ID: 915354998

View in Genome Browser
Species Human (GRCh38)
Location 1:155250607-155250629
Sequence TCGAGGAAAGCCCCCTGCCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915354998_915355010 19 Left 915354998 1:155250607-155250629 CCGTGGCAGGGGGCTTTCCTCGA 0: 1
1: 0
2: 0
3: 6
4: 116
Right 915355010 1:155250649-155250671 GTCCAGGCTGAGGCAGTAGCCGG 0: 1
1: 0
2: 4
3: 51
4: 438
915354998_915355008 9 Left 915354998 1:155250607-155250629 CCGTGGCAGGGGGCTTTCCTCGA 0: 1
1: 0
2: 0
3: 6
4: 116
Right 915355008 1:155250639-155250661 GCAGGCCACAGTCCAGGCTGAGG 0: 1
1: 0
2: 7
3: 45
4: 440
915354998_915355004 3 Left 915354998 1:155250607-155250629 CCGTGGCAGGGGGCTTTCCTCGA 0: 1
1: 0
2: 0
3: 6
4: 116
Right 915355004 1:155250633-155250655 GGCCCCGCAGGCCACAGTCCAGG 0: 1
1: 1
2: 3
3: 24
4: 247
915354998_915355012 24 Left 915354998 1:155250607-155250629 CCGTGGCAGGGGGCTTTCCTCGA 0: 1
1: 0
2: 0
3: 6
4: 116
Right 915355012 1:155250654-155250676 GGCTGAGGCAGTAGCCGGCACGG 0: 1
1: 0
2: 0
3: 25
4: 241
915354998_915355002 -9 Left 915354998 1:155250607-155250629 CCGTGGCAGGGGGCTTTCCTCGA 0: 1
1: 0
2: 0
3: 6
4: 116
Right 915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915354998 Original CRISPR TCGAGGAAAGCCCCCTGCCA CGG (reversed) Exonic
900115731 1:1027062-1027084 CTGAGGAAGGCCCCCTGCCAGGG + Intronic
900124811 1:1064664-1064686 TCAGGGAAGACCCCCTGCCAGGG + Intergenic
901927339 1:12574690-12574712 TCTTGGTAAGACCCCTGCCAGGG + Intronic
904277130 1:29391950-29391972 TCAAGGAAAGGCCCTTGCCTTGG - Intergenic
906038179 1:42766329-42766351 GCGAGGAAGGTCTCCTGCCAGGG + Intronic
906290109 1:44614293-44614315 TCGAGGTAAGCCACCTCCCAGGG + Exonic
912800561 1:112717318-112717340 TCCAGAACAGCCCCCAGCCATGG + Intergenic
915354998 1:155250607-155250629 TCGAGGAAAGCCCCCTGCCACGG - Exonic
917781179 1:178399213-178399235 TTGTGCAAAGGCCCCTGCCAGGG - Intronic
922746597 1:228047865-228047887 TCGAGGACAGCACCAAGCCATGG + Intronic
1067427247 10:46219648-46219670 CAGAGGAAGGCCCCCTGCCCTGG - Intergenic
1067582678 10:47455532-47455554 CAGAGGAAGGCCCCCTGCCCTGG - Intergenic
1069825002 10:71249613-71249635 TCCAGGAGAGTCCCCTGGCATGG + Intronic
1071113152 10:82186366-82186388 CCTAGGAAAGCCCCTTCCCATGG + Intronic
1076518994 10:131068094-131068116 TCCAGGAAAATCCCTTGCCAGGG + Intergenic
1078417809 11:11180239-11180261 TCCAGGGAAGCCAACTGCCATGG - Intergenic
1078533989 11:12158911-12158933 ACGAGGAAAGCTACCCGCCATGG + Intronic
1080994150 11:37580002-37580024 TCGAGGATTTGCCCCTGCCAAGG - Intergenic
1084421697 11:69063673-69063695 TCAAAGAAAGGACCCTGCCAGGG + Intronic
1085260118 11:75199805-75199827 GCGAGGAAAACCTCCAGCCAAGG - Intronic
1088067037 11:105732155-105732177 TGGGGGAAGGCTCCCTGCCAAGG + Intronic
1090248772 11:125236599-125236621 CCCAGGAAAGCTCCCTGGCAGGG + Intronic
1094076451 12:26480928-26480950 TCCAGGAAAGGACCTTGCCATGG + Intronic
1095941979 12:47733318-47733340 TCCAGGAAGGCCCCCAGGCATGG + Intergenic
1096801317 12:54112509-54112531 CAGAGGAGAGCCCACTGCCAAGG - Intergenic
1097134613 12:56841272-56841294 TGAAGGAGAGACCCCTGCCATGG - Intergenic
1097632306 12:62079160-62079182 TAGAGGAAAGCATCCTGCAAGGG - Intronic
1102009839 12:109611558-109611580 TCCCGGGAAGCCCCCTCCCACGG + Intergenic
1105539922 13:21307454-21307476 TCGGGGAAAGGCCCCTGGGAAGG + Intergenic
1105580564 13:21691850-21691872 TCGGGGGAAGCCCTCTGCAACGG - Intronic
1105798403 13:23880596-23880618 TCGGGGAAAGGCCCCTGGGAAGG - Intronic
1110296649 13:73874673-73874695 TCAAGGTAAGCCATCTGCCAAGG - Intronic
1113597326 13:111542853-111542875 TGCAGGGAAGCCCCCTGCCCTGG + Intergenic
1122214211 14:100192773-100192795 ACGAGGAGAGCCCACTGCCCCGG + Intergenic
1122609155 14:102969490-102969512 TCCAGCCAAGCCCGCTGCCAGGG + Intronic
1122691974 14:103535804-103535826 GCGAGGAGAGCCCCCAGCCTGGG - Exonic
1123038257 14:105480035-105480057 CGGAGGGAAGCCCTCTGCCAGGG - Intronic
1123107916 14:105851557-105851579 TCGAGGAAAGCCACGTGCCCAGG - Intergenic
1124168639 15:27352632-27352654 GCCAAGGAAGCCCCCTGCCAAGG + Intronic
1125578853 15:40772038-40772060 TCGAGGAAGGAAACCTGCCAGGG - Exonic
1127912333 15:63427817-63427839 TCCAGGACAGCCCACAGCCAGGG + Intergenic
1128557135 15:68639500-68639522 AAGAGGAAGGCCCCCAGCCAGGG + Intronic
1128879008 15:71225997-71226019 TCTTGGACAGCCCCCTTCCATGG + Intronic
1129614626 15:77088600-77088622 TCGAGGACAGCACCAAGCCATGG - Intergenic
1132722489 16:1323649-1323671 CCGAGAAAAGGCACCTGCCAGGG - Intronic
1133585929 16:7195428-7195450 TAGAGGACAGCCACCTGCCCAGG - Intronic
1137388222 16:48059656-48059678 TGGTGGAAAGCCGCCTGCCTTGG - Intergenic
1138036868 16:53616324-53616346 TCAAGGAGATCCCCCTGCAATGG + Intronic
1139345603 16:66301103-66301125 TGTAGGAAAGACCCCTTCCAGGG - Intergenic
1141997795 16:87646154-87646176 TCCAGGAAAGCTCCCAGCCTGGG + Intronic
1142291209 16:89194389-89194411 TCAGAGAAAGCCCCCAGCCAAGG + Intronic
1145302193 17:21648501-21648523 TTGAGGAGCTCCCCCTGCCAAGG - Intergenic
1145348122 17:22054815-22054837 TTGAGGAGCTCCCCCTGCCAAGG + Intergenic
1147769337 17:42856811-42856833 TCTAGGGAAGCCCTCGGCCACGG - Exonic
1151718998 17:75845116-75845138 TCTAGGAAAGCCCCATGCTGAGG - Intergenic
1152516567 17:80828321-80828343 GCAAGGAATGCCACCTGCCACGG - Intronic
1152567090 17:81105127-81105149 GTGGGGAAAGACCCCTGCCATGG - Intronic
1152627019 17:81392548-81392570 TTGAGAAATGCCCACTGCCAGGG - Intergenic
1157319114 18:46620675-46620697 TGGTGGAGAGCCACCTGCCAGGG + Intronic
1157633124 18:49120456-49120478 TCCAGGACATCCCCCTGCCTCGG + Intronic
1158833081 18:61302123-61302145 TAGTGGACACCCCCCTGCCAGGG + Intergenic
1160706882 19:534012-534034 AAAAGGAAAGCGCCCTGCCAAGG - Intronic
1160845444 19:1164145-1164167 TCGAGGGAAGCCCCTGCCCATGG + Intronic
1162829847 19:13277606-13277628 TCAAGGCCAGGCCCCTGCCAGGG + Intronic
1163221874 19:15927543-15927565 TGGAGGAATGCTCCCAGCCAGGG + Intronic
928262592 2:29781272-29781294 TTGAGGGAATCGCCCTGCCAAGG - Intronic
935229539 2:101083809-101083831 TTGAGCAAAGGCCCCTGCCCAGG - Intronic
937853995 2:126659704-126659726 CCCAGGAAAGCCCCTTACCAGGG - Intronic
946313676 2:218896530-218896552 ACGTGGAAGGCCCCCTGCCAGGG - Intronic
1169167395 20:3435948-3435970 TTGAGGAAAAGCCCTTGCCAAGG + Intergenic
1169264875 20:4161656-4161678 TCAGGGAAGGCCTCCTGCCAAGG - Intronic
1170547350 20:17445711-17445733 ACGATGAATGCCTCCTGCCAAGG + Intronic
1171518777 20:25759928-25759950 TTGAGGAGCTCCCCCTGCCAAGG - Intergenic
1171558079 20:26096282-26096304 TTGAGGAGCTCCCCCTGCCAAGG + Intergenic
1171795368 20:29561957-29561979 CAGAGGAGAGCCCACTGCCAAGG + Intergenic
1171853084 20:30322308-30322330 CAGAGGAGAGCCCACTGCCAAGG - Intergenic
1174862443 20:54103628-54103650 TCTAGGAAAGCCACATGGCAAGG - Intergenic
1175064211 20:56271777-56271799 CCATGGAAAGCCCCCTGCTATGG + Intergenic
1175825344 20:61933799-61933821 TCGGGGAGAGCCCCAGGCCATGG + Intronic
1177117616 21:17105017-17105039 TCAAGGAAGGGTCCCTGCCAAGG + Intergenic
1179574416 21:42298819-42298841 TGGAGGAAAGCCTACCGCCAAGG + Intergenic
1180781302 22:18521390-18521412 TCGAGGAAAGCGCCATGTGAAGG - Intergenic
1181078318 22:20395916-20395938 TCCATGAAGGCCCCATGCCAGGG - Intronic
1181238187 22:21460732-21460754 TCGAGGAAAGCGCCATGTGAAGG - Intergenic
1181805679 22:25373276-25373298 CCAGGGAAAGACCCCTGCCAGGG + Intronic
1183740749 22:39667213-39667235 CAGAGGAAGACCCCCTGCCAAGG - Intronic
949368135 3:3305366-3305388 GCTAGGAAAGCCCCTGGCCATGG - Intergenic
961493550 3:127274323-127274345 TCTTGGAAGGCCCCCTGCCCTGG + Intergenic
964646950 3:158968839-158968861 TCCAGGAAATCCCTCTGCTAGGG - Intronic
964767037 3:160189333-160189355 TCTAGGAAAACACCCTGCCATGG - Intergenic
970463023 4:16294716-16294738 TCCAAGAATGCCCCCTCCCATGG + Intergenic
979878830 4:125928749-125928771 CAGAGGGAAGCCCACTGCCAGGG + Intergenic
979981172 4:127257101-127257123 TAGGGGAAAGCCCACTGCTATGG - Intergenic
982134377 4:152259368-152259390 ATAAGGAAATCCCCCTGCCATGG + Intergenic
987418816 5:17693879-17693901 TGGAGGAAAGCCATTTGCCAAGG - Intergenic
989994850 5:50817531-50817553 TCCAGGCAAGTCCCCTGCAATGG - Intronic
996212440 5:120828043-120828065 TTGAGAAACGCACCCTGCCAGGG + Intergenic
1003568434 6:7239942-7239964 TCAGGGACAGCCCCCAGCCAGGG - Intronic
1006349779 6:33512620-33512642 CAGAGGAAAGCCCTCTCCCAGGG + Intergenic
1011106472 6:83787197-83787219 CCTAGGAAAGCCCATTGCCAAGG + Intergenic
1013130160 6:107225047-107225069 TCTAGGGAAGCCAGCTGCCATGG - Intronic
1017975276 6:159351558-159351580 TCAAGAAAAGCCCTATGCCAAGG - Intergenic
1025279267 7:57615058-57615080 TTGAGGAGCTCCCCCTGCCAGGG - Intergenic
1025305464 7:57850442-57850464 TTGAGGAGCTCCCCCTGCCAGGG + Intergenic
1025927946 7:65974230-65974252 CCGAGGCCAGCCACCTGCCAGGG + Intronic
1032466974 7:132152198-132152220 TAGAGGGAAGCCACCTGCGATGG - Intronic
1032918864 7:136523393-136523415 TGGAGGAAAGGCACCTGGCATGG + Intergenic
1032927008 7:136618617-136618639 TCTAGGAAAACCCCCTGCAGTGG + Intergenic
1041794242 8:61729421-61729443 TCGAGGCAAGCACCCTTCAAAGG + Intergenic
1050065994 9:1760069-1760091 TCCAGGAGAGCCCCCAGGCAAGG + Intergenic
1053790882 9:41685607-41685629 CAGAGGAGAGCCCACTGCCAAGG - Intergenic
1054179229 9:61897301-61897323 CAGAGGAGAGCCCACTGCCAAGG - Intergenic
1054474057 9:65560285-65560307 CAGAGGAGAGCCCACTGCCAAGG + Intergenic
1054658309 9:67683520-67683542 CAGAGGAGAGCCCACTGCCAAGG + Intergenic
1057122496 9:92588784-92588806 TCCAGGAAAGCACCCAGCCAAGG - Intronic
1057775494 9:98005271-98005293 TCAAGCAATGCCCCCTGCCTCGG - Intronic
1061583079 9:131549384-131549406 CCGAGGAATGCCCCCAGCCCGGG + Intergenic
1061662276 9:132138149-132138171 TCAAGGGATGCCCCCTGCCTTGG + Intergenic
1061950187 9:133931765-133931787 TCAGGGAAAGCCACCTGCCCAGG + Intronic
1186459367 X:9735901-9735923 TCAAGGAAAACCCCTTACCAGGG - Intronic
1189537698 X:41953696-41953718 TCGAGGTAAGATCCCAGCCATGG - Intergenic
1192147441 X:68691080-68691102 ATGAGGAAAGCCCCATGCCTCGG + Intronic
1199666753 X:150102280-150102302 ACGAGGAAGGCCACCTGCCTAGG - Intergenic