ID: 915361385

View in Genome Browser
Species Human (GRCh38)
Location 1:155288184-155288206
Sequence GGGAGCGCCCTGCCCGGGAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 129}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915361385_915361404 21 Left 915361385 1:155288184-155288206 CCTATCCCGGGCAGGGCGCTCCC 0: 1
1: 0
2: 1
3: 8
4: 129
Right 915361404 1:155288228-155288250 CTCCAGGAGGAGGTGGACGGCGG 0: 1
1: 0
2: 1
3: 45
4: 396
915361385_915361396 8 Left 915361385 1:155288184-155288206 CCTATCCCGGGCAGGGCGCTCCC 0: 1
1: 0
2: 1
3: 8
4: 129
Right 915361396 1:155288215-155288237 CTGCTGGGTCCCCCTCCAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 268
915361385_915361406 26 Left 915361385 1:155288184-155288206 CCTATCCCGGGCAGGGCGCTCCC 0: 1
1: 0
2: 1
3: 8
4: 129
Right 915361406 1:155288233-155288255 GGAGGAGGTGGACGGCGGCTAGG 0: 1
1: 0
2: 4
3: 44
4: 410
915361385_915361398 14 Left 915361385 1:155288184-155288206 CCTATCCCGGGCAGGGCGCTCCC 0: 1
1: 0
2: 1
3: 8
4: 129
Right 915361398 1:155288221-155288243 GGTCCCCCTCCAGGAGGAGGTGG 0: 1
1: 0
2: 4
3: 69
4: 348
915361385_915361397 11 Left 915361385 1:155288184-155288206 CCTATCCCGGGCAGGGCGCTCCC 0: 1
1: 0
2: 1
3: 8
4: 129
Right 915361397 1:155288218-155288240 CTGGGTCCCCCTCCAGGAGGAGG 0: 1
1: 0
2: 5
3: 43
4: 442
915361385_915361390 -7 Left 915361385 1:155288184-155288206 CCTATCCCGGGCAGGGCGCTCCC 0: 1
1: 0
2: 1
3: 8
4: 129
Right 915361390 1:155288200-155288222 CGCTCCCAGGTCTCCCTGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 235
915361385_915361401 18 Left 915361385 1:155288184-155288206 CCTATCCCGGGCAGGGCGCTCCC 0: 1
1: 0
2: 1
3: 8
4: 129
Right 915361401 1:155288225-155288247 CCCCTCCAGGAGGAGGTGGACGG 0: 1
1: 0
2: 3
3: 45
4: 442
915361385_915361393 5 Left 915361385 1:155288184-155288206 CCTATCCCGGGCAGGGCGCTCCC 0: 1
1: 0
2: 1
3: 8
4: 129
Right 915361393 1:155288212-155288234 TCCCTGCTGGGTCCCCCTCCAGG 0: 1
1: 2
2: 3
3: 59
4: 1924
915361385_915361389 -8 Left 915361385 1:155288184-155288206 CCTATCCCGGGCAGGGCGCTCCC 0: 1
1: 0
2: 1
3: 8
4: 129
Right 915361389 1:155288199-155288221 GCGCTCCCAGGTCTCCCTGCTGG 0: 1
1: 0
2: 0
3: 21
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915361385 Original CRISPR GGGAGCGCCCTGCCCGGGAT AGG (reversed) Exonic