenic
987537131 5:19203994-19204016 CAGAGGGTCTATCACTGAGCTGG + Intergenic
993480385 5:88417296-88417318 CTGTGTGTCTGACACACAGTAGG + Intergenic
996982188 5:129512149-129512171 GAGTATGTCTAAGACTCAGTAGG + Intronic
1003178094 6:3768795-3768817 CAGTGTCTCTAACACTCACTAGG + Intergenic
1003722912 6:8724971-8724993 CAATGGGTCTAAGACACTGTGGG + Intergenic
1003762493 6:9196085-9196107 CAGTGGGGCTAACAGTGAGGAGG + Intergenic
1005468211 6:26136155-26136177 CAGAGGGCCTGACACTTAGTGGG + Intronic
1008075358 6:47139806-47139828 CAATGGGTCTGACACATAGTGGG + Intergenic
1011385406 6:86792040-86792062 TAGTGGGTGTAACACTAATTTGG + Intergenic
1014171862 6:118287652-118287674 CAGTGGTTCTCAAACTCAGAGGG - Intronic
1016254194 6:142084165-142084187 CCCTGGGTCTAACACTCACTAGG - Intronic
1018805706 6:167258134-167258156 CAGTGGGCCCAACCCTCAGAGGG + Intergenic
1019849109 7:3537039-3537061 CAGTGGGTAAAAGACTCAGAGGG - Intronic
1022772694 7:33491568-33491590 CATAGGGCCTAACACACAGTAGG - Intronic
1023053842 7:36276102-36276124 CAGTAGGTCTCAGCCTCAGTAGG - Intronic
1023604684 7:41918802-41918824 CAGTGGGTGGGAAACTCAGTAGG + Intergenic
1024057885 7:45677160-45677182 CAGTGCTTTTACCACTCAGTAGG + Intronic
1028904168 7:96134603-96134625 CAGAAGGTGGAACACTCAGTGGG - Intronic
1033030030 7:137817292-137817314 CAGTGTCTATAACACACAGTAGG + Intronic
1034739434 7:153459836-153459858 TAGTGGGTCTACCACTCAATTGG + Intergenic
1038914738 8:32008282-32008304 CAGTGGATCTCAGATTCAGTGGG - Intronic
1043982169 8:86655733-86655755 CACAGTGTCTAACACACAGTAGG + Intronic
1047450187 8:124958495-124958517 CATTGTGTCTGCCACTCAGTGGG - Intergenic
1049093154 8:140532209-140532231 CAGTGCGTCGATCACTAAGTCGG + Intronic
1051544623 9:18260217-18260239 CAGTGGGTAGAAGACTCAGCAGG - Intergenic
1060459461 9:123836013-123836035 CAGGGTGTCTGACACACAGTAGG + Intronic
1061133408 9:128720637-128720659 CAGAGGCTCTAACAGTCTGTGGG - Exonic
1061621124 9:131811981-131812003 CAGTGGGTCCTACAGTCAGGTGG - Intergenic
1187426952 X:19186530-19186552 CAGTAGGTCTAATACACACTTGG - Intergenic
1191174248 X:57482553-57482575 CAGTGGGTCCAACCCACAGGAGG - Intronic
1194837563 X:98699427-98699449 CAGTGGGTGTAGCACCCAGAGGG - Intergenic
1195124083 X:101787644-101787666 CAGTGGGTTTAAAAGTCAGGGGG - Intergenic
1195820958 X:108944678-108944700 CAGTGGGTCCAACCCACAGAGGG - Intergenic
1197184660 X:123573338-123573360 CAGTGGGTCCAACCCACAGAGGG + Intergenic
1197882202 X:131178521-131178543 CAGAGGGCCTGACACTCAATTGG + Intergenic
1198517970 X:137427696-137427718 CACTGGGTCTGGCACACAGTAGG - Intergenic
1199077854 X:143544932-143544954 CAGTGGATCTACCATTCTGTGGG + Intergenic
1199980767 X:152919254-152919276 CAGCTGGTCCAACACTGAGTGGG - Intronic