ID: 915355002

View in Genome Browser
Species Human (GRCh38)
Location 1:155250621-155250643
Sequence TTTCCTCGAAGGGGCCCCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915354998_915355002 -9 Left 915354998 1:155250607-155250629 CCGTGGCAGGGGGCTTTCCTCGA 0: 1
1: 0
2: 0
3: 6
4: 116
Right 915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 66
915354992_915355002 4 Left 915354992 1:155250594-155250616 CCCGTGGGGGGCGCCGTGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 233
Right 915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 66
915354994_915355002 3 Left 915354994 1:155250595-155250617 CCGTGGGGGGCGCCGTGGCAGGG 0: 1
1: 0
2: 2
3: 20
4: 187
Right 915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915355002 Original CRISPR TTTCCTCGAAGGGGCCCCGC AGG Exonic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
902585952 1:17438700-17438722 ATTCCCCGAAGGAGCCGCGCCGG - Intronic
902839120 1:19064333-19064355 TTTCCTAGAAAGGGCCAAGCAGG + Intergenic
903594433 1:24483274-24483296 TGTCCTGGAAAGGCCCCCGCTGG - Intergenic
907237326 1:53061661-53061683 TTTCCGGGAAGAGGCCCAGCAGG + Intergenic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
923959371 1:239059327-239059349 CTTCCTCGAAGGTGTCCAGCAGG + Intergenic
1063958468 10:11286249-11286271 TGTCCTGGAGGGGGACCCGCTGG + Intronic
1067425214 10:46204675-46204697 TTTCCTAGCGGGGGCCCTGCGGG - Intergenic
1067943293 10:50674709-50674731 TTTCCTAGCGGGGGCCCTGCGGG - Intergenic
1070864631 10:79700489-79700511 TTTCCTAGTGGGGGCCCTGCGGG - Intergenic
1070878421 10:79838619-79838641 TTTCCTAGTGGGGGCCCTGCGGG - Intergenic
1071631534 10:87222718-87222740 TTTCCTAGTGGGGGCCCTGCGGG - Intergenic
1071644976 10:87354930-87354952 TTTCCTAGTGGGGGCCCTGCGGG - Intergenic
1073101567 10:101009249-101009271 TTTCCTCAGTGGGGCCCTGCAGG - Intronic
1092884334 12:12912270-12912292 TTTCCTCTAAGCGGCCTCACGGG + Intronic
1094007887 12:25774732-25774754 TTCCCTGGAAGGGGCTCCTCAGG - Intergenic
1094338962 12:29389521-29389543 TCTCCCCGACGGGACCCCGCCGG + Intergenic
1103239959 12:119404787-119404809 TTGTCTCTAAGGGGCCCTGCTGG - Intronic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1115308662 14:31957544-31957566 TTTCCGCCAAGGGGCACCGAAGG - Intergenic
1125448386 15:39782631-39782653 GTTCCTCGAGGAGGCCCGGCGGG - Exonic
1128322452 15:66703095-66703117 TGTCGTCGAAGGGGCGCCGCAGG - Exonic
1130093518 15:80840032-80840054 CCTCCTCTAAGGGGCCCCCCAGG + Intronic
1130935255 15:88464732-88464754 GTTCCTCGAAGGGTCTCCCCAGG + Exonic
1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG + Intronic
1140639965 16:76960189-76960211 CTTCCACGAAGAGGCCCTGCAGG - Intergenic
1145790046 17:27620891-27620913 TTTCCTCGAAGGGGCTGGGCAGG - Intronic
1148440480 17:47709245-47709267 TGCCCTCGAAGGCGCGCCGCGGG - Exonic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1152526364 17:80890321-80890343 TTCCCTGGAAGGGGCCCAGTGGG + Intronic
1152883328 17:82832979-82833001 TTTCCTCGAAAGCGCCCTGCCGG + Intronic
1155493776 18:26423598-26423620 TTTCCACCAAGTGGCCCCGGAGG + Intergenic
1160791020 19:923815-923837 TTCCCCCAAAGGGGCCGCGCAGG - Intergenic
1160846781 19:1169493-1169515 TCTACTCGAAGGGGCCCTACGGG - Intronic
1162561827 19:11421751-11421773 TTTCCTCCACGAGGCCCAGCAGG + Exonic
1164753500 19:30672869-30672891 GTTCCTCGGAGGGTCCCAGCAGG - Intronic
1164881693 19:31738345-31738367 TTACCTCGAATGGTCCCAGCTGG + Intergenic
1167479353 19:49720015-49720037 ATTTCTCGAAGGGTCTCCGCGGG + Intergenic
1168112463 19:54201229-54201251 ATTTCTCGAAGGGTCTCCGCGGG - Exonic
934714818 2:96537346-96537368 TTTCCTGAAAGGGGCTGCGCGGG + Intronic
942088561 2:172465539-172465561 GTTGCTCGTGGGGGCCCCGCGGG + Exonic
945119676 2:206444115-206444137 TTTCCTCTGCAGGGCCCCGCGGG - Intronic
948560594 2:238848815-238848837 TCTCCTCGGCGAGGCCCCGCGGG + Intronic
948789845 2:240371578-240371600 TCCCCTGGAAGGGGCCCTGCAGG + Intergenic
1169334105 20:4740878-4740900 TTTCCTTGCGGGGGGCCCGCTGG + Intergenic
1174204185 20:48827521-48827543 TTGCCTCGGGGGCGCCCCGCAGG - Intronic
1174387554 20:50196350-50196372 CTTCCTAGGAGGGGCCTCGCAGG - Intergenic
1182091285 22:27596650-27596672 TTTCCACGAAGCGGCCTCCCAGG + Intergenic
1185294084 22:50044890-50044912 TCTCCCCAAAGGGGCCCCGTGGG - Intronic
962271434 3:133980542-133980564 TCTCCTGGAAGGCGCCCCTCTGG + Intronic
968434153 4:576323-576345 CCTCCTGGGAGGGGCCCCGCGGG - Intergenic
985795956 5:1962263-1962285 TTTCCTAGAAGGCGCCCACCTGG + Intergenic
990626083 5:57612987-57613009 TTTTCTCCAGGGGACCCCGCTGG + Intergenic
997303840 5:132824667-132824689 GTTCCTAGAAGAGGCCCCACTGG - Exonic
997418011 5:133744007-133744029 TTTCCTAGATGGGCCTCCGCTGG - Intergenic
1000324262 5:160160193-160160215 TTTGCTCGCAGGGCTCCCGCAGG - Intergenic
1004193268 6:13483330-13483352 TTTCCTTGAATGGGCCCTGTTGG - Intronic
1013283026 6:108656479-108656501 TTTCCTGGAAGGGGCCGCCCTGG + Intronic
1018891738 6:167987719-167987741 TCACCCCGAAGGGCCCCCGCCGG + Intergenic
1020279673 7:6643890-6643912 CTTCCTGGTAGAGGCCCCGCTGG - Exonic
1021510524 7:21428088-21428110 TTTCCGCGAATGGCCGCCGCTGG - Exonic
1022158142 7:27680840-27680862 TTTCCTTGAAAGGGCCCCAGTGG - Intergenic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1029626962 7:101725922-101725944 TTCCCTCGGAGGGGCCCCTTGGG - Intergenic
1029640636 7:101817038-101817060 TTTCCCCAAAGAGCCCCCGCGGG - Intronic
1043909344 8:85842724-85842746 TTGCCTGGAAGTGGCCCTGCAGG + Intergenic
1056634203 9:88318201-88318223 ATTCCTCAAAGCGGCCCTGCAGG - Intergenic
1062010269 9:134263377-134263399 TTTCCTCCGAGGGTCCCCTCTGG + Intergenic
1185544825 X:935153-935175 TTTGCTCTTAGGGGCCCCGGAGG - Intergenic
1192818053 X:74614698-74614720 ATTCCTCGAAAAGGCTCCGCGGG + Intergenic