ID: 915363524

View in Genome Browser
Species Human (GRCh38)
Location 1:155300675-155300697
Sequence CTGCATAGGGTGAGGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915363524_915363531 8 Left 915363524 1:155300675-155300697 CCCAGCAGCCTCACCCTATGCAG 0: 1
1: 0
2: 3
3: 17
4: 162
Right 915363531 1:155300706-155300728 TCACCCAGTTCCTGCTCCAAAGG 0: 1
1: 1
2: 1
3: 12
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915363524 Original CRISPR CTGCATAGGGTGAGGCTGCT GGG (reversed) Intronic
901022866 1:6263883-6263905 ATGAACAGGGTGGGGCTGCTGGG - Intergenic
901726527 1:11247226-11247248 CTGCAAGTGGTGAGGCAGCTTGG + Intronic
902528496 1:17075201-17075223 CTGCAAATTGTGTGGCTGCTTGG - Intronic
902942061 1:19807698-19807720 CTGATTAGGGAGAGGCTTCTGGG - Intergenic
903811336 1:26036530-26036552 CTCCAGAGGGTGAGGGTGGTGGG + Intergenic
907046881 1:51305002-51305024 CTGCACAGGGTGGGGCTGACAGG - Intronic
907527250 1:55061040-55061062 CTGCATAGGGAGGGGCTGGGGGG + Intronic
914684543 1:149966857-149966879 TATCATAGGGTGAGGCAGCTGGG - Intronic
915363524 1:155300675-155300697 CTGCATAGGGTGAGGCTGCTGGG - Intronic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920735672 1:208531146-208531168 CTGAATAGGAGGTGGCTGCTTGG + Intergenic
922057297 1:222053288-222053310 ATGCATGGGGTAGGGCTGCTGGG - Intergenic
922213441 1:223502301-223502323 CTGCATTAGGTCAGGCTCCTGGG + Intergenic
922770070 1:228176871-228176893 CTGCAGCGGGTGAGGCTGGACGG - Exonic
922790688 1:228309287-228309309 CTGCACAAGGTGAGGCCTCTGGG + Exonic
922798576 1:228353530-228353552 CTGCAGAGGGCCAGGCCGCTGGG + Intronic
1067156046 10:43782205-43782227 CTGCATGGGGCCAGGCTTCTGGG + Intergenic
1068716643 10:60196153-60196175 CTGCGTGAGGTGAGGCTCCTTGG + Exonic
1069956396 10:72054464-72054486 ATGCATAGGGTGAGGTGGGTGGG - Intergenic
1071495037 10:86162340-86162362 CTGCATGGGGTGAGGGTCCCTGG - Intronic
1073466580 10:103697799-103697821 CTGCACAGGGAGAGGCTGGTGGG + Intronic
1074769882 10:116726432-116726454 CTGTCTCGGGGGAGGCTGCTGGG - Intronic
1075904931 10:126072826-126072848 CTCCATTGGGAGAGGGTGCTTGG - Intronic
1076888118 10:133271792-133271814 CAGCATTGGGTGAGGCGGCCAGG - Exonic
1077330242 11:1980975-1980997 CTCCATTGGGTAGGGCTGCTGGG + Intronic
1079131374 11:17748793-17748815 CTGCACAGGGTGGGCCTGCGTGG + Intronic
1079725180 11:23871719-23871741 CAGCACAGGGTAAGGCTGCTAGG - Intergenic
1084096849 11:66917043-66917065 CTGCATGGGGTGAGGGCTCTTGG - Intronic
1084327799 11:68411757-68411779 CAGCAGAGGGTGAGGCTGCTGGG - Intronic
1084510594 11:69601182-69601204 CTGCAGAGGATGTGGCTGCCTGG - Intergenic
1090017810 11:123101567-123101589 CTGCTTGGGCTGAGACTGCTGGG + Intronic
1090797340 11:130146435-130146457 CTGCCTAGGGTGAGGCCGCCTGG - Intergenic
1091275109 11:134344714-134344736 CTGCATGGGGTCCGGCCGCTGGG + Intronic
1202813221 11_KI270721v1_random:36154-36176 CTCCATTGGGTAGGGCTGCTGGG + Intergenic
1093131781 12:15400358-15400380 GTGCAGCAGGTGAGGCTGCTGGG - Intronic
1095941258 12:47728624-47728646 GGGAAGAGGGTGAGGCTGCTTGG + Intergenic
1097758017 12:63427858-63427880 CTGCAGTGGGAGAGGCTGCCAGG + Intergenic
1102036226 12:109771920-109771942 CTGCAGAGGCTGGGCCTGCTGGG - Intergenic
1104287621 12:127439445-127439467 CTGCCTTGGGTGAGGCAGCTGGG - Intergenic
1107561711 13:41562693-41562715 CTACAGAGCCTGAGGCTGCTGGG - Intergenic
1107938959 13:45367587-45367609 CTGAACAGGGTGAGTCAGCTCGG - Intergenic
1115556184 14:34546615-34546637 CTGGAGAGGGTGAGGGGGCTGGG + Intergenic
1115557724 14:34556466-34556488 CTGGAGAGGGTGAGGGGGCTGGG - Intergenic
1120643046 14:87038508-87038530 CTGCAAATGGTGAGGCTTCTTGG + Intergenic
1121053231 14:90832907-90832929 ATGCATAGGGTGAGGCACGTGGG - Intergenic
1122318241 14:100838055-100838077 TTGCACAGGGGCAGGCTGCTGGG + Intergenic
1122978066 14:105179099-105179121 CTGCATGGGGTGATGTTACTCGG - Intronic
1123720804 15:23060593-23060615 CTGCATCTGGTGAGTCTCCTGGG + Intergenic
1124364467 15:29062250-29062272 CTGCATACGGGGAGGCTGCACGG + Intronic
1124407427 15:29404777-29404799 CTGTATTGAGTTAGGCTGCTGGG - Intronic
1125203271 15:37121629-37121651 ATGCCTAGGGTCACGCTGCTTGG - Intergenic
1128261520 15:66236265-66236287 GAGGATGGGGTGAGGCTGCTGGG + Intronic
1128694882 15:69754014-69754036 CTGCAGTGGGTGAGGTAGCTGGG - Intergenic
1132562734 16:605449-605471 CTGCAGAGGGCGAGGCTGCGAGG - Intronic
1132594509 16:742284-742306 CTCCATGGGCTGAGCCTGCTTGG - Intronic
1132877342 16:2145973-2145995 ATGCATAGGCTGAGAGTGCTAGG - Intronic
1134002633 16:10794659-10794681 GTGCACAGGGTGAGGGCGCTTGG + Intronic
1136223641 16:28844647-28844669 CTGCAGAGGGTGGGGCTGGATGG - Intronic
1137264049 16:46854187-46854209 CTGCAAATGGTGAACCTGCTGGG - Intergenic
1141070416 16:80949209-80949231 CTGCATATGCTGAGGCTTCTGGG + Intergenic
1143370791 17:6437798-6437820 CTGTTTAGGGTGAGGGTGGTGGG - Intergenic
1143867634 17:9935561-9935583 CAGCATGTGGTGAGGCTTCTGGG + Intronic
1143904340 17:10197726-10197748 CTGCCTTGGGTCAGGCTGCCTGG - Intronic
1144362184 17:14506035-14506057 CTGCCTGGGCTGAGGTTGCTGGG + Intergenic
1144843870 17:18205743-18205765 CTGCCTTGGGCTAGGCTGCTTGG - Intronic
1145095126 17:20018745-20018767 CTGCACTGGGAGAGGATGCTTGG - Intronic
1145392390 17:22465666-22465688 GTGCACAGGGTGAGGCATCTGGG - Intergenic
1146127360 17:30239570-30239592 CTGGATGGGGTGGGCCTGCTAGG - Intergenic
1146177802 17:30677729-30677751 ATGCAAAGGGTGAGGGAGCTGGG - Intergenic
1146357029 17:32142804-32142826 CTGCAAAGGTTGGGGCTGCAGGG - Intronic
1149652386 17:58284081-58284103 GTGGACAGGGTGAGGCTGGTGGG + Intergenic
1150295267 17:64004011-64004033 CTGGCCAGGGGGAGGCTGCTGGG - Intronic
1151474200 17:74336399-74336421 CTGCATAGAGGGAAGCTGCTAGG - Intronic
1151667992 17:75556520-75556542 GGGCAGGGGGTGAGGCTGCTGGG + Intronic
1152314617 17:79572870-79572892 CTGCATGGGGTGAGGGTGGGTGG - Intergenic
1152563829 17:81091406-81091428 CAGCATAGGGTGCAGCTGCTGGG - Intronic
1152845694 17:82598431-82598453 CTGGTGAGGGTGAGGCTGTTGGG + Intronic
1153514184 18:5890288-5890310 CTGCACCGGCTGAGGTTGCTCGG + Exonic
1157705835 18:49805635-49805657 CTGCAGAGGTCGAGGCTGCAGGG - Intronic
1158451427 18:57569553-57569575 CTGTCTCCGGTGAGGCTGCTGGG - Intronic
1158464168 18:57674987-57675009 CTTCATCGGGAGAGGCTGCCTGG + Exonic
1160006577 18:75073083-75073105 CTGGATATGGGGAGGCTGGTGGG + Intergenic
1162980687 19:14237519-14237541 ATGCAAAGGGTGAGGGAGCTGGG + Intergenic
1163687322 19:18719228-18719250 CTGCATCGTGTGTGTCTGCTGGG + Intronic
1164011256 19:21205181-21205203 ATGGACAGGGTGAGGCAGCTAGG - Intergenic
1164414461 19:28034794-28034816 ATGCATAGGGTGAGGCAGTGGGG - Intergenic
1166970645 19:46565064-46565086 CTGCATAGGGAAAGGCTTGTGGG - Intronic
1168636098 19:57998757-57998779 CTGCATCTGGTGAGGAGGCTGGG + Intronic
925101199 2:1247462-1247484 CTCCACAGGGAGGGGCTGCTGGG + Intronic
925174227 2:1770977-1770999 CTGCTTAGGGGGAGGGTGCCAGG + Intergenic
925568687 2:5285658-5285680 CTGCCTAGGATGAGGTTTCTGGG - Intergenic
927930037 2:27038113-27038135 CGACAGAGGGAGAGGCTGCTGGG - Intronic
929720121 2:44359987-44360009 CTGCATAGTTTGAGCCTGATAGG - Exonic
931863364 2:66380941-66380963 ATGCATAGGATGAGTTTGCTGGG - Intergenic
934719352 2:96562514-96562536 CTGGAAAGGGTAAGGCTTCTGGG + Intergenic
940522045 2:154763350-154763372 CTGCACAGGCCTAGGCTGCTTGG + Intronic
943776503 2:191772445-191772467 AGACATAGGGTGAGGGTGCTTGG + Intergenic
945975045 2:216263910-216263932 GTGCAGAGAGTGAGGCTGCCAGG + Intronic
946117503 2:217476133-217476155 CTGCAAAGGGAGAGGCTTCCTGG - Intronic
1171171764 20:23021768-23021790 CTGCCATGGGTGAGGCTGCCTGG - Intergenic
1171345265 20:24461240-24461262 GTGCTCAGGGTGATGCTGCTGGG + Intergenic
1171460547 20:25295662-25295684 CTGTACCGGGTGAGGCTCCTGGG + Exonic
1172197594 20:33102656-33102678 CTGCAAAGTGGGTGGCTGCTAGG - Intronic
1172441933 20:34971941-34971963 CTGCAGCTGGTGGGGCTGCTTGG + Intergenic
1173619800 20:44428368-44428390 CTGCATCAGGTGAGGGTGCAGGG - Exonic
1173671276 20:44800720-44800742 CTGCAGAGTGAGAGGCTGGTGGG - Intronic
1175357260 20:58378264-58378286 CTGCAAAGGTTGGGGCTGCGGGG - Intergenic
1175830650 20:61963570-61963592 CTGCACAGGCTGAGGCTTCCAGG - Intronic
1178724344 21:35037640-35037662 CTGCTTGTGGTTAGGCTGCTGGG - Intronic
1179128177 21:38611114-38611136 CTGCATAGGGTTTGGATGCGTGG - Intronic
1179939416 21:44628326-44628348 GGGCAGAGGGTGACGCTGCTGGG - Intronic
1180219284 21:46347843-46347865 GTGCATGGGGTGTGGGTGCTGGG + Intronic
1181939752 22:26465973-26465995 CTTCATATTGTGAGACTGCTCGG - Intronic
1184777472 22:46630643-46630665 CTGCCAGGAGTGAGGCTGCTTGG - Intronic
1185400501 22:50613142-50613164 CTGCACAGGGGGCGGCTGCCAGG - Intronic
950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG + Exonic
950965039 3:17140155-17140177 CTGCAGAAGGTGAGGATGCTGGG + Intergenic
950967263 3:17154953-17154975 CTGCATAGGCTGTGCCAGCTGGG - Intergenic
954430119 3:50466177-50466199 CTGCATGGGGGCAGGCTGCCAGG - Intronic
957075350 3:75598492-75598514 CTGCAATGGGTGAGGATTCTGGG - Intergenic
961599143 3:128045651-128045673 CTGCAGAGGGTGGGGATGCTAGG + Intergenic
962319232 3:134377104-134377126 CTCCATGGGAGGAGGCTGCTAGG - Intergenic
964749232 3:160039232-160039254 CTGCCTAGGGGGAACCTGCTTGG + Intergenic
966913164 3:184570372-184570394 CTGCCTAAGGTGAAGTTGCTAGG - Intronic
969576388 4:8038475-8038497 CAGCTTAGGGTGAAGCTGCCAGG - Intronic
973724791 4:53764378-53764400 TTGGCCAGGGTGAGGCTGCTGGG + Intronic
974404787 4:61452071-61452093 TTGCATGGAGTGTGGCTGCTTGG + Intronic
975895063 4:79079182-79079204 ATGCATAGGGTGAGGCATGTGGG + Intergenic
976123552 4:81808678-81808700 CTGAATAGGTTTTGGCTGCTTGG - Intronic
977032910 4:91909631-91909653 CTCCAGAAGGTGAGTCTGCTTGG - Intergenic
978137018 4:105275084-105275106 CTGTAGAGGCTGGGGCTGCTGGG - Exonic
980000872 4:127486237-127486259 CTGCAGAGGGTGAGGGTGCTTGG + Intergenic
981591338 4:146366094-146366116 TTCCATGGGGTGAGGCTGGTGGG - Intronic
982104820 4:152002659-152002681 CTGATGAGGCTGAGGCTGCTGGG + Intergenic
986650406 5:9958195-9958217 ATGCATAGGGTGAGTGTTCTGGG + Intergenic
988853432 5:35201749-35201771 CTTAATAGGGTGAGGCTGCTTGG + Intronic
992350153 5:75920621-75920643 CTGCATAGGGAGTGGGTGGTGGG + Intergenic
997045094 5:130306419-130306441 CTGGATAGGGTGAGGGTGTTGGG + Intergenic
1000406102 5:160889816-160889838 CAGCATAAGATGAGGCTGCCAGG - Intergenic
1000810162 5:165851598-165851620 GTGCATGGGGTGAGGATCCTAGG - Intergenic
1001042897 5:168349488-168349510 AAGGAGAGGGTGAGGCTGCTTGG - Intronic
1001862187 5:175066985-175067007 ATGCATAGGGTCAGCTTGCTGGG - Intergenic
1002897670 6:1389123-1389145 CTGCTGCGGGTGCGGCTGCTCGG - Intergenic
1005397429 6:25397464-25397486 GTGCATAGGGTGGGGCAGATAGG + Intronic
1007116738 6:39348391-39348413 CTGCATGAGGTGGGGCAGCTGGG - Intronic
1007628083 6:43257789-43257811 CTGCAGGGGGTGAGGGTGATGGG - Intronic
1015156438 6:130101659-130101681 CTGCACAGGAGGAGGCTGCTGGG - Intronic
1015260088 6:131227350-131227372 CTGCAGAGTGGGAGGTTGCTAGG + Intronic
1017907887 6:158769312-158769334 CAGCACAGGGTGAGTCTGCACGG - Exonic
1019321789 7:419331-419353 CTGCCCTGGGTGAGGCTGCAGGG - Intergenic
1019779861 7:2932960-2932982 CAGAAGAGGGTGAGGCTGCCAGG + Intronic
1024563433 7:50663170-50663192 CTGCAGAGTGAGATGCTGCTGGG + Intronic
1024927008 7:54627775-54627797 CTGCATTGGGGGAGGCTGCATGG - Intergenic
1026824823 7:73574963-73574985 CTGGGTTGGGTGATGCTGCTGGG + Intronic
1028879771 7:95867080-95867102 ATGGATAGGATGTGGCTGCTTGG - Intronic
1029592957 7:101519468-101519490 CTGCAGAGGGAGAGGCTGCCGGG + Intronic
1030967583 7:116011924-116011946 CTGCTTTGGCTGAGGCTGCAGGG - Intronic
1032083378 7:128870873-128870895 CTGCCTGGGAGGAGGCTGCTGGG - Intronic
1034540150 7:151752971-151752993 CCGCATCGGGTGACCCTGCTGGG + Intronic
1036902779 8:12683981-12684003 CTGCAATGGGTGAGGATTCTGGG - Intergenic
1036905204 8:12702893-12702915 CTGCAATGGGTGAGGATTCTGGG - Intergenic
1037000132 8:13707450-13707472 CTGCTCAGGGAGAGGCAGCTGGG + Intergenic
1038010915 8:23475156-23475178 CTGCATGGGGAGAGGCTGCCTGG + Intergenic
1038296079 8:26291791-26291813 CTGCAAATGGTGACCCTGCTGGG - Intronic
1039472470 8:37821913-37821935 GGGCCGAGGGTGAGGCTGCTGGG + Intronic
1042131877 8:65595351-65595373 CAGCTTTGAGTGAGGCTGCTGGG - Intergenic
1043477148 8:80616061-80616083 CAGCATTGAGTGAGGCTTCTTGG + Intergenic
1048871672 8:138804180-138804202 ATGCATAGGCTGAGTCTGCCAGG - Intronic
1050273628 9:3973134-3973156 ATGCATAGGGCAAGTCTGCTAGG + Intronic
1052769133 9:32671508-32671530 CTGCAGATGGTGAGGGTGCCAGG - Intergenic
1053063048 9:35046156-35046178 CTCTATAGGGTGAGGCTACAGGG + Intergenic
1054704130 9:68445480-68445502 CTAGATAGTGTGAGGATGCTTGG + Intronic
1057772629 9:97982634-97982656 CTGAACAGGGTGGGGATGCTCGG + Intergenic
1061359071 9:130129598-130129620 CTGCATGGGGAGATGCTGTTTGG - Intronic
1061498573 9:130989712-130989734 CCCCACAGGGTGAGGCTGCCGGG + Intergenic
1062016061 9:134291984-134292006 CGGCCCAGGCTGAGGCTGCTGGG + Intergenic
1062533142 9:137010479-137010501 CTGCATGGGGTGGGGCTGTGGGG - Intronic
1062728849 9:138097142-138097164 CTGCATATAGTGTGGGTGCTTGG + Intronic
1190333499 X:49249583-49249605 GTGCCTGGGGTGGGGCTGCTGGG + Intronic
1196874964 X:120148432-120148454 ATGGACAGGGTGAGGCAGCTGGG + Intergenic
1201338304 Y:12904135-12904157 CTTGACAGGGTTAGGCTGCTGGG - Exonic
1202337633 Y:23827900-23827922 CAGCATAAGGTAAGCCTGCTGGG - Intergenic
1202533133 Y:25842171-25842193 CAGCATAAGGTAAGCCTGCTGGG + Intergenic