ID: 915354361

View in Genome Browser
Species Human (GRCh38)
Location 1:155247326-155247348
Sequence CACCTCTAGCTGCATGACCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 7, 3: 58, 4: 356}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915354361_915354363 -9 Left 915354361 1:155247326-155247348 CCAAGGTCATGCAGCTAGAGGTG 0: 1
1: 0
2: 7
3: 58
4: 356
Right 915354363 1:155247340-155247362 CTAGAGGTGGCAGAGCTGAGAGG 0: 1
1: 1
2: 3
3: 46
4: 371
915354361_915354364 8 Left 915354361 1:155247326-155247348 CCAAGGTCATGCAGCTAGAGGTG 0: 1
1: 0
2: 7
3: 58
4: 356
Right 915354364 1:155247357-155247379 GAGAGGCCACCTAGATTTTTTGG 0: 1
1: 0
2: 3
3: 14
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915354361 Original CRISPR CACCTCTAGCTGCATGACCT TGG (reversed) Exonic
901547434 1:9969008-9969030 CAGCTCCAACGGCATGACCTTGG - Intronic
902561879 1:17282770-17282792 CTACTCTACCTGCAGGACCTAGG - Intronic
902624631 1:17669502-17669524 CTCTTCTAGCTGTGTGACCTTGG - Intronic
902775678 1:18673140-18673162 CACATATAGCTGTGTGACCTTGG + Intronic
903327409 1:22577357-22577379 CATCCCCAGCTGCATGACCTTGG - Intronic
904062777 1:27724718-27724740 CACAACTAACTACATGACCTTGG - Intergenic
904917131 1:33978148-33978170 CCCCAGTACCTGCATGACCTTGG - Intronic
905879598 1:41454923-41454945 CACCTCTAGCTGTGTGACCTTGG + Intergenic
906704807 1:47887273-47887295 CACTTATAGCTGTGTGACCTTGG - Intronic
906706744 1:47900507-47900529 ACTTTCTAGCTGCATGACCTTGG - Intronic
906726707 1:48049551-48049573 CACCTCCAGCTGTGTGACTTTGG + Intergenic
906791838 1:48665562-48665584 CACTGCTAGCTGAATGACCTTGG - Intronic
906944746 1:50286162-50286184 AATCATTAGCTGCATGACCTTGG - Intergenic
907273032 1:53301757-53301779 TGCCTCAAGCTACATGACCTTGG - Intronic
907374254 1:54022528-54022550 CACCACTAGCTGAGTGATCTTGG + Intergenic
907516883 1:54998457-54998479 CATCTTTAGCTGTGTGACCTTGG + Intergenic
907518466 1:55008127-55008149 AGCCGCTAGCTGCAAGACCTAGG - Intronic
907848569 1:58232295-58232317 CACTTCTAGCTCCATGGCATGGG - Intronic
907892920 1:58652411-58652433 CACTTCTGGCTGCATGACGTTGG + Intergenic
908155116 1:61345426-61345448 CACCTCTGACTTCATGACCTGGG + Intronic
908329113 1:63052889-63052911 CACTTCCAGCTGTGTGACCTTGG - Intergenic
908887470 1:68806087-68806109 AGCCACTAACTGCATGACCTTGG + Intergenic
909325451 1:74346397-74346419 CATTTTTAGCTGCAGGACCTCGG - Intronic
909849839 1:80446860-80446882 AACTTCTAGTTGTATGACCTTGG - Intergenic
910857691 1:91712153-91712175 AACCTCAACCTGCAAGACCTTGG + Intronic
911014493 1:93317713-93317735 CACCTGTATCAGAATGACCTGGG + Intergenic
912367811 1:109149473-109149495 CACCCCATGCTGCATGACCGGGG - Intronic
912558133 1:110530832-110530854 AGCTACTAGCTGCATGACCTTGG + Intergenic
912565185 1:110582443-110582465 CCCTGCCAGCTGCATGACCTTGG + Intergenic
912618735 1:111133670-111133692 CACATCCAGCTCTATGACCTTGG - Intronic
913295904 1:117320211-117320233 CCCTTCTAGCTGTGTGACCTTGG + Intergenic
915299771 1:154945308-154945330 TACCTCTACCTGCATGGCCCAGG - Intronic
915354361 1:155247326-155247348 CACCTCTAGCTGCATGACCTTGG - Exonic
916511543 1:165476198-165476220 ACCATCTAGCTGGATGACCTTGG - Intergenic
916793569 1:168145602-168145624 CACCTCTCTTTACATGACCTTGG - Intergenic
916823366 1:168421880-168421902 CTCTTCTAGCTGCATGACCTTGG + Intergenic
918281816 1:183013946-183013968 CACCAGCAGCTGAATGACCTTGG + Intergenic
920048351 1:203148282-203148304 GGCCACTAGCTGTATGACCTTGG + Intronic
922749126 1:228062565-228062587 CAGCCTTAGCTGCATGCCCTGGG - Intergenic
1064692391 10:17931375-17931397 CACATCAAGATTCATGACCTAGG + Intergenic
1064709345 10:18107773-18107795 AACCTCTAGCTTAATAACCTTGG + Intergenic
1065259013 10:23905495-23905517 CTCCTTTAGCTTTATGACCTTGG - Intronic
1068094231 10:52470220-52470242 TACCTCTAGCTGAGTGATCTAGG + Intergenic
1069553687 10:69382660-69382682 CACCTCCAGCAGCATGTCCTTGG - Exonic
1069690476 10:70348546-70348568 CACTTCTAGCTATATGACCTGGG - Intronic
1069747304 10:70723937-70723959 CACTTCTAGCTGCGTGGCCTTGG + Intronic
1070371777 10:75789132-75789154 CACTTCTAGCTGTGTGACTTTGG + Intronic
1070425094 10:76279206-76279228 CAATTATAGCTGTATGACCTTGG + Intronic
1070801333 10:79246152-79246174 ACCCTCTTGCTGGATGACCTTGG - Intronic
1070987583 10:80701536-80701558 CACTCCAAGCTGCGTGACCTTGG + Intergenic
1072274105 10:93805580-93805602 CTCCTCTAGCTCTAGGACCTGGG + Intergenic
1072454261 10:95562094-95562116 CACCACTTGCTGTGTGACCTCGG - Intergenic
1074273347 10:111976687-111976709 ACCATCTAGCTGTATGACCTTGG + Intergenic
1074501368 10:114028002-114028024 ATCTGCTAGCTGCATGACCTTGG - Intergenic
1075942984 10:126407242-126407264 CACCTCTGCCTGCATCACGTTGG + Intergenic
1075981536 10:126744656-126744678 CACTTCTAGTTGTGTGACCTTGG + Intergenic
1078525779 11:12100198-12100220 CAAATCTAGCTGTATGACCTTGG - Intronic
1078800395 11:14638141-14638163 CATTTGTAGCTACATGACCTTGG - Intronic
1080040389 11:27753918-27753940 CACCATGAGCTGCATGACCTTGG - Intergenic
1080415657 11:32067751-32067773 CCACACTTGCTGCATGACCTTGG + Intronic
1080492553 11:32781898-32781920 CACCTCCTGCTGCGTGGCCTGGG - Intronic
1080635449 11:34119442-34119464 CAGCTCCAGCTGCAGGCCCTAGG + Intronic
1081484306 11:43516064-43516086 TCACTCTGGCTGCATGACCTGGG - Intergenic
1081648678 11:44808241-44808263 CTCTTCTAGCTGTGTGACCTTGG - Intronic
1081676079 11:44970401-44970423 CTCCTCTTGCTGTGTGACCTTGG + Intergenic
1083148155 11:60773739-60773761 CCCAACTAGCCGCATGACCTTGG + Intronic
1083724361 11:64620513-64620535 CATCTCTTGCTGGCTGACCTCGG + Intronic
1084087546 11:66861523-66861545 CACCTCTAGCTGCATGTTCTGGG - Intronic
1084127074 11:67106375-67106397 CGAAACTAGCTGCATGACCTTGG + Intergenic
1084440219 11:69168398-69168420 CACCTCTACCTGGGTGGCCTGGG + Intergenic
1084948652 11:72652717-72652739 CATTTCTAGCTGCATGACTTTGG - Intronic
1085115365 11:73926814-73926836 ACCAACTAGCTGCATGACCTAGG - Intronic
1085258416 11:75190406-75190428 CACCTCCAGCTGAAGGACCATGG - Intronic
1085608790 11:77927577-77927599 CACCTAGAGCTGTATGGCCTGGG + Intronic
1086433609 11:86759646-86759668 CACCTATAGCATCATGACTTAGG + Intergenic
1087291376 11:96324215-96324237 CACTTGTGGTTGCATGACCTGGG + Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1088582379 11:111328447-111328469 CAATTCTAGCTGTATGGCCTTGG + Intergenic
1088591143 11:111404375-111404397 CTCCTCTAGCTGGATGACATTGG - Intronic
1089699356 11:120235155-120235177 CACCTCTACCTGCAAGACCCTGG - Intergenic
1089730382 11:120515289-120515311 CATCACTCCCTGCATGACCTCGG + Intronic
1089883426 11:121796530-121796552 CACTTCTAGCTGTGTGATCTTGG + Intergenic
1089952626 11:122543738-122543760 CACCTTTATCTGCATAAACTAGG - Intergenic
1090211575 11:124924387-124924409 CACTTCTAGCTGTGTGACCTTGG + Intronic
1090245854 11:125215412-125215434 CTTTTCTAGCTGAATGACCTTGG - Intronic
1090298964 11:125617355-125617377 CAATTCTAGCTGGGTGACCTTGG - Intronic
1090778624 11:129986747-129986769 CAGCTCCAGCTCCATGACCCAGG + Intronic
1091281867 11:134386292-134386314 CACCTCTCTCTGCATGGGCTTGG + Intronic
1091817550 12:3451321-3451343 CACAACTAGCTGCAAGACTTTGG - Intronic
1091888917 12:4037362-4037384 CATGTCTAACTACATGACCTTGG - Intergenic
1093769609 12:23003405-23003427 CACCTCTAGCACCATCACATTGG + Intergenic
1094150992 12:27282913-27282935 CATGTCTAGCTGTATGATCTTGG + Intronic
1095050776 12:37552605-37552627 CACCTCTAACTGCAACACTTTGG + Intergenic
1095464759 12:42478696-42478718 CAGCTCTCTCTACATGACCTTGG - Intronic
1096198962 12:49667479-49667501 TACGTCAAGCAGCATGACCTGGG + Intronic
1096412782 12:51389407-51389429 CATTTCTAGCTGTGTGACCTTGG - Intronic
1096598223 12:52710918-52710940 CCCTTCTAGTTACATGACCTTGG + Intergenic
1098068923 12:66650873-66650895 CAAATCTAGCAGCATAACCTTGG + Intronic
1100723225 12:97380667-97380689 CACAGCTGGCTGAATGACCTTGG - Intergenic
1101470387 12:104991331-104991353 TACCTCTATCTGAATTACCTTGG - Intronic
1101854435 12:108430296-108430318 CACCACCAGATGGATGACCTTGG + Intergenic
1102347388 12:112168705-112168727 CCCAGCTGGCTGCATGACCTTGG + Intronic
1102868449 12:116393244-116393266 CTCATCTGGCTGTATGACCTTGG + Intergenic
1102889922 12:116550620-116550642 TCCATCTAGCTGCATGACCTTGG + Intergenic
1103053315 12:117799679-117799701 CACTTCAAGCTGAGTGACCTTGG + Intronic
1106133687 13:26958858-26958880 CACCCCCAGCTGCTTGTCCTTGG - Intergenic
1106958945 13:34975077-34975099 CATTTCTACCTGCTTGACCTAGG - Intronic
1110805517 13:79749968-79749990 CACTTCTAGCTGTGTGAACTTGG - Intergenic
1113636729 13:111924629-111924651 AACCTTTCGCTGCATGAGCTTGG - Intergenic
1113973424 13:114208094-114208116 GACTTCTAGCTGTGTGACCTTGG + Intergenic
1114543902 14:23484241-23484263 CAATTCTGGCTGCAGGACCTTGG + Intronic
1116991366 14:51280380-51280402 CACATCTAGCTCTATGATCTTGG - Intergenic
1117591174 14:57269477-57269499 CACGAATAGCTGCGTGACCTTGG + Intronic
1121246751 14:92466124-92466146 CACTTCTAGCTGTGTGAGCTTGG + Intronic
1121404483 14:93711121-93711143 TCCCGCTAGCTGCATGATCTTGG - Intergenic
1121437250 14:93927911-93927933 CACCTGTAGCTGGGTCACCTTGG + Intronic
1121840772 14:97132038-97132060 CACCACTATCTCCATGGCCTTGG - Intergenic
1121893937 14:97627437-97627459 CACCACTATTTGAATGACCTTGG + Intergenic
1122347453 14:101069388-101069410 CACCTCCAGCTGGGTGACCTTGG - Intergenic
1122468994 14:101953358-101953380 CACTCCCAGCTGCATGACCTTGG - Intergenic
1125400419 15:39296269-39296291 CTACACCAGCTGCATGACCTTGG + Intergenic
1125482010 15:40087635-40087657 CTCCTCCAGCTGAATGATCTTGG - Intergenic
1125626821 15:41115955-41115977 CACGTCTAGTTGCCTCACCTCGG + Exonic
1126540505 15:49817202-49817224 CACCTATAGCTGAATCAGCTGGG - Intergenic
1127366438 15:58294937-58294959 CTTCACTTGCTGCATGACCTTGG + Intronic
1127422736 15:58823537-58823559 CACCTCTAGCTCCACGTACTTGG + Intronic
1128341449 15:66825298-66825320 CATTTCTAGCTGTGTGACCTTGG + Intergenic
1128691632 15:69728591-69728613 CACCTCTAGCTGTATGACTTTGG + Intergenic
1129111842 15:73341707-73341729 GAGGTCTAACTGCATGACCTTGG + Intronic
1129696733 15:77744724-77744746 TAGCTCTATGTGCATGACCTTGG - Intronic
1129786322 15:78312607-78312629 CACCTCTATCTTCCTGCCCTGGG + Intergenic
1129976148 15:79823472-79823494 CAACACCAGCTGCGTGACCTTGG + Intergenic
1130836555 15:87655398-87655420 CACTGGTAGCTGCATGTCCTGGG - Intergenic
1132315950 15:100890651-100890673 CACCTCTGGCTGGGTGACCTAGG - Intronic
1132803977 16:1767278-1767300 CGCCTCTATCTGCATGGTCTTGG - Exonic
1133459710 16:5976992-5977014 CACCTCTGCCAGCATCACCTGGG + Intergenic
1133755302 16:8758246-8758268 CTCCACTAGCTGTGTGACCTCGG - Intronic
1133841355 16:9412750-9412772 CACATCTAGCCGAGTGACCTTGG + Intergenic
1133916245 16:10112358-10112380 CAGCTCTATCTGCATCACCCAGG + Intronic
1133988414 16:10685855-10685877 CACCTCTGGTTGCATCATCTGGG + Intronic
1134349907 16:13427316-13427338 TTCATCTAGCTGCATAACCTTGG - Intergenic
1134627502 16:15732824-15732846 CCTCTCTAGCTGTGTGACCTTGG + Intronic
1134740328 16:16537704-16537726 CACTCCTGGCTGCATGACCTTGG + Intergenic
1134927167 16:18174466-18174488 CACTCCTGGGTGCATGACCTTGG - Intergenic
1135586117 16:23672415-23672437 CATCACTAGCTGTATGACCTTGG - Exonic
1135636044 16:24076567-24076589 CACGTCTAGCTGCATGGTCTGGG + Intronic
1136058711 16:27709922-27709944 ACCTTCCAGCTGCATGACCTTGG - Intronic
1137385026 16:48033518-48033540 CACCACTAGCTGTTTGACCTTGG + Intergenic
1137393876 16:48103543-48103565 CACAACTAGCTGAAGGACCTTGG - Intronic
1137821910 16:51454083-51454105 CCCCTCTAGGTGCATAAACTGGG + Intergenic
1138317376 16:56081648-56081670 CACCAGTACCTGCCTGACCTTGG - Intergenic
1138543787 16:57704706-57704728 CAGCTCCAGCTCCATGACCTTGG - Intronic
1138655348 16:58488132-58488154 CCCCACTAGCTGTGTGACCTTGG - Intronic
1139928234 16:70504078-70504100 ATTTTCTAGCTGCATGACCTTGG + Intronic
1140612316 16:76615323-76615345 CCTCTGTAGCTGTATGACCTTGG - Intronic
1140874305 16:79136683-79136705 CCTTTCTAGTTGCATGACCTGGG + Intronic
1141157292 16:81606207-81606229 CACTCCTAGCTAGATGACCTTGG + Intronic
1141826815 16:86486417-86486439 CACCTGTTGCTGCGTGACCTGGG + Intergenic
1141916093 16:87098377-87098399 CAGCAACAGCTGCATGACCTTGG + Intronic
1143990171 17:10952391-10952413 CCCCTTTAGCTGTCTGACCTTGG + Intergenic
1144704964 17:17362279-17362301 CACCCCCAGCTGCAGGACCCTGG - Intergenic
1144753730 17:17667400-17667422 CACCTGTTGCTGTGTGACCTTGG - Intergenic
1145000735 17:19302813-19302835 CACTTCTTAATGCATGACCTTGG - Intronic
1145069477 17:19791287-19791309 CACCTGTAGCTGCAGCACTTCGG + Intronic
1145817866 17:27808549-27808571 CAGCTTTAGCTGTATGATCTTGG - Intronic
1145976655 17:28987838-28987860 CATCATTAGCTGCGTGACCTTGG - Intronic
1146554820 17:33814185-33814207 CACTTCCAGCTGAATGTCCTTGG - Intronic
1148491674 17:48027447-48027469 CACCTAAAGCTGGGTGACCTAGG - Intronic
1148566732 17:48637339-48637361 CGTCCCTAGCTGCATGACCCTGG + Intergenic
1148642352 17:49197573-49197595 GACCTCTGGCCACATGACCTCGG + Intergenic
1148667807 17:49387868-49387890 GTCACCTAGCTGCATGACCTGGG - Intronic
1148821034 17:50359834-50359856 CACAGCTTGCTGAATGACCTTGG - Intronic
1149317391 17:55451321-55451343 CACCTCCAGCTGGCTGACCTTGG + Intergenic
1149549500 17:57529821-57529843 CACCTCTACCTGCTTGACTCTGG - Intronic
1149705848 17:58693799-58693821 CACCACTTACTGCATGACTTTGG - Intronic
1150281722 17:63932788-63932810 CCCCTCCAGATGCCTGACCTGGG - Intergenic
1150331150 17:64295344-64295366 CACAATTAGCTGTATGACCTTGG + Intergenic
1150338355 17:64345993-64346015 CACCCCTTGCTCCATGATCTGGG - Intronic
1150454597 17:65296856-65296878 CATCTCTAGCGGCACGATCTCGG + Intergenic
1150478794 17:65493657-65493679 CACTTCTAGCTCTATGAACTTGG + Intergenic
1150581387 17:66477019-66477041 ATTCTCCAGCTGCATGACCTTGG - Intronic
1151292195 17:73158330-73158352 CACTGCTAGCTGTGTGACCTTGG + Intergenic
1152253308 17:79222995-79223017 CACCTTTTCCTGCATGCCCTGGG + Intronic
1152396023 17:80033999-80034021 CACTCCTAACTGCATGAGCTTGG + Intronic
1152704877 17:81838163-81838185 CACCTCTAGGTGCAAAGCCTTGG + Intergenic
1153324217 18:3801523-3801545 CACTTCTAGCTCTGTGACCTTGG + Intronic
1154193764 18:12251579-12251601 CTCCTCTAGCTGGGTGACCTTGG - Intergenic
1156336187 18:36173946-36173968 GACCTCTAACTGCGTGACCTTGG - Intronic
1156396459 18:36704189-36704211 CAAATCTAGCTGCAAGCCCTCGG + Intronic
1157165992 18:45358976-45358998 CACTTTTAGTTGCATGGCCTTGG + Intronic
1157183755 18:45520718-45520740 CACATCTAGCTGTGTGACCTAGG + Intronic
1157436077 18:47670413-47670435 CAGCTCTAACTTGATGACCTTGG - Intergenic
1157643358 18:49241351-49241373 CACTATTAGCTACATGACCTTGG + Intronic
1157791117 18:50532045-50532067 CACCTCTAGCTTTATTACCAAGG - Intergenic
1157951429 18:52042819-52042841 CACATATATCTGCTTGACCTTGG - Intergenic
1158017729 18:52804534-52804556 AACCTGTAGCTTTATGACCTTGG - Intronic
1159566172 18:70053044-70053066 CACCTTTTGCTATATGACCTTGG + Intronic
1159573894 18:70152332-70152354 CACTTTTAGTTGAATGACCTTGG + Intronic
1162418964 19:10554994-10555016 AACCTCTTGTTGCATGACTTTGG - Intronic
1163839484 19:19597481-19597503 CACCTCTGGCTGCATGACCCTGG - Intronic
1163867695 19:19788096-19788118 CACATATAGGTGCATGGCCTGGG + Intronic
1163889456 19:19997937-19997959 TAACTCAAGGTGCATGACCTCGG - Intronic
1163952766 19:20605913-20605935 CACGTTTAGGTGCATGGCCTGGG + Intronic
1163961950 19:20704992-20705014 CACTTTTAGGTGCATGACCCGGG - Intronic
1165437543 19:35804541-35804563 CACCTCTAGCTGTGTGACCTGGG - Intronic
1165708324 19:37991901-37991923 CTGCACTAGCTGCATGACCTGGG + Intronic
1165734048 19:38164652-38164674 CAGCCCTAGCTGCATGTCCCTGG + Exonic
1167043606 19:47037469-47037491 CACTTATAGCTGTGTGACCTGGG - Intronic
1167606803 19:50485599-50485621 CACCTCTGTCTCCATGGCCTTGG + Exonic
925240055 2:2317167-2317189 CACGTCAACCTGCCTGACCTTGG + Intronic
926156130 2:10454932-10454954 CAGCACTAGCTGCTTGCCCTTGG - Intergenic
926714968 2:15916961-15916983 GGTCTCTAGCTGGATGACCTTGG + Intergenic
926891690 2:17644327-17644349 CACCTCTAACTCCTTGTCCTGGG - Intronic
926910806 2:17851069-17851091 CACCATTAGCTGTGTGACCTTGG + Intergenic
927552426 2:24011108-24011130 TATCTCTAGCTGCGTGACCCAGG - Intronic
928621422 2:33091982-33092004 CACCTCTAGCTGTGTGACTGTGG + Intronic
929998961 2:46848047-46848069 CACACCTTGCTGCATGGCCTTGG + Intronic
931611536 2:64106700-64106722 CACTGCTAGCTGTGTGACCTTGG - Intronic
932272838 2:70425877-70425899 GCCCTCTAGCTGCCTGCCCTAGG + Intergenic
932534684 2:72580722-72580744 CACTTCTTGCTGCCTGCCCTAGG + Intronic
932835609 2:75033319-75033341 CAGCTCCAGCAGCATCACCTGGG + Intergenic
934084306 2:88497297-88497319 CCTCTCTAGCTGCCTGATCTTGG - Intergenic
934687380 2:96331602-96331624 TGCCACTAGCTACATGACCTTGG - Intergenic
934970566 2:98760500-98760522 CACTTCAAGCTGCATGGCCTTGG - Intergenic
935351871 2:102158011-102158033 CAAAACTAGCTACATGACCTTGG - Intronic
938606134 2:132894734-132894756 CACCACTAGCTGCAAGGCCAGGG - Intronic
939617036 2:144373265-144373287 CCTCCCTAGCTGTATGACCTTGG - Intergenic
940155125 2:150647893-150647915 CTTTTCTAGCTGTATGACCTCGG - Intergenic
942420472 2:175801754-175801776 TACCCCTAACTGCCTGACCTTGG + Intergenic
942708369 2:178802570-178802592 CACTGCTAGCTGAAGGACCTTGG - Intronic
942804629 2:179915683-179915705 CACCTCCAGCTGTGTGATCTAGG - Intergenic
943259821 2:185644965-185644987 TACTGCTAGCTGTATGACCTCGG - Intergenic
945244914 2:207709324-207709346 CACCTCCACCTTCATGGCCTAGG - Intergenic
946107844 2:217387752-217387774 CACCACAAGCTGCATGGGCTAGG + Intronic
946840335 2:223813527-223813549 CACTTATAGCTGTGTGACCTTGG - Intronic
947219272 2:227777644-227777666 CACCTGTAGCTGCACGGCCCAGG + Intergenic
948730900 2:239963214-239963236 CATCACTGGCTGAATGACCTGGG - Intronic
1168835640 20:875528-875550 CACTTAGAGCTGCATGGCCTTGG + Intronic
1168890743 20:1294158-1294180 CACCTGCAGCTGTGTGACCTTGG + Intronic
1168977985 20:1982352-1982374 CCTTTCTAGCTCCATGACCTTGG - Intronic
1169712985 20:8585192-8585214 CATTTCTAGATGCATGTCCTAGG + Intronic
1172027266 20:31957005-31957027 CCCATCTGGCTGCATGACCTTGG - Intergenic
1172196894 20:33097948-33097970 CACTTCCAGCTACATGACTTTGG + Intronic
1172480601 20:35269256-35269278 CATTTATAGCTGCATGACCTAGG - Intronic
1172491068 20:35338449-35338471 ATTCTCTAGCTGTATGACCTTGG + Intronic
1172979462 20:38929919-38929941 ATTCTCTAGCTGCATGACTTCGG - Intronic
1173202389 20:40963435-40963457 CACTGCTAGCTGTGTGACCTTGG - Intergenic
1173288496 20:41693752-41693774 CACTTCTAGCTGTATAGCCTGGG - Intergenic
1173670904 20:44798336-44798358 CCTCACTAGCTGTATGACCTTGG + Intronic
1174141023 20:48413703-48413725 CACCACTAGCTGGGTGACTTTGG - Intergenic
1174153577 20:48502723-48502745 TACCTCAAGCCCCATGACCTCGG + Intergenic
1175669593 20:60890619-60890641 CCTTACTAGCTGCATGACCTTGG - Intergenic
1178105803 21:29317913-29317935 CACTACTAGCTATATGACCTTGG - Intronic
1178823918 21:35999447-35999469 CATAACTAGCTGAATGACCTTGG - Intronic
1179068916 21:38053675-38053697 CAGCTCCAGCTCCATGGCCTGGG - Intronic
1179104213 21:38383846-38383868 CAACTCCAGCTGCATCACCTGGG - Exonic
1179225992 21:39453702-39453724 CACTTGTAACTGTATGACCTTGG + Intronic
1179250472 21:39667531-39667553 CACTTCTAGCTGCACAACCTTGG - Exonic
1180003990 21:45011537-45011559 GACCTCTAGCTGCAGGGCCAAGG + Intergenic
1181750947 22:24988944-24988966 AATCACTAGTTGCATGACCTTGG - Intronic
1182473897 22:30565363-30565385 CTCTACTAGCTGCGTGACCTTGG - Intronic
1182782229 22:32877365-32877387 CACCAATAGCTGCGTGACCTTGG - Intronic
1183156354 22:36078511-36078533 CACAACTAGCTGTATGCCCTTGG - Intergenic
1184662001 22:45969706-45969728 CTCCTCTAGCTCCCTGTCCTGGG - Intronic
949348187 3:3096995-3097017 CACCACTGGCTGAGTGACCTTGG - Intronic
949485029 3:4529927-4529949 CACTTCTAGCTACGTGATCTTGG - Intronic
949876988 3:8632958-8632980 CACTTCTAGCTGCATCTTCTTGG + Intronic
951811769 3:26708485-26708507 CACCTCAATCTGTTTGACCTTGG + Intronic
953890603 3:46749518-46749540 CATCTCTACCTGAAAGACCTAGG - Intronic
954130569 3:48558658-48558680 CAGCTCTAGCTGCTTGCCCTGGG + Intronic
954690439 3:52392744-52392766 CACCTCTCCCTGCCTGCCCTAGG + Intronic
954705812 3:52479976-52479998 CCTCCCTGGCTGCATGACCTCGG + Intronic
955405937 3:58625829-58625851 CCCCACTAGCTGCATGACCCTGG + Intronic
955893825 3:63677830-63677852 CACTTCTAGCTGTGTGACTTTGG - Intronic
956785643 3:72640082-72640104 CACTACTAGCTGTGTGACCTGGG - Intergenic
956968339 3:74490075-74490097 CACCTATGGCTGGATGACATTGG + Intronic
957792257 3:84957213-84957235 TGCTTCTAGCTGTATGACCTTGG - Intergenic
959147741 3:102569795-102569817 CTCCTCTAGCTCCAGGCCCTGGG + Intergenic
959622764 3:108415957-108415979 CATCACTAGGTGTATGACCTTGG + Intronic
960957149 3:123040997-123041019 ATCCACTAGCTGCGTGACCTTGG + Intergenic
961457479 3:127031351-127031373 CCCCTCTACCTGCATGGCCGAGG + Intronic
962069030 3:132013829-132013851 CACCTCTAGCTGCATTGTTTTGG - Intronic
962620210 3:137170490-137170512 CTCCTGCGGCTGCATGACCTGGG + Intergenic
962897275 3:139727367-139727389 ACTCACTAGCTGCATGACCTTGG + Intergenic
963231562 3:142913613-142913635 ATTCACTAGCTGCATGACCTTGG + Intergenic
963811425 3:149780534-149780556 CACCTCTAGCTCCACGACATGGG + Intronic
963817586 3:149849499-149849521 CCACTCTATTTGCATGACCTTGG + Intronic
967249190 3:187519583-187519605 TACCACTAGCTGCATGGCCTCGG - Intergenic
967269182 3:187718968-187718990 CACCTTTAGCTGCGGGACCTTGG + Intronic
969133664 4:5012232-5012254 CATCACTAGTTGCATGACCAGGG - Intergenic
969371642 4:6735086-6735108 TACTTCTAGCTCTATGACCTTGG + Intergenic
969607510 4:8209985-8210007 CCCCTCTGGGTGCAGGACCTGGG - Intronic
970099527 4:12504554-12504576 CACTTCTAGCTGTGTGACCTTGG - Intergenic
970758567 4:19455587-19455609 CAGCTCCAGCTGCAGGACCCCGG + Intergenic
971241404 4:24892219-24892241 CACTTCTAGCTGAAGGATCTTGG + Intronic
971246295 4:24931515-24931537 CATCTTTAGCTGCAACACCTGGG + Intronic
971959007 4:33460099-33460121 CACTTCTAGCTGCATGACTTGGG + Intergenic
973757871 4:54093037-54093059 CATCACTAGCTGTGTGACCTTGG + Intronic
975608050 4:76175562-76175584 CACTTATAGCTGTGTGACCTTGG - Intronic
975663480 4:76710171-76710193 CACCAGTATCTGCATGGCCTGGG - Exonic
985660928 5:1156119-1156141 CGGCTCTCGCTGCGTGACCTTGG + Intergenic
986199058 5:5564799-5564821 CACTTCTAGCTGTGTGACCCTGG + Intergenic
987066797 5:14297756-14297778 CACCTCTAGCTGCACGGCTATGG + Intronic
988533276 5:32043392-32043414 CACCTCTGGTTACATGACCTGGG + Intronic
989252472 5:39333488-39333510 CACCTCAAGCTGCAACAGCTGGG - Intronic
989709811 5:44384637-44384659 CATGTCTAGTTGAATGACCTTGG + Intronic
990982164 5:61611769-61611791 ACCTGCTAGCTGCATGACCTTGG - Intergenic
991086232 5:62650577-62650599 ACCTTCTAGCTGCATGACATTGG + Intergenic
991298142 5:65102940-65102962 CACCCCAAGCTGCATAAACTTGG + Intergenic
991448506 5:66726677-66726699 TACCTCCTGCTGTATGACCTAGG - Intronic
991589879 5:68239584-68239606 CTCCACTAGCTGTGTGACCTTGG - Intronic
993653783 5:90553888-90553910 CACCTCTACCTGTAGGACCTGGG - Intronic
994163584 5:96584323-96584345 CACCTCCTGCTGCATGGCCCAGG + Intronic
994213712 5:97113596-97113618 CATCTTAAGGTGCATGACCTTGG - Intronic
995375143 5:111465574-111465596 CACCTTTATGTGCATGAACTAGG + Intronic
996436744 5:123441955-123441977 AATCGCTAGCTCCATGACCTTGG + Intergenic
996852503 5:127968157-127968179 CATCTCTACCTGGATGACTTAGG - Intergenic
997209369 5:132068467-132068489 CACAGCTCGCTGCATGTCCTTGG - Intergenic
997697355 5:135872136-135872158 CAGCTCCAGCTGTATGACCTGGG - Intronic
997955708 5:138277025-138277047 CGACACTAGCTGGATGACCTTGG + Intergenic
998491391 5:142550343-142550365 AACCACTAGCTGGATGACCTTGG - Intergenic
999197130 5:149790023-149790045 CACTTCTAGCTGGGTGACCTTGG + Intronic
999301164 5:150491327-150491349 TACTACTAGCTGCATGATCTAGG + Intronic
999486891 5:152005668-152005690 TACTTCTAGCTGTATGACCCTGG - Intergenic
999985357 5:156999296-156999318 CACCTCTAACTCCAACACCTTGG + Intergenic
1000140466 5:158398372-158398394 CTGCACTAGCTACATGACCTTGG - Intergenic
1000970780 5:167711779-167711801 GACCTCAACTTGCATGACCTTGG - Intronic
1001289739 5:170448389-170448411 CACTTCTACCTGCAGGATCTGGG - Intronic
1001555843 5:172636713-172636735 CCCTTCTAGCTGTGTGACCTGGG + Intergenic
1001556829 5:172642297-172642319 CACTACTAGCTGTGTGACCTTGG - Intronic
1001822606 5:174721502-174721524 CACTTCTACCTGCGCGACCTTGG + Intergenic
1003291975 6:4787716-4787738 CACCTCCACCTGCATGTCTTTGG - Intronic
1003453078 6:6255398-6255420 ACTCACTAGCTGCATGACCTTGG - Intronic
1004144019 6:13047896-13047918 CTCCTCCCGCTGCATGCCCTAGG + Intronic
1004266582 6:14153304-14153326 CACCTTTAGCTGCAGTAACTGGG - Intergenic
1004433951 6:15572250-15572272 CACTTATAGCTGCATGTCCTTGG - Intronic
1004851017 6:19699236-19699258 CATCTCTACCTGGATGTCCTGGG + Intergenic
1005093506 6:22084535-22084557 GACATATAGCTGCATGTCCTTGG + Intergenic
1005128874 6:22480034-22480056 TACTTTTAGGTGCATGACCTGGG + Intergenic
1005894752 6:30168475-30168497 CTCCTCCAGCTCCTTGACCTGGG - Exonic
1006027185 6:31154637-31154659 AGCCTCTAGCTCCATGGCCTGGG + Exonic
1006152001 6:31994688-31994710 CACCTCAATCTGCAGAACCTTGG - Exonic
1006158303 6:32027426-32027448 CACCTCAATCTGCAGAACCTTGG - Exonic
1006511168 6:34521996-34522018 CACCTGTAGCTGCGCGATCTTGG + Intronic
1006791086 6:36701760-36701782 CACCTCTACCTGCAGGGCCAGGG + Intronic
1007324432 6:41049243-41049265 CCTCTCTAGCTGCATCACCTTGG + Intronic
1007458479 6:41999087-41999109 CACTTCTAGCTGTGGGACCTTGG - Intronic
1007770329 6:44186786-44186808 CACCTCTTGTTCCATGGCCTAGG + Intergenic
1008559003 6:52704934-52704956 CACCTCTGACAGCATGATCTTGG - Intergenic
1010012024 6:71059026-71059048 CCTCACTAGCTGTATGACCTTGG - Intergenic
1010368071 6:75075855-75075877 CTTTTCTAACTGCATGACCTTGG + Intergenic
1011261917 6:85478554-85478576 CACCACTAGCTGTCTGACTTTGG + Intronic
1013203882 6:107928889-107928911 CACTTCTAACTACATGACTTTGG + Intronic
1015938550 6:138426288-138426310 CACCTCTCGCTGTGTGACCTGGG + Intronic
1019612982 7:1946212-1946234 CACCTCTAGCTGCAGGCCCAGGG + Intronic
1020012669 7:4815269-4815291 CACCCCTACCTGGATGAGCTGGG + Exonic
1022282921 7:28928800-28928822 TACCTGTAGATGAATGACCTTGG - Intergenic
1022416197 7:30179171-30179193 CTCCACTAGCTGTGTGACCTTGG + Intergenic
1022820314 7:33953412-33953434 CACTTCTAGTTACTTGACCTTGG + Intronic
1023245375 7:38197880-38197902 TACTTCTAGCTGCTTCACCTCGG + Intronic
1023740619 7:43277869-43277891 CACATCAAGCTGCATTTCCTGGG - Intronic
1024045378 7:45582322-45582344 CACCTCCAGCTCCGTGACCTTGG + Intronic
1025233381 7:57217798-57217820 TACCTCAAGCCCCATGACCTCGG - Intergenic
1025296704 7:57781141-57781163 CACCTCTAACTGCAACACTTTGG + Intergenic
1026830358 7:73606752-73606774 CACCACTTGCTCAATGACCTGGG + Intronic
1029957452 7:104654489-104654511 CTCAAATAGCTGCATGACCTTGG + Intronic
1031604017 7:123748223-123748245 CACCTCTTACTGCTTGATCTGGG - Intronic
1032953331 7:136941909-136941931 CAGTTCTAGCTATATGACCTGGG + Intronic
1033139090 7:138809106-138809128 CACCTCCAGCTGCATCTCCCAGG - Intronic
1033290403 7:140078230-140078252 CACCTCCAGCTGCCTGACTGGGG - Intergenic
1034903032 7:154919557-154919579 CAACTGTAGCTGTCTGACCTTGG - Intergenic
1037349412 8:17934581-17934603 CATTTTTAGCTGAATGACCTTGG + Intronic
1037477663 8:19273185-19273207 CATCTCTAGCTGAGAGACCTTGG + Intergenic
1037701067 8:21274150-21274172 TCCCTTTTGCTGCATGACCTTGG + Intergenic
1038035121 8:23681125-23681147 CACCTCTTGCTCCCTGACCTTGG + Exonic
1038159033 8:25019238-25019260 CAGCTCTAGCTCCATGTTCTGGG - Intergenic
1040073404 8:43206328-43206350 CTGCTCTGGCTGCAGGACCTAGG - Intergenic
1040381250 8:46875549-46875571 TACCTCTTTATGCATGACCTAGG + Intergenic
1042231064 8:66555263-66555285 CACCTCTACCAGTATGATCTTGG + Intergenic
1043815696 8:84798521-84798543 CACCTCTGGCTGTGTGGCCTTGG - Intronic
1044282408 8:90371375-90371397 CACATCTAGCAGCCTGACCTAGG + Intergenic
1045067659 8:98465234-98465256 CACCTCTAGCTGAGAGACCTAGG - Intronic
1045332327 8:101166194-101166216 TCACTCTAGCTGTATGACCTTGG - Intergenic
1047098558 8:121650805-121650827 CACTTCTATCTGCATGGTCTTGG + Intergenic
1047547347 8:125831690-125831712 CACCTTTAACTGTAAGACCTTGG - Intergenic
1047552350 8:125888684-125888706 CATAACTAGCTGAATGACCTTGG + Intergenic
1049208141 8:141372873-141372895 CCCTCCTAGCTGCATGACCTTGG - Intergenic
1049253801 8:141603375-141603397 CACCCCTAGCTGCCCGACGTGGG - Intergenic
1049337513 8:142094291-142094313 CACCTGCAGCTGTGTGACCTTGG + Intergenic
1049637150 8:143695163-143695185 CAACTCCAGGTGCATGACCCAGG - Exonic
1051861021 9:21624850-21624872 CACCTCTAGGTGCCAGACCTGGG - Intergenic
1051864984 9:21669972-21669994 CACCAACATCTGCATGACCTGGG - Intergenic
1053300078 9:36942746-36942768 CACTTGTAGCTACATAACCTAGG - Intronic
1054801364 9:69352618-69352640 CACTTCTAGCTATGTGACCTTGG - Intronic
1057042686 9:91858873-91858895 CCCCCATAGCTGCATGATCTTGG - Intronic
1057785613 9:98085328-98085350 CACCACTAGCTGTGCGACCTTGG + Exonic
1059127524 9:111706422-111706444 CACCACTATCTGTGTGACCTGGG - Intronic
1059277518 9:113108789-113108811 CACCTCCAGCTGAATGCCCAGGG - Intergenic
1059278733 9:113115762-113115784 CACCTCCAGCTGAATGCCCAGGG + Intergenic
1059466728 9:114473460-114473482 ACTCTCTAGCTGTATGACCTGGG + Intronic
1059699792 9:116764118-116764140 CCACACTAGCTGTATGACCTTGG - Intronic
1059980214 9:119763208-119763230 TACTTATAGCTGCATGACCCTGG - Intergenic
1060483147 9:124029833-124029855 CACCCCAATCTGCATGACTTTGG + Intronic
1060777653 9:126387865-126387887 CACTTCCAGATGCATGACCTTGG - Intronic
1060985365 9:127816378-127816400 CCCCACCTGCTGCATGACCTTGG + Intronic
1061121300 9:128644231-128644253 CACCTTTTGCTGTGTGACCTTGG - Intronic
1061200784 9:129137400-129137422 AAGCTCTAGCTGCATGGCGTTGG - Intronic
1061246866 9:129405037-129405059 CGCCTCTCGCTGGATGCCCTGGG + Intergenic
1062181056 9:135191569-135191591 CCCCACTGGCTGCATGAGCTCGG - Intergenic
1062529550 9:136993893-136993915 CACCTCCACCTGCCTGTCCTGGG + Exonic
1062668559 9:137692989-137693011 CACCTCTGCCTGCCTCACCTGGG + Intronic
1186757045 X:12682674-12682696 CATCCCTTGCTGCATGATCTTGG - Intronic
1187056233 X:15743750-15743772 CACCTCCTGCTGCATCCCCTGGG + Intronic
1188323979 X:28776685-28776707 ATTTTCTAGCTGCATGACCTTGG + Intronic
1189283656 X:39836906-39836928 CACTTCTAGCTGTGTGACTTGGG - Intergenic
1191215489 X:57928713-57928735 CCCCTCCAGCAGCCTGACCTAGG - Intergenic
1195705437 X:107734957-107734979 CAGCTCTAGCTGTGTGACCTTGG - Intronic
1195717518 X:107831225-107831247 GAGCTCTGGCTGCCTGACCTTGG + Intronic
1196499876 X:116367451-116367473 CACTTCTATATGCATGAACTTGG - Intergenic
1196736366 X:118984200-118984222 AATCACCAGCTGCATGACCTTGG - Intronic
1197712192 X:129679287-129679309 CAGCAGTAGCTGCATCACCTGGG - Intergenic
1199492608 X:148417562-148417584 CACTTCTAGCCGTATGACCTTGG - Intergenic