ID: 915354994

View in Genome Browser
Species Human (GRCh38)
Location 1:155250595-155250617
Sequence CCCTGCCACGGCGCCCCCCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915354994_915355001 -6 Left 915354994 1:155250595-155250617 CCGTGGGGGGCGCCGTGGCAGGG 0: 1
1: 0
2: 2
3: 20
4: 187
Right 915355001 1:155250612-155250634 GCAGGGGGCTTTCCTCGAAGGGG 0: 1
1: 0
2: 0
3: 13
4: 127
915354994_915355000 -7 Left 915354994 1:155250595-155250617 CCGTGGGGGGCGCCGTGGCAGGG 0: 1
1: 0
2: 2
3: 20
4: 187
Right 915355000 1:155250611-155250633 GGCAGGGGGCTTTCCTCGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 97
915354994_915355008 21 Left 915354994 1:155250595-155250617 CCGTGGGGGGCGCCGTGGCAGGG 0: 1
1: 0
2: 2
3: 20
4: 187
Right 915355008 1:155250639-155250661 GCAGGCCACAGTCCAGGCTGAGG 0: 1
1: 0
2: 7
3: 45
4: 440
915354994_915355002 3 Left 915354994 1:155250595-155250617 CCGTGGGGGGCGCCGTGGCAGGG 0: 1
1: 0
2: 2
3: 20
4: 187
Right 915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 66
915354994_915354999 -8 Left 915354994 1:155250595-155250617 CCGTGGGGGGCGCCGTGGCAGGG 0: 1
1: 0
2: 2
3: 20
4: 187
Right 915354999 1:155250610-155250632 TGGCAGGGGGCTTTCCTCGAAGG 0: 1
1: 0
2: 0
3: 12
4: 111
915354994_915355004 15 Left 915354994 1:155250595-155250617 CCGTGGGGGGCGCCGTGGCAGGG 0: 1
1: 0
2: 2
3: 20
4: 187
Right 915355004 1:155250633-155250655 GGCCCCGCAGGCCACAGTCCAGG 0: 1
1: 1
2: 3
3: 24
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915354994 Original CRISPR CCCTGCCACGGCGCCCCCCA CGG (reversed) Exonic
900002333 1:21590-21612 CCCTGCCAGGGAGCCTCCCGTGG + Intergenic
900022052 1:192114-192136 CCCTGCCAGGGAGCCTCCCGTGG + Intergenic
900119180 1:1041268-1041290 ACCTGCCGTGGCGCCCCCGAGGG + Exonic
900163053 1:1233417-1233439 CGCTGCCCCGGCAACCCCCAGGG - Exonic
900335659 1:2161779-2161801 CCATGCCACTGCGCCCTGCATGG + Intronic
900977104 1:6024780-6024802 TCCTGCCCTGGAGCCCCCCATGG - Intronic
902698891 1:18158202-18158224 CCCTGCCATGGCACCCCTGATGG + Intronic
902877998 1:19352580-19352602 CACTGCCACGTGGCCCCCCATGG - Intronic
903247739 1:22028542-22028564 TCCCGCCCCGCCGCCCCCCACGG + Intergenic
904811040 1:33163683-33163705 CCCCGCCAGGGCGCCGACCAAGG + Intronic
905871409 1:41406584-41406606 CCCTTCCACTGCCCCCCACAGGG + Intergenic
906697975 1:47837514-47837536 CCCTGCCTCTGCTCCCGCCAAGG + Intronic
911348200 1:96721954-96721976 CCCTCCCGCGGCCCCTCCCAGGG + Intronic
915354994 1:155250595-155250617 CCCTGCCACGGCGCCCCCCACGG - Exonic
915934262 1:160081618-160081640 CCCTGACACCGCCCCCCCCACGG - Exonic
920177630 1:204113009-204113031 CCTTGCCACGAGGCCCCCCAGGG + Exonic
921978413 1:221227882-221227904 CCCTGCCGAGGGGCTCCCCATGG - Intergenic
923954354 1:238997929-238997951 CCCTCCCACCTCTCCCCCCAAGG + Intergenic
1070787613 10:79171061-79171083 CCCAGCCAGGGCAGCCCCCATGG + Intronic
1071518275 10:86313556-86313578 CCCTGCCACGGAGACTCCCCTGG - Intronic
1071600897 10:86958314-86958336 CCCAGCCAGGGCTGCCCCCATGG + Intronic
1071601949 10:86962701-86962723 CCCTACCAAGGAACCCCCCATGG - Intronic
1075344581 10:121672919-121672941 CCCCACCACAGCGCCTCCCATGG - Intergenic
1075777089 10:124996178-124996200 CCCCGTCACAGCGCCCCCCCCGG + Intronic
1076746397 10:132516985-132517007 CCCTGCTACTGAGCGCCCCAAGG - Intergenic
1077008238 11:369181-369203 CCATCCCCCGCCGCCCCCCACGG + Intergenic
1077485372 11:2836053-2836075 CCACGCCACGGGGCACCCCATGG - Intronic
1083408918 11:62478311-62478333 CCCTGACAGGGCTCACCCCAGGG + Intronic
1083594364 11:63911926-63911948 CCCCGCCACAGCGCCCGCCCTGG - Exonic
1084173514 11:67411632-67411654 CACTGCCACCGCGCCCCCGCAGG - Intronic
1084234242 11:67776183-67776205 CCTTGCCACCGCACTCCCCATGG + Intergenic
1084520505 11:69659795-69659817 CCATGCCACGGCGGCCGCCTGGG + Intronic
1084784794 11:71435838-71435860 CCCTTCCCCCTCGCCCCCCAGGG - Exonic
1089581665 11:119485244-119485266 CCCTGCCTCGGGTCCCTCCATGG + Intergenic
1091375751 12:23652-23674 CCCTGCCAGGGAGCCTCCCGTGG + Intergenic
1091489974 12:924561-924583 CCCTGCCATGTCGCTCCCCAGGG - Intronic
1094523945 12:31219565-31219587 CCCTGCCAGGGAGCCTCCCATGG + Intergenic
1097192328 12:57225440-57225462 CCCCGCCAGTGCGCCCCCGAGGG - Exonic
1102001627 12:109561223-109561245 CCCTGCCACGGCACACCCACCGG + Intronic
1103796987 12:123510035-123510057 CCCTGCCGCTGGGCTCCCCAAGG - Intronic
1104898520 12:132175817-132175839 CCCTGCCCCCCCACCCCCCAGGG + Intergenic
1104929325 12:132329697-132329719 CCCCCCCACCGCGCCCCCCCGGG + Intergenic
1107481460 13:40789405-40789427 CCCTGCCACCGCCCCCAGCACGG - Intronic
1117867565 14:60165415-60165437 CACTGCCCCGGCTCCGCCCAGGG + Exonic
1118600815 14:67470492-67470514 CCCTGCCATGGCTCCCCTAAGGG + Exonic
1121767824 14:96502643-96502665 CCCTTCCCGGACGCCCCCCAAGG - Intronic
1122074150 14:99224909-99224931 CCATGCCACAGAGCCCCACAGGG + Intronic
1122306362 14:100769193-100769215 CCCTGCCCCTGTGCCCACCATGG - Intergenic
1122848590 14:104514310-104514332 CCCTGCCAGGGCGCCTGGCACGG - Intronic
1124654882 15:31499902-31499924 CCAAGCCACAGCGCCCTCCATGG + Intronic
1127308344 15:57729460-57729482 ACCTGCCATGGTGCCTCCCAGGG - Intronic
1129772866 15:78213745-78213767 TCCTGCCACTGGGTCCCCCAGGG + Intronic
1130230791 15:82095084-82095106 TCCTGCCCCAGCACCCCCCACGG - Intergenic
1132451179 15:101969349-101969371 CCCTGCCAGGGAGCCTCCCGTGG - Intergenic
1132852495 16:2031137-2031159 CCCTGCCAAGCCGCTCCCCCCGG - Intronic
1133073766 16:3264180-3264202 CCCTGGCCCGGCGCCCCAAAGGG + Intronic
1134160538 16:11884821-11884843 ACCTGCCTCGGCCTCCCCCAAGG - Intronic
1136141642 16:28292545-28292567 CCCGGCCCCGGCGCCCGCCCGGG - Exonic
1136923073 16:34347014-34347036 CCTCGCCAGGGCACCCCCCAGGG + Intergenic
1136981500 16:35064792-35064814 CCTCGCCAGGGCACCCCCCAGGG - Intergenic
1137591830 16:49698516-49698538 CGCTGCCACGCCGCCCGCCTGGG + Intronic
1140098642 16:71895794-71895816 CCCTGCCACGCCCCCCACCCAGG - Intronic
1141400710 16:83744682-83744704 CTCTGCAACGGCTCCCCCGAGGG + Intronic
1141554349 16:84827127-84827149 CACTGCCCCCGCACCCCCCAAGG + Intronic
1142127334 16:88416775-88416797 CCCTTCCAGGGCTCCCTCCACGG + Intergenic
1143024024 17:3930432-3930454 ACCTGCCACGGTGCCCCCAGAGG - Exonic
1143780215 17:9225387-9225409 CCCTGCCACCCCACCCCGCAGGG - Intronic
1144764473 17:17725105-17725127 CCCTGCCCCGGCGCCATCCCAGG - Intronic
1145279099 17:21455439-21455461 CCCTGCCAGGGCCCCCACCAGGG - Intergenic
1146774137 17:35597037-35597059 CCCGGCCACGGCCCCCACAACGG - Intronic
1148244981 17:46024701-46024723 CCCTGCCTCGGCCTCCCCCGTGG - Exonic
1150323102 17:64233200-64233222 CCCTGCCCCGGGGCCCACCCTGG + Intronic
1151155646 17:72121830-72121852 CCCTGCCGCGCCGCCCCCGCCGG - Intronic
1152261607 17:79270208-79270230 CTCTGCCAGGGCCCCCGCCATGG + Intronic
1152345278 17:79747523-79747545 CCCTGCCCCGGCGCCCCACCAGG + Intergenic
1152403848 17:80085463-80085485 CCCTGCCAGCGCACCCACCATGG + Intronic
1152545865 17:80999878-80999900 CCCAGCCGCGGGGACCCCCATGG - Exonic
1152608897 17:81306129-81306151 CCCTGCCCAGGCGGCCCCCAGGG - Intergenic
1152743992 17:82030966-82030988 CCCTTCCCAGGCGCCTCCCACGG - Exonic
1152799034 17:82322615-82322637 CCCTGCCATGCTGCCCTCCAGGG + Intronic
1152828464 17:82482304-82482326 CCCTGCCACATCACCCCACAGGG - Intronic
1153514478 18:5891334-5891356 CCCCGCCGCGGCGCCCCCCGGGG - Exonic
1154147070 18:11875195-11875217 CCCTGCCAGTGCTGCCCCCAGGG + Intronic
1154324325 18:13379276-13379298 CCCAGCCACGATGTCCCCCATGG + Intronic
1156171896 18:34494652-34494674 CCCTCCCCCTGCGCCCCTCACGG - Intronic
1157384168 18:47247864-47247886 GCCTGCGCCCGCGCCCCCCAGGG + Intronic
1157566015 18:48679851-48679873 CCCTCCCAGGCCACCCCCCAAGG - Intronic
1157602621 18:48903265-48903287 CCCTGCCACAGAGCCCCAGAAGG + Intergenic
1160453600 18:78980680-78980702 CGCCGCCGCGCCGCCCCCCAGGG + Intronic
1160634085 19:63198-63220 CCCTGCCAGGGAGCCTCCCGTGG + Intergenic
1160681150 19:412175-412197 CCCTGCCCCTGCCCCACCCAGGG - Intergenic
1160827354 19:1086772-1086794 CCCCGCCACGGGGCCCCGCGAGG + Exonic
1160894236 19:1395244-1395266 CCCTGGCACTGCGCCCACCCAGG + Intronic
1161059634 19:2208446-2208468 CCCTCCCACTGCTCCCCCGAGGG + Intronic
1162380774 19:10330427-10330449 CCCTGCCCTGGCCCGCCCCATGG + Intronic
1162531665 19:11239688-11239710 GCCTGCCTCAGCGGCCCCCATGG + Exonic
1162787221 19:13043303-13043325 CCATGCCACGGTGACCCCCAAGG - Intronic
1163453718 19:17393978-17394000 CAATGCCACGGCGCCGCCCGGGG - Intergenic
1164492447 19:28727498-28727520 CCCGGCCCGGGCGCCCCCCGAGG + Intergenic
1164577495 19:29414051-29414073 GCCTGCCACGGCCACCCCGATGG - Intergenic
1164594977 19:29526558-29526580 CGCCGCCACCGCGCCCCCCGCGG + Exonic
1165097810 19:33419272-33419294 TCCTGCCAGGGAGCCCCACAAGG + Intronic
1165349695 19:35269083-35269105 CCCCGCCCCCGCCCCCCCCATGG + Exonic
1165696918 19:37907467-37907489 CCCGGCGCCGCCGCCCCCCACGG - Intronic
1165786427 19:38464571-38464593 CCCTGCCCCGTCTCCTCCCACGG - Intronic
1166299412 19:41905698-41905720 CCCTGCCCCTGCGGCCCCCCAGG + Intronic
1166746809 19:45145640-45145662 TCCTGCCCTGGTGCCCCCCACGG + Exonic
1166837036 19:45673786-45673808 CCCTGCAGCCTCGCCCCCCAGGG - Intronic
1167492806 19:49801897-49801919 CCCTGGCAGGGCCCACCCCAGGG - Intronic
925294570 2:2768667-2768689 TGCTGCCACGACGCCCCCAAGGG + Intergenic
928262913 2:29783811-29783833 CCCTCCCACGGTCACCCCCAGGG + Intronic
930728970 2:54709513-54709535 CCCTGCCGCGGCCTCCCTCACGG - Intergenic
931834012 2:66080298-66080320 AACTGCCACTGGGCCCCCCAGGG - Intergenic
932823536 2:74921064-74921086 CTTTGCCACGGCTCCTCCCATGG - Intergenic
934954806 2:98608594-98608616 CCGTGACGCGGCGCGCCCCAAGG + Exonic
936567394 2:113591830-113591852 CCCTGCCAGGGAGCCTCCCGTGG - Intergenic
937912547 2:127082477-127082499 CCCTGCCTGGGCGCCCACCATGG - Intronic
938260554 2:129892461-129892483 CCCTCCCACGCTGCACCCCAGGG + Intergenic
938539704 2:132275840-132275862 CCCAGCCAAGGCTCCCACCACGG - Intergenic
942046303 2:172101271-172101293 CCCTCCCACGGCGGCCCCTTGGG + Intronic
946185761 2:217979631-217979653 CCCTGCCGCCCCACCCCCCAGGG + Intronic
947928099 2:233938828-233938850 CCTTGGCACGGCGCCCGCCTGGG + Intronic
948162814 2:235839105-235839127 CCATGCCACTGCTCTCCCCAGGG + Intronic
948413087 2:237779673-237779695 CCGTGCCATGGCTCACCCCAGGG + Intronic
1175874511 20:62222996-62223018 CCCTGGGACAGGGCCCCCCAGGG - Intergenic
1175902852 20:62366860-62366882 CCGGGCCACGGCGCTCCCCCTGG + Intronic
1175965586 20:62658597-62658619 CCCAGGCACGGGGCCCCACACGG + Intronic
1176101307 20:63365737-63365759 CCCTGCCATGGGGCCCCCCCTGG + Intronic
1180090339 21:45531003-45531025 CCCTGCCCCGTGGCCCCCCAGGG - Intronic
1180144928 21:45913638-45913660 CACTGCCACAGAGCCTCCCAGGG + Intronic
1180846392 22:18984759-18984781 CTCTGCCTCTGCGCACCCCAGGG - Intergenic
1181531917 22:23521868-23521890 CACTCCCACGGCGCCCCCCAAGG + Intergenic
1182094068 22:27614472-27614494 CACCGCCACGGCGCCCGCCGTGG - Intergenic
1182301152 22:29337838-29337860 CCCTGCCACGGAATCCCCCGGGG + Intronic
1184734801 22:46391755-46391777 CCCTGCGACTGCTTCCCCCATGG - Exonic
1185377345 22:50488535-50488557 ACCCCCCACGGCCCCCCCCACGG + Intronic
954335103 3:49911730-49911752 ACCAGCCACAGAGCCCCCCAGGG - Exonic
954417930 3:50403173-50403195 CACTGCCAGGGCCCCTCCCAGGG + Intronic
954707062 3:52486798-52486820 CCCTGCCCCGGAGGCCACCAGGG + Intronic
955769525 3:62373734-62373756 CCCGGACGCGGCGCCCCCAAAGG + Intronic
961386229 3:126524760-126524782 CCCTTCCCCTGCGCACCCCACGG + Intronic
961793374 3:129392494-129392516 CCCTGCCTCAGATCCCCCCATGG + Intergenic
961818912 3:129565291-129565313 CCCTGCCACGTCCCCCGCCTGGG + Intronic
961883871 3:130082727-130082749 CCTTGCCACCGCACTCCCCATGG + Intronic
968497916 4:928591-928613 CCCTGCCACTGAGCCCACCTTGG + Intronic
968688682 4:1978460-1978482 CCCTGCCAGGGAGCCCGCCCGGG + Intronic
968897700 4:3414343-3414365 CCCTGCCACGGGGCTGCTCAGGG - Intronic
969709437 4:8834352-8834374 CCCAGCCACGGCGGACCCCAAGG - Intergenic
969820903 4:9719573-9719595 CCTTGCCACTGCACTCCCCATGG - Intergenic
982009018 4:151089088-151089110 GCCTGCCTCGGCCCCCCCAAAGG - Intergenic
984552714 4:181180113-181180135 CTCTGCCATGGCGACCACCACGG - Intergenic
984845829 4:184107078-184107100 CCCTGCCACTCCCTCCCCCAGGG - Intronic
985541532 5:489742-489764 TCCTGGCACGGCCGCCCCCAGGG + Intronic
985941802 5:3142282-3142304 CCCTGACACGGCCCCCACCTAGG - Intergenic
989209628 5:38846166-38846188 CCCTGCCGCTGCGCCGCCCTCGG + Exonic
995724675 5:115170237-115170259 CCCCGCCCCGGCGCCGCCCTCGG - Intronic
998095172 5:139392504-139392526 CGCTGCCTCGGCGCCTCCCACGG - Exonic
998147909 5:139740677-139740699 CTCTGCCACTGCTCCCCACAAGG - Intergenic
999435304 5:151559086-151559108 CTCTGTCACTGAGCCCCCCAGGG - Intronic
1003003771 6:2361689-2361711 CCCTGTCACTCCGCCTCCCAGGG - Intergenic
1004599431 6:17133187-17133209 CCCTGCCCCTGCCCCCTCCAGGG + Intergenic
1005522773 6:26614561-26614583 CCCTGCGGCGGCGCCCCTCTTGG + Intergenic
1006075329 6:31528996-31529018 CCCTGCCAGGTCACCCGCCATGG + Exonic
1006164488 6:32056543-32056565 CCCTCCCACGGCTCCCACCCTGG + Intronic
1006531631 6:34660054-34660076 ACCTGCCTCTGCGCCTCCCAAGG - Intronic
1007575935 6:42925266-42925288 CCCAGCCACAGCGCCCCACCCGG - Exonic
1011790647 6:90894910-90894932 CCCTGCCAAGGAGCCTGCCAAGG - Intergenic
1015881909 6:137878723-137878745 CCATGCCAGGGAGCCCCTCAGGG - Exonic
1016937259 6:149456619-149456641 CCCCGCCCCGCCGCCCCCCAGGG + Intronic
1018364129 6:163100481-163100503 CACAGCCACCGCGCCCTCCAAGG + Intronic
1018774207 6:166998856-166998878 CCCTTCCCCGGCGCCCCCCCGGG + Intergenic
1019111964 6:169724081-169724103 CCCTGCCGCCGCGCGCCCCGCGG + Intronic
1019467841 7:1200122-1200144 CCCCGACTCGGGGCCCCCCAAGG + Intergenic
1019587597 7:1813715-1813737 CACTGGCACGGCTCCCCCCGTGG - Intergenic
1019587984 7:1815138-1815160 CCCTGCCCCCGCCCCCACCATGG + Intergenic
1022375371 7:29806893-29806915 CCCTGCCACGCCGCCCCGGCCGG + Intronic
1022375557 7:29807577-29807599 CGCCGCCCCGGCGCCCGCCACGG - Intronic
1022701123 7:32761676-32761698 ACCTGCCAAGGGGCGCCCCAAGG - Intergenic
1023848081 7:44134515-44134537 CCCTGCCACACAACCCCCCATGG - Intergenic
1024991164 7:55235433-55235455 CCCTGGCACAGAGCCCCGCAGGG - Intronic
1027177788 7:75915500-75915522 CCCCGCGCCGCCGCCCCCCACGG + Intronic
1027200902 7:76063331-76063353 TCCTGCCACGGTGCCCCAAAAGG - Intronic
1030974276 7:116101681-116101703 CCCTGCCCCAACTCCCCCCAAGG - Intronic
1033253176 7:139777774-139777796 CCCTCCCCCGGCGCCGGCCACGG - Intronic
1035556976 8:574627-574649 CCCTGCCTCTGCACCACCCATGG - Intergenic
1035590763 8:811570-811592 CCCTGCCAGGGCTCCTGCCATGG + Intergenic
1036781504 8:11651096-11651118 TCCTGCCACTGCGTCCCCCAGGG + Intergenic
1037763148 8:21755631-21755653 CCCTCCCCCGGCCCCCACCAAGG - Intronic
1037855123 8:22366491-22366513 CCCTTCCTCCGAGCCCCCCAAGG + Intergenic
1042591417 8:70402582-70402604 CCCTCCCCCAGCACCCCCCAGGG + Intronic
1043502823 8:80873888-80873910 CCCGGCCCCGGCGCCCGCCCCGG - Intronic
1044229506 8:89758004-89758026 CCCTGCTGCGGCGGCTCCCAAGG - Exonic
1047225868 8:122955068-122955090 CCCTGCCACCCCCCCCCCCCCGG - Intronic
1049465981 8:142751511-142751533 CCCAGCCACGCCCCCACCCAAGG - Intronic
1049585953 8:143432469-143432491 CCCTCCCACGGCCCCTCCAAGGG + Intergenic
1049885139 9:21703-21725 CCCTGCCAGGGAGCCTCCCGTGG + Intergenic
1052568565 9:30190275-30190297 CCCTGCCTCTGCACTCCCCAAGG + Intergenic
1055760852 9:79605920-79605942 CCCTTCCACTGCTTCCCCCAGGG - Intronic
1057139583 9:92718440-92718462 CCCTGCCACGGGGCCCCCCCAGG - Intronic
1057623247 9:96655174-96655196 CTCGGCCACGGCGGCCGCCAGGG + Exonic
1061280794 9:129596938-129596960 CCCTGCCTCAGCGTCCCCCAAGG - Intergenic
1061304951 9:129726777-129726799 CGGCCCCACGGCGCCCCCCAGGG - Intergenic
1061970419 9:134041870-134041892 GCCTGCCCCCGCGGCCCCCATGG - Exonic
1062188297 9:135230247-135230269 CCCTGCCACGCAGCCACCAAGGG + Intergenic
1188003903 X:25004817-25004839 CGATGCCACTGCGCCCTCCACGG + Exonic
1193891319 X:87049718-87049740 CCCTGCCATCCAGCCCCCCATGG - Intergenic
1196523781 X:116707420-116707442 CCCTGCCCCGCCGCCCCCATAGG + Intergenic
1198518353 X:137429437-137429459 CCCTGCCGCAGCGCCCCCTACGG + Intergenic
1200233605 X:154458178-154458200 CCCTGCCGCCGCGTCCCCCTCGG + Intergenic
1200807931 Y:7451590-7451612 TCCTCCCACTGAGCCCCCCAAGG - Intergenic