ID: 915355002

View in Genome Browser
Species Human (GRCh38)
Location 1:155250621-155250643
Sequence TTTCCTCGAAGGGGCCCCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915354992_915355002 4 Left 915354992 1:155250594-155250616 CCCGTGGGGGGCGCCGTGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 233
Right 915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 66
915354998_915355002 -9 Left 915354998 1:155250607-155250629 CCGTGGCAGGGGGCTTTCCTCGA 0: 1
1: 0
2: 0
3: 6
4: 116
Right 915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 66
915354994_915355002 3 Left 915354994 1:155250595-155250617 CCGTGGGGGGCGCCGTGGCAGGG 0: 1
1: 0
2: 2
3: 20
4: 187
Right 915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915355002 Original CRISPR TTTCCTCGAAGGGGCCCCGC AGG Exonic