ID: 915366367

View in Genome Browser
Species Human (GRCh38)
Location 1:155319029-155319051
Sequence CTGTGTGACCTTGAGCAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 2, 1: 7, 2: 44, 3: 107, 4: 343}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915366365_915366367 -10 Left 915366365 1:155319016-155319038 CCCTGGTGAAAAACTGTGTGACC 0: 1
1: 0
2: 0
3: 15
4: 187
Right 915366367 1:155319029-155319051 CTGTGTGACCTTGAGCAAGTCGG 0: 2
1: 7
2: 44
3: 107
4: 343
915366364_915366367 -9 Left 915366364 1:155319015-155319037 CCCCTGGTGAAAAACTGTGTGAC 0: 1
1: 0
2: 2
3: 8
4: 183
Right 915366367 1:155319029-155319051 CTGTGTGACCTTGAGCAAGTCGG 0: 2
1: 7
2: 44
3: 107
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915366367 Original CRISPR CTGTGTGACCTTGAGCAAGT CGG Intronic
901029573 1:6299122-6299144 CTGGGTGACCTTGGGCAGGCAGG + Intronic
902395245 1:16128910-16128932 CTGTGTGACCTCAGGCAAGCCGG + Intronic
903283606 1:22263868-22263890 CTGGGCGAGCTGGAGCAAGTGGG + Intergenic
903420676 1:23216553-23216575 TAGTGTGACCTTGGGCAAGACGG + Intergenic
903570170 1:24298353-24298375 CTGTGTGGCCTTGAGCAAAGGGG + Intergenic
903882510 1:26521141-26521163 CTGTGTGACTTTGAGTATTTCGG - Intergenic
904366189 1:30012242-30012264 CACTGTGACCTTCAGCAAGATGG + Intergenic
904412545 1:30333128-30333150 TTGTGTGACCTGGGGCAAGTCGG + Intergenic
904437319 1:30507228-30507250 CAGTGTGACCCTGTGCAAGTGGG - Intergenic
904825290 1:33270306-33270328 CTGTGTGATTTGGGGCAAGTTGG + Intronic
904895646 1:33815633-33815655 CTTTGTGCCCTTGGGCAAGTTGG + Intronic
905122976 1:35695914-35695936 CAGTGTGACCTTGGGCCAGGTGG + Intergenic
905282593 1:36858786-36858808 CTGTATGACCTTGGGCGAGCTGG - Intronic
905954581 1:41981542-41981564 CTGTGTGACCTTCTGCAAACTGG + Intronic
906019600 1:42615692-42615714 CTGTGTGACTTTTAGCAACAAGG + Intronic
906059985 1:42942257-42942279 CTTTGTGACCTTGGGCCTGTCGG + Intronic
906308966 1:44739479-44739501 TTCAGTGACCTCGAGCAAGTTGG - Intergenic
906613930 1:47222335-47222357 CTGTGTGACCTTGATCAAGCTGG + Intronic
907248216 1:53121387-53121409 CTGTGTGACATCGAGACAGTTGG + Intronic
907268066 1:53274852-53274874 CTGTGAGACCTTGGACAAGAAGG + Intronic
907450633 1:54543516-54543538 CTTTTTGACCTTGAGCTAGCTGG - Intronic
907955033 1:59220186-59220208 TTGTGTGACTTTGAGCAAGTTGG - Intergenic
908437814 1:64123485-64123507 CTGTGTGATCTTGGGAAAGTTGG + Intronic
909461747 1:75923790-75923812 CTGTGTGATTTTGAGCAAGTTGG + Intronic
909486956 1:76185109-76185131 CCTGGTGGCCTTGAGCAAGTTGG - Intronic
909537457 1:76753730-76753752 TTGTGAGACCTTGGGCAAATGGG + Intergenic
909774902 1:79471594-79471616 CAGTGAGAACTTGGGCAAGTAGG + Intergenic
910434416 1:87190730-87190752 TTGTGTGACCTTAAGCAACAGGG + Intergenic
911886943 1:103313847-103313869 CTGTGTGTCTTTGGGTAAGTTGG - Intergenic
915366367 1:155319029-155319051 CTGTGTGACCTTGAGCAAGTCGG + Intronic
915918071 1:159953097-159953119 CGGAGTGACCTGGAGCAAGGAGG - Intronic
916391455 1:164335329-164335351 CTGTGTGACCTTGGGTAAGTGGG + Intergenic
916501649 1:165392748-165392770 CTGTGTCCCCTTTAGCTAGTGGG + Intergenic
917628567 1:176870964-176870986 CAGTGTGACCTTGGGCAGGTAGG - Intronic
917818951 1:178741312-178741334 TTGTATAACCTTGGGCAAGTTGG - Intronic
918094282 1:181321830-181321852 CCATGTGACCTTGTGCAAATCGG + Intergenic
919601223 1:199624848-199624870 CTCTGTGTCCTTGGGCAAATTGG + Intergenic
919858332 1:201720605-201720627 CTGTATGAGCTTGAGCAAACTGG + Intronic
920375686 1:205506619-205506641 CTGTGTGACCTTGGAAAAGTTGG - Intronic
921027249 1:211297375-211297397 TTCTGTCACCTTGAACAAGTTGG - Intronic
922570659 1:226633024-226633046 GTGTGTGACCTTTAGCAAGTCGG + Exonic
924330161 1:242933624-242933646 CAATGTGACCTTGAGCATGAAGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063292473 10:4763583-4763605 CTGTGGGACATTGAGGCAGTAGG + Intergenic
1064014573 10:11762452-11762474 CTGTGTGTCCTTGTGCACCTGGG + Intronic
1064901816 10:20303419-20303441 CTGTGTGATCCTGAGAAAGATGG + Intergenic
1067905370 10:50285299-50285321 CAGGGTGGCCTTGAGGAAGTGGG - Intergenic
1067976350 10:51029862-51029884 CTGTGTAACCTGGGGCAAGTAGG + Intronic
1068005161 10:51384596-51384618 CTGGGTGACAGGGAGCAAGTGGG - Intronic
1069685457 10:70315436-70315458 CTGTGTGACTTTCAGCAACAAGG - Intronic
1069739526 10:70678714-70678736 CTGCGTGACTCTGAGCAAGCTGG + Intronic
1069744457 10:70706304-70706326 CTGCGTGACCTAGGGCGAGTGGG + Intronic
1069814092 10:71182420-71182442 CTGTGTGGCCTTGGGCAAGTAGG + Intergenic
1069818975 10:71216121-71216143 CAGTGTGACCTTGGGCAAGTTGG - Intronic
1069834170 10:71298125-71298147 CTGTGAGACCTTGAGGACGAAGG - Intronic
1069853397 10:71425025-71425047 CCGTGTGACCCTGGGCAAGGTGG - Intronic
1069905032 10:71727209-71727231 CTGTGTGACCCTGAACAAGTCGG - Intronic
1070395965 10:76011470-76011492 GTGTGTGACCATGAGCGAGTGGG + Intronic
1070425194 10:76280327-76280349 TTTAGTGACCTTGAGCAAGCTGG + Intronic
1072294544 10:93996361-93996383 ATCTGTGGCATTGAGCAAGTAGG + Intronic
1072531600 10:96324548-96324570 CTGTGTGATCTTGAGCAAGTTGG + Intronic
1072779563 10:98237949-98237971 CTGTGTGACCTTGAGAGGGTAGG + Intronic
1072938140 10:99732652-99732674 CCCTGCGACCTTGTGCAAGTTGG + Intronic
1073419829 10:103415635-103415657 CTGTGTGACTCTGGGCAAGACGG - Intronic
1073490744 10:103851585-103851607 CTGCGAGACCCTAAGCAAGTTGG + Intronic
1073674870 10:105634534-105634556 CTATATAATCTTGAGCAAGTAGG - Intergenic
1074080567 10:110165173-110165195 CTGTGTGACTCTGGGTAAGTGGG + Intergenic
1074962900 10:118463946-118463968 GGGTGTGACCTTGGGCAAGGTGG + Intergenic
1075411427 10:122231351-122231373 CTCTGTGGCTTTGAACAAGTAGG + Intronic
1075659087 10:124181006-124181028 CTGTGTGATCTTGGGCAAGTTGG - Intergenic
1075813613 10:125247065-125247087 CTGGGTGAACTTGAGCAGATTGG + Intergenic
1075982973 10:126757012-126757034 CTGGATTAACTTGAGCAAGTAGG - Intergenic
1078104311 11:8349136-8349158 CTGTGTGACCTTAGACATGTTGG + Intergenic
1078464028 11:11537193-11537215 CTGTGTGACTTTAGGCAAGCTGG - Intronic
1078926365 11:15879178-15879200 CAATGTGATCTTGAGCAACTAGG - Intergenic
1079029991 11:16979455-16979477 CTGTGTGACCTTGAGCAAGGTGG - Intronic
1079295651 11:19231256-19231278 TTGAGAGACCTTGAGCCAGTAGG - Intronic
1079355745 11:19729207-19729229 CTGGGTGACTTGGAGCAAGCAGG + Intronic
1079501605 11:21106889-21106911 CTGTGTTCCTTTGGGCAAGTTGG + Intronic
1080024992 11:27604076-27604098 CATTGTGAACTTTAGCAAGTAGG - Intergenic
1080172324 11:29319999-29320021 CTATGAGAGCATGAGCAAGTTGG - Intergenic
1080294762 11:30713982-30714004 TTGTCTAAGCTTGAGCAAGTTGG + Intergenic
1080720037 11:34839737-34839759 GTATGTGAACTTGAGCAAGCTGG + Intergenic
1080925182 11:36748811-36748833 CTGTGTGGCCTTAAGCAAGTTGG - Intergenic
1081333636 11:41835772-41835794 CTGTGTTTCCTTGAGCAATTTGG + Intergenic
1081807215 11:45897091-45897113 CTGGGTGACCTTGAACTAGTGGG + Intronic
1081866523 11:46363405-46363427 CTGTGTGACTGTGTGCAAGTTGG - Intronic
1082031909 11:47610775-47610797 CTGTGAGACCTTGGGAAAGTTGG - Intergenic
1083728392 11:64640313-64640335 CTGAGGGACCCTGAGCAGGTAGG - Intronic
1083925358 11:65802901-65802923 CCGTGTGACCTTGAGCAAGATGG - Intergenic
1084084605 11:66849239-66849261 CTGGGTGTCCTTGACCAAGATGG + Exonic
1085018366 11:73189891-73189913 CTGTGTTACCCTGAGCCAGGTGG + Intergenic
1085311796 11:75521164-75521186 CTGTGTGACCTGGGGTGAGTCGG - Intronic
1085345355 11:75765085-75765107 CTGTGTGAGTTTGGGCAAGGGGG - Intronic
1085509461 11:77080832-77080854 CTGTGTGTCCTTGGGCAAGGTGG - Intronic
1085799149 11:79571992-79572014 CTGTGTGATCTCAAGCAAGTTGG - Intergenic
1085886661 11:80530821-80530843 CTATGTGAACTTGGGCAAGTTGG - Intergenic
1086151328 11:83614045-83614067 CAGTGTGAACTTGATGAAGTAGG + Intronic
1086335281 11:85794521-85794543 TTTTGTGACCTTGAGAAAGTGGG - Intronic
1087566016 11:99859014-99859036 CTATGCTACTTTGAGCAAGTTGG - Intronic
1089118934 11:116118300-116118322 CTGGGTGGCCATGAACAAGTGGG + Intergenic
1089784196 11:120896285-120896307 CTCTGTGACCTCAGGCAAGTTGG + Intronic
1090704100 11:129321049-129321071 CTCTATGACCTTGGGCAAGTTGG + Intergenic
1091589052 12:1832243-1832265 CTGTGTGATCTTGAGAAAGCTGG + Intronic
1091851138 12:3697969-3697991 TTATATGACCTTGAACAAGTCGG + Intronic
1092768327 12:11872921-11872943 CTGTGTGCCCTTGAGAGAGCGGG - Intronic
1093109639 12:15134163-15134185 CTGTGTGACCTTGGGTATGGTGG - Intronic
1094753127 12:33437703-33437725 GAGTGTTACCTTTAGCAAGTGGG + Intronic
1095103660 12:38206875-38206897 CTGTGTAACCATGGGAAAGTGGG - Intergenic
1096200758 12:49680843-49680865 CTGTGTAACCTTGAGCCAGTTGG - Intronic
1096633128 12:52942314-52942336 CTAGGTGACCTTGGTCAAGTTGG - Intronic
1097356590 12:58608988-58609010 CTGTGTCAGCTGGAGCAAGCAGG + Intronic
1098378674 12:69844651-69844673 CTGTGTGACTCTGGGCAAGCTGG + Intronic
1098964158 12:76768278-76768300 CTCAGTGACCTTGAGCTAGTAGG + Intronic
1099954131 12:89336362-89336384 CTGTCTGACGCTAAGCAAGTTGG - Intergenic
1100180189 12:92076987-92077009 GTGTGAGGCCTTGAGCAAGTTGG - Intronic
1101276155 12:103203599-103203621 CTGTGTGTCCTTGTGCCAGGAGG - Intergenic
1101320273 12:103667441-103667463 CTGTGTGACCTTGTACAAGGTGG - Intronic
1101443849 12:104723299-104723321 CTGTGTGATCCCGGGCAAGTCGG - Intronic
1101737285 12:107472493-107472515 CTGTGTGACCTTAGGCAATTTGG + Intronic
1102017163 12:109655606-109655628 CAGGGTGACCTTCAGCAAGTGGG - Intergenic
1102166381 12:110810066-110810088 TTATGTGACCTTGGGCAAGGTGG - Intergenic
1102187075 12:110957317-110957339 CTGCGTGACCTTGAGTGAATTGG + Intergenic
1102209781 12:111117934-111117956 CTGTGTGACCTTGGGCATGTTGG - Intronic
1102232992 12:111276531-111276553 CCTAGTGACCTTGAGCAAGTGGG + Intronic
1102301862 12:111777171-111777193 CTGTGTGACCTAGAGCCAAGTGG + Intronic
1102640130 12:114360176-114360198 CTGAGTGACCTTCAGCAAGTTGG + Intronic
1102659989 12:114517991-114518013 CTGTGTCACTTTGGACAAGTTGG + Intergenic
1103346896 12:120257146-120257168 CTGGGTGAGCTGGAGCAAGGGGG - Intronic
1104391181 12:128391716-128391738 CTGTGTGACCTAAAGCAAGGAGG - Intronic
1105564910 13:21535717-21535739 CTGTGTAACCTTGGGCAAGTTGG - Intronic
1105636118 13:22216756-22216778 CTGTGTGACCTTTAACAGGCTGG + Intergenic
1105810647 13:23992262-23992284 CTGTGTGACCTTGTGTACTTAGG + Intronic
1106070046 13:26401853-26401875 CTGTGTGACCTTGGACAAGTAGG + Intronic
1107015944 13:35707786-35707808 GGGTGTGACCTTGGGCAAGGTGG - Intergenic
1107767162 13:43748582-43748604 CTACCTGACCTTGGGCAAGTCGG + Intronic
1107986320 13:45779589-45779611 CTGGGTGATCTTAAGCAAGTTGG + Exonic
1107987116 13:45785207-45785229 CTGTGTGACCTAGACCATGCAGG - Intronic
1108196164 13:47997622-47997644 AGGTGTGACTTTGGGCAAGTAGG - Intronic
1109295081 13:60520800-60520822 CTGTGTGACCTTGTAAAATTGGG - Intronic
1112109273 13:96276461-96276483 CTGTGTGATGCTCAGCAAGTTGG + Intronic
1112305950 13:98273806-98273828 CTGTGTGACCTTGAACTTCTTGG - Intronic
1113778786 13:112963909-112963931 CTCTGGGGCCTGGAGCAAGTGGG - Intronic
1114044568 14:18712483-18712505 GTGTGTAAGCTTGAGAAAGTGGG - Intergenic
1114048901 14:18903209-18903231 GTGTGTAACGTTGAGAAAGTGGG - Intergenic
1114113661 14:19498724-19498746 GTGTGTAACGTTGAGAAAGTGGG + Intergenic
1114115361 14:19616473-19616495 GTGTGTAACCTTGAGAAAGTGGG + Intergenic
1115694218 14:35879045-35879067 CTCTGTGACCGTGAGGAAGTGGG + Intronic
1116425130 14:44781758-44781780 CTGTGTGCCTTTGGGCAAGTGGG - Intergenic
1116515296 14:45797433-45797455 TTGTGTGACTTTGGGCATGTTGG - Intergenic
1117706858 14:58478630-58478652 CTGTGTGAACTTGTGAAACTGGG - Intronic
1118711860 14:68526024-68526046 CTCTGTGACATTGGGAAAGTTGG + Intronic
1118746406 14:68776665-68776687 CTGTGTGACCTTGGGCGTGTTGG + Intergenic
1119566590 14:75634319-75634341 CCTTGTGACCTTGGGCTAGTAGG + Intronic
1119788406 14:77329126-77329148 CTGTCTGTCCTGAAGCAAGTGGG + Exonic
1120188538 14:81419299-81419321 TTGTGTGACCTTGAGAAAGTTGG - Intronic
1121575110 14:94978281-94978303 CTATGTGGCCTTGGGCGAGTGGG + Intergenic
1121830750 14:97050082-97050104 CTGTGTGATCTGTAGCAAGTAGG + Intergenic
1122016550 14:98801778-98801800 CTGTGTGGTCTTGAACAGGTTGG - Intergenic
1122250722 14:100437485-100437507 CTGTGTGGCCTTGGGCAAGGTGG + Intronic
1122472062 14:101975517-101975539 CTGTGTGACTTTGGGCAAGGCGG - Intronic
1123504960 15:20932802-20932824 GTGTGTAACCATGAGAAAGTGGG - Intergenic
1123562205 15:21506496-21506518 GTGTGTAACCATGAGAAAGTGGG - Intergenic
1123598450 15:21943783-21943805 GTGTGTAACCATGAGAAAGTGGG - Intergenic
1123826602 15:24088276-24088298 ATGTATGACCATGAGCAAGTCGG - Intergenic
1123855972 15:24411975-24411997 ATGTATGACCATGAGCAAGTCGG - Intergenic
1123860894 15:24465550-24465572 ATGTATGACCATGAGCAAGTCGG - Intergenic
1124148113 15:27149957-27149979 CTGTGTGATCTTGGGCAAGTAGG + Intronic
1126465016 15:48954080-48954102 CTGAGAAACCTTGAGCCAGTGGG - Intronic
1126572548 15:50167731-50167753 GTGTGTGGCTTTAAGCAAGTTGG + Intronic
1126714228 15:51497046-51497068 CTGTGGGACATTAAGAAAGTAGG - Intronic
1127032865 15:54883192-54883214 ATGTGTGACCTTGGGCAAATTGG - Intergenic
1127920636 15:63491685-63491707 CAATGTGAGATTGAGCAAGTAGG + Intergenic
1127982826 15:64046714-64046736 CTGCGTGGCCTTGGGCAAGTCGG + Intronic
1128111675 15:65080040-65080062 CTGTGTGGCTTTGGGCCAGTGGG - Intergenic
1128803974 15:70517137-70517159 CTGTGTGACTTGGAGCAATAAGG + Intergenic
1129462736 15:75707998-75708020 CTGTGTGACTCTGAACAAGCAGG + Intronic
1129722138 15:77883418-77883440 CTGTGTGACTCTGAACAAGCAGG - Intergenic
1129952352 15:79603001-79603023 CTATGTGACCTTCAGCAAGTTGG - Intergenic
1130614789 15:85394722-85394744 CTGTGTGACCTTGAGCAGGTAGG + Intronic
1131700664 15:94932115-94932137 CTGTGGGACCCTGAGCTAGCTGG + Intergenic
1202970550 15_KI270727v1_random:233638-233660 GTGTGTAACCATGAGAAAGTGGG - Intergenic
1133246928 16:4455226-4455248 CTCTGTGACCATGGGCAAGCCGG - Intronic
1133468628 16:6052303-6052325 CTGCGTGACCTTGGGCAAAATGG - Intronic
1134796385 16:17040894-17040916 CTGTGTGACCTTGGGAAGGTTGG - Intergenic
1134893934 16:17866874-17866896 GCTTGTGACCTTGAGCAAGCTGG - Intergenic
1135063661 16:19291409-19291431 CTGTGCGATCTTGGGCAAGTTGG + Intronic
1135323043 16:21509567-21509589 CTGTGTGACTTTCAGCAAGTGGG - Intergenic
1136334526 16:29602753-29602775 CTGTGTGACTTTCAGCAAGTGGG - Intergenic
1136419117 16:30121603-30121625 CAGTATGGCCTCGAGCAAGTGGG - Intronic
1136607590 16:31346897-31346919 CTGTGAGAACTTGAACCAGTGGG - Intergenic
1138402486 16:56758139-56758161 CTCTGTGACTTTGGGCAAGCTGG + Intronic
1138655344 16:58488123-58488145 CTGTGTGACCTTGGCCAACTGGG - Intronic
1138907485 16:61354610-61354632 CTATCTGACCTGGAGAAAGTTGG + Intergenic
1139745182 16:69068419-69068441 CTGTGTGAACCTGGGCAAATTGG + Intronic
1139938249 16:70586815-70586837 CTGCGTGACCGTGGGCAAGCTGG - Intronic
1140346485 16:74218330-74218352 CTGTGGGACCTTGGTTAAGTTGG - Intergenic
1140791032 16:78391414-78391436 CTTTCTCAACTTGAGCAAGTAGG + Intronic
1140840860 16:78837921-78837943 TTCTGTGCCCTTGAGCAGGTAGG - Intronic
1141076947 16:81015336-81015358 CTGTGAGCCCTGGAGGAAGTTGG + Intronic
1141113480 16:81289085-81289107 GTGTGTGACCTTGGGCAAAAAGG - Intronic
1142035238 16:87858589-87858611 CTGTGTGACTTTCACCAAGTGGG - Intronic
1143263066 17:5614604-5614626 CTGTGAGCCCCTGAGCAACTGGG + Intronic
1144780338 17:17805177-17805199 ATGTGTGGTCTTGAGCAAGTTGG + Intronic
1146241277 17:31229322-31229344 GTGTGTAACCATGAGAAAGTGGG + Exonic
1147183063 17:38698973-38698995 CAGTGTGACCTTGGGCAAAGCGG - Intergenic
1148324843 17:46777254-46777276 CTGTGTGACCTCGCACAAGTTGG - Intronic
1149227092 17:54484874-54484896 CAGTGAGACTTTGAGCAAGTTGG + Intergenic
1149489078 17:57068998-57069020 CTGTGTAAACTTGAATAAGTTGG + Intergenic
1150614840 17:66762442-66762464 CTGTGTGACTTTGGGCAAGTTGG - Intronic
1151053953 17:71010900-71010922 CTGTGTGACCTCATGTAAGTGGG + Intergenic
1151820867 17:76496080-76496102 CTGGGAGACTTTGGGCAAGTGGG + Intronic
1152704307 17:81834814-81834836 CAGGGTGACCTGGAGCAGGTGGG - Exonic
1154325869 18:13389938-13389960 GTGGGTGACTGTGAGCAAGTGGG - Intronic
1155032338 18:21995616-21995638 TTGGGTGATCTTGGGCAAGTGGG + Intergenic
1155097167 18:22568197-22568219 CTGGGTGACAATGATCAAGTAGG - Intergenic
1157133763 18:45034127-45034149 CTCTGTGACCTTGAGCAACCTGG + Intronic
1157365638 18:47061689-47061711 CTATGTAACTTTGGGCAAGTTGG + Intronic
1157553013 18:48594373-48594395 CTGTGGGGCCTGGAGCAAGCAGG - Intronic
1157555341 18:48609884-48609906 CTGGGTGACCTTGAGGGTGTGGG + Intronic
1157988465 18:52466916-52466938 CTGTGTAAGCTTGGGCAAGTTGG - Intronic
1158189205 18:54806804-54806826 ATGTATGATATTGAGCAAGTTGG - Intronic
1158419594 18:57280985-57281007 CTTTGTGAACTTGAGCACATTGG + Intergenic
1158624199 18:59057470-59057492 TTGTGTGACCTTGAAGAGGTAGG - Intergenic
1159179473 18:64883074-64883096 TTGTGTGACCTTGAGCAGCAGGG + Intergenic
1160033267 18:75280612-75280634 CTGTGTTACTTTGGGGAAGTCGG + Intronic
1160325994 18:77948664-77948686 TTGGGTGACCCTGAGCAAGTAGG - Intergenic
1160732120 19:646052-646074 CTGTCTGACCTCGAGCAATGCGG + Intergenic
1162113650 19:8415009-8415031 CTATATGACCTTGGGAAAGTAGG + Intronic
1162153268 19:8660178-8660200 CTGTGTGACCCTAGGCAAGTCGG + Intergenic
1162365392 19:10245648-10245670 CTGGATGGCCTTGGGCAAGTGGG - Intergenic
1162534649 19:11255660-11255682 CTGTGTGGCTTTGGGCAGGTAGG + Intronic
1162858025 19:13484041-13484063 GTGTGTGAGCTTGAGTAATTGGG + Intronic
1163664929 19:18598708-18598730 CTGCGTGACCTTGACCAACGCGG - Intronic
1164951528 19:32341252-32341274 TTGTGGGACTGTGAGCAAGTGGG - Intergenic
1165274323 19:34734612-34734634 TTGTGTAACCTTGAACAAATGGG + Intronic
1165891111 19:39112730-39112752 CTGTGTGACCATGGGCAAGTCGG + Intergenic
1166290729 19:41861547-41861569 CTGTGTGTCCTCTGGCAAGTTGG + Intronic
1166998081 19:46729343-46729365 CTTGGTGACCTAGGGCAAGTGGG - Intronic
1167197366 19:48039533-48039555 CTGTGTGACTTTCAGACAGTTGG + Intronic
1168532371 19:57139927-57139949 CTGTGTGACCCTGTGTGAGTGGG - Intronic
925737100 2:6973006-6973028 CTTTGTGACGTTGGACAAGTTGG + Intronic
926901005 2:17752505-17752527 TTGTGTGACTCTGAGCAGGTTGG - Intronic
926938194 2:18107255-18107277 CTGTGTGAGATTGAGGAAGAAGG + Intronic
927345579 2:22034953-22034975 CTTGGTGACCTTGGACAAGTTGG - Intergenic
927427115 2:22993912-22993934 GTATGTGACCTTGAATAAGTTGG + Intergenic
928376752 2:30781186-30781208 TTGTGTGACCTGGAACAAATCGG - Intronic
928697783 2:33867486-33867508 CTGTTTGACCTTCAGCAAATTGG - Intergenic
931432772 2:62222037-62222059 CTTTGTGATCATGGGCAAGTGGG - Intronic
931706705 2:64952215-64952237 CTGTGGGACCCAGAGAAAGTGGG + Intergenic
931994789 2:67829595-67829617 CTGTGTGACCTTGGGCAGGAAGG - Intergenic
932119108 2:69081943-69081965 CTGTGTGGCCTTGGACAAGTTGG - Intronic
932463916 2:71901226-71901248 ACGTGTGATCTTGAGCAAGTTGG - Intergenic
933512740 2:83261883-83261905 CAGTGTGTCCTTGAACATGTTGG - Intergenic
933992180 2:87641608-87641630 CTGGGAGACTTGGAGCAAGTCGG + Intergenic
934167479 2:89307343-89307365 ATGTGTGACCTGGAGCACCTGGG - Intergenic
934199796 2:89875103-89875125 ATGTGTGACCTGGAGCACCTGGG + Intergenic
934932583 2:98440176-98440198 CTGTGAGGCTTTGAGCAAGCAGG - Intergenic
935638847 2:105271569-105271591 CTGTGTGACCTGTGGCAAGCGGG + Intronic
935639605 2:105278533-105278555 CCGCGTGACCTTGAGCAAGTAGG + Intronic
936301669 2:111309229-111309251 CTGGGAGACTTGGAGCAAGTCGG - Intergenic
936506412 2:113111371-113111393 CTGTGTGACTCTGAGCCACTTGG - Intronic
936973104 2:118193361-118193383 TTGTGTGACCTTGAGCAAGAAGG - Intergenic
937159790 2:119749365-119749387 ATGTGTCAGCTTTAGCAAGTAGG + Intergenic
937309966 2:120896124-120896146 CTGAGTGATCTTGGGCAGGTTGG + Intronic
937319518 2:120952717-120952739 CTGTGTGGCCTTGACCAAGCTGG + Intronic
938192428 2:129295908-129295930 TTATGTGACCTTGAGGAAGGAGG - Intergenic
938426217 2:131191465-131191487 GTGTGTAACCTTGAGAAAGTGGG - Intronic
940039060 2:149340600-149340622 CTGGCTGACCTTTAGCCAGTAGG + Intronic
940261191 2:151781211-151781233 CTCTGTGATCTTGGGCAAGTTGG - Intergenic
940739019 2:157485748-157485770 CTGTGGGATCTTGAGCATGCAGG - Intronic
941213915 2:162681317-162681339 CTGGGTGACCTTTAGGAAGAAGG + Intronic
941663663 2:168221722-168221744 CGGTCTGACCTTGAGGAACTTGG - Intronic
942130273 2:172871913-172871935 CTGTGTGACTCCAAGCAAGTTGG - Intronic
942214815 2:173708441-173708463 CTGTGTGACCTTAGACAATTTGG - Intergenic
942980830 2:182079530-182079552 CTGTCTGACCTTGAGAGAGTGGG + Intronic
943472690 2:188314476-188314498 CTGTGTGACCTTGGGCAAGTGGG - Intronic
945268012 2:207910522-207910544 CTCTGTGACCTTGGGCAAATTGG - Intronic
945287518 2:208097194-208097216 CTGGGTGGACTTGAGCAGGTAGG - Intergenic
945687570 2:212990881-212990903 CAGTGTGACCTTGAGCATCATGG + Intergenic
945977271 2:216280704-216280726 CTGTGTCACCCTGGGCATGTTGG + Intronic
946147924 2:217744702-217744724 CTGCCTGCCCTTGGGCAAGTCGG + Intronic
946940065 2:224761067-224761089 CGATGTGACCTGGAGCAAGAGGG + Intergenic
946947038 2:224831865-224831887 CTATAGGACCTTGAGCAAGAGGG + Intronic
947109847 2:226707158-226707180 CTGTATGATCTTGGGCAGGTTGG - Intergenic
947134322 2:226961923-226961945 CTATGTGAACCTGAGTAAGTGGG - Intronic
947788338 2:232845105-232845127 CTGTGTGACCTTGGGCAAGAGGG + Intronic
1169649917 20:7855587-7855609 ATTTTTGACCTTGAACAAGTTGG + Intergenic
1170227108 20:14003407-14003429 ACGTGTGACCTTGGGCAAGCGGG + Intronic
1171055424 20:21901977-21901999 TTGTGTGACCTTGGACAAGCTGG + Intergenic
1171335790 20:24384269-24384291 CTGTTTGAATTTGGGCAAGTTGG - Intergenic
1171959235 20:31482119-31482141 CTGTGTCACCTTGGGAAAATTGG - Intronic
1171994342 20:31720719-31720741 CTGTGTGACCTTGGACAGGCTGG - Intronic
1172773040 20:37392643-37392665 CTGTGTGACCTTGAGCAAAGAGG + Intronic
1173490046 20:43472449-43472471 GTGTGTGACTTTGGGCATGTGGG - Intergenic
1173721388 20:45261110-45261132 CTGTGTCATCTTGGGCAAGTGGG - Intergenic
1174187300 20:48715927-48715949 CTCTGTGGCCTTGGGCAAGAGGG - Intronic
1174385865 20:50188465-50188487 CTGTGTGACCTTAGGCAAAATGG - Intergenic
1174696495 20:52564933-52564955 CTGTGTGACTTTGAGCACATTGG + Intergenic
1174850377 20:53988209-53988231 CTATGTGACTCTGAGTAAGTGGG - Intronic
1175480365 20:59306357-59306379 CTGTGTGGCCTTGAGCCAGGAGG + Intronic
1175936680 20:62517460-62517482 CTGGGTGACCTTCAGCCTGTGGG + Intergenic
1176268694 20:64224120-64224142 CTGTGTGACCCTGAGCCATGGGG + Intronic
1177172764 21:17671967-17671989 CTGGGAGAGCATGAGCAAGTGGG - Intergenic
1178307924 21:31506057-31506079 CTGTGGGACCTTGAGCAAGTTGG - Intronic
1178503313 21:33143551-33143573 CTGTGTGACCTTGGGCAAAGAGG - Intergenic
1178586045 21:33871871-33871893 CTGTGTGCTCTTGGGCAAGTTGG + Intronic
1179975730 21:44864866-44864888 CTGTGTGACCTTCAACAAGAGGG - Intronic
1180467387 22:15625593-15625615 GTGTGTAAGCTTGAGAAAGTGGG - Intergenic
1181018076 22:20082764-20082786 CTGTATGACCTTGAGCATGTGGG + Intronic
1181032319 22:20154553-20154575 CTGTGTGTCCCTGAGTGAGTGGG + Intergenic
1181032365 22:20154713-20154735 CTCTGTGTCCTTGAGTGAGTGGG + Intergenic
1181271060 22:21658624-21658646 CTGTGTGATCCTGAGCAAGTTGG + Intronic
1181630617 22:24149249-24149271 CTGAGTGGCTTTGAGCAAGCTGG + Intronic
1181720423 22:24770182-24770204 CTGTGTGACCTTGGGTAAGCGGG - Intronic
1181983811 22:26785118-26785140 CTGTGTTACCTTGGGCAAGTTGG + Intergenic
1182366422 22:29782399-29782421 CTCTCTGACTTTGAGCAAGGTGG - Intergenic
1183074486 22:35418172-35418194 CTCTATGACTTTGGGCAAGTTGG + Intronic
1183159485 22:36102426-36102448 CTGTATGATCTTGGGCAAGTTGG - Intergenic
1183265655 22:36823652-36823674 CTGTGTGATCCTGAGCCAGTTGG + Intergenic
1183427008 22:37745657-37745679 CTGTGTGACCTCGGGCAAATCGG + Intronic
1184091876 22:42297173-42297195 CTGGGCGACCTTGGGCAAGGAGG + Intronic
1184567477 22:45300739-45300761 CTGTGTGATCTGGGGCAAGGAGG + Intergenic
1185110898 22:48899613-48899635 CCCCGTGACCGTGAGCAAGTGGG - Intergenic
949168476 3:969470-969492 CTGTGTGACCCAGGGCAAGTCGG - Intergenic
949290665 3:2461844-2461866 CTGTGTGACCCTAAGCAACTTGG - Intronic
949763692 3:7501558-7501580 CTGTGTGACCTTAAACACATAGG - Intronic
950298463 3:11852572-11852594 CTGTGTGACCTGGTGCAAGTTGG + Intergenic
951507739 3:23467455-23467477 CTCTATGACTTTGAGCAAATTGG + Intronic
952924036 3:38308409-38308431 CCGTGTGGCCCTGTGCAAGTTGG - Intronic
952969817 3:38643757-38643779 CCGTGTGACCTTGAGCCTATGGG + Intronic
953790289 3:45942243-45942265 ATGTGTGTTCTTGGGCAAGTGGG + Intronic
953868620 3:46606731-46606753 CAGTGTGCCCTTGAACAACTTGG - Intronic
954069123 3:48130121-48130143 ATGGGTGATCTTGAGCAAGTTGG + Intergenic
955388771 3:58503036-58503058 CTGTGTGCCCTGGGGCAAGCAGG + Intergenic
955391091 3:58522817-58522839 CTGTGTGACCCTGGACAAATTGG - Intronic
956355300 3:68385079-68385101 CTGTGGGACCTTGGGTAAGATGG + Intronic
956488310 3:69744433-69744455 CTGGGTGACCTTGGGCAGGCTGG + Intronic
956814549 3:72896136-72896158 CCGCGTGACTTTGAACAAGTCGG + Intronic
956904631 3:73753033-73753055 GTGTGTGAGCTTCAGCAAGCCGG + Intergenic
956916257 3:73874714-73874736 CAGTGTGACCTTGAGCAAGACGG + Intergenic
956949112 3:74259424-74259446 TTGTGTGACCTTGGGAAAGCAGG - Intergenic
957432444 3:80128940-80128962 TTATGTGACTTTGAGCAAGGTGG + Intergenic
957836537 3:85599417-85599439 CTGTGTGACCTTGTGCTCGATGG - Intronic
960465672 3:117994454-117994476 TTTTGTGACCATGGGCAAGTCGG - Intergenic
961475968 3:127146508-127146530 CTGTGTAACCTTGGCCCAGTTGG + Intergenic
962661367 3:137603811-137603833 CTGTGTAACCTCGGGCAATTTGG + Intergenic
963932843 3:151022149-151022171 CTGGGAGACCTAGAGGAAGTTGG - Intergenic
965011300 3:163095593-163095615 CTGTGTTACCTTGGGCAAGTTGG + Intergenic
965129256 3:164673817-164673839 CTTTTTGACATTGAACAAGTAGG - Intergenic
965350615 3:167607559-167607581 CTTCATGCCCTTGAGCAAGTTGG - Intronic
966030486 3:175340510-175340532 CTATGGGACCTAGATCAAGTTGG + Intronic
966113408 3:176431524-176431546 AAATGTGACCTTGAGCTAGTTGG - Intergenic
966643068 3:182211764-182211786 GTGTGTGACCTTAGGCAAGCTGG + Intergenic
966969052 3:185025866-185025888 CTGAGTGACCTTGTGTAAATTGG + Intronic
969053924 4:4390133-4390155 CCATGTGACCTTGAGCACGCAGG - Intronic
969232864 4:5843616-5843638 CTCTGTGACTTTGGGCAGGTTGG + Intronic
969493982 4:7515428-7515450 CTGGGTGGCCTTGGGCAAGCTGG + Intronic
969872838 4:10115705-10115727 CTGCGTGACCTTGAGAAGATTGG - Intronic
970294301 4:14612050-14612072 TTGGGTGACCTTGAGCAAGCTGG + Intergenic
970500514 4:16672207-16672229 CTGTGTGACCTTCAGTGAGTTGG - Intronic
970676622 4:18457777-18457799 CTGTGTGACCTGGGGCAAATGGG - Intergenic
971342053 4:25779873-25779895 CTGTGTGGACTTGGGCATGTTGG + Intronic
971379363 4:26082988-26083010 CTGGGTGACTTTGATCAAGAAGG - Intergenic
972253281 4:37328054-37328076 CTGTGGGCCATTGAGCAAGGGGG - Intronic
972500054 4:39669579-39669601 CTGCATGACCTTGGGCATGTTGG + Intergenic
975822359 4:78285002-78285024 CTGTTTGATATTGAGCAAGTTGG - Intronic
979269814 4:118746465-118746487 TTGTGTGACCTGGGGCAAATTGG - Intronic
979695687 4:123610677-123610699 CTGTGTGACCTTGGGAAAGTTGG - Intergenic
979746172 4:124215959-124215981 CTGTGTGAACCTGGTCAAGTTGG - Intergenic
979905914 4:126292519-126292541 CTGTTTCACCTTGATCAAGAAGG - Intergenic
981364792 4:143889876-143889898 CTGTGTGAACTTAAGCAAGTCGG - Intronic
981722437 4:147815226-147815248 TTGTATGACCTTGGGCAAGTTGG + Intronic
981751589 4:148097530-148097552 CTATGTGACTTTTAGCAAGTAGG - Intronic
982791406 4:159595868-159595890 CTGTGTGATCATGGGCTAGTTGG + Intergenic
985670663 5:1204981-1205003 CTGTCTGTCCTTGAAAAAGTAGG - Intronic
986405860 5:7424380-7424402 CTGTGTGACTTTGAGGAAGTTGG - Intronic
989461148 5:41699810-41699832 TTTTGTGACTGTGAGCAAGTGGG - Intergenic
990073014 5:51808210-51808232 CTGTGAGATCTTGGGCAACTCGG - Intergenic
990770703 5:59241260-59241282 CTGCCTGGCCCTGAGCAAGTAGG + Intronic
991052545 5:62288577-62288599 GAGTATGACCTTGAGCAAGGTGG - Intergenic
992565184 5:77988931-77988953 CTGTCTGACTCTGAGCAAGGTGG + Intergenic
992853743 5:80838746-80838768 CTGTGAGATCTTAGGCAAGTCGG - Intronic
992869257 5:80990103-80990125 CTGTGTCCCCTGGAGAAAGTAGG + Intronic
993792382 5:92223435-92223457 CTGTGAGACGTTGTGGAAGTGGG + Intergenic
994724431 5:103417365-103417387 GAGTGTAACCTTGAGCAAGGTGG + Intergenic
995980727 5:118100014-118100036 CTGTGCAGCCTTGAGTAAGTAGG - Intergenic
996879884 5:128284298-128284320 CTCTGTGACCCTGGGCAAGTTGG - Intronic
996885932 5:128353780-128353802 CTGGGTGACCTTGGGTAAATTGG - Intronic
997612833 5:135227213-135227235 CTGTGTAGCCTTCAGCAAGTTGG - Intronic
997742436 5:136268771-136268793 CCCTGTGACCTAGATCAAGTGGG - Intronic
998167137 5:139850647-139850669 CTGAGTGGCCCTCAGCAAGTGGG - Intronic
998376299 5:141692961-141692983 CTGTGTGACCTTGGGAAAGCAGG + Intergenic
998480268 5:142457450-142457472 CTGTGTGACTTTGTGGAAGAAGG - Intergenic
998606185 5:143637182-143637204 CTGTGAGACTTTGAACAATTTGG - Intergenic
998947884 5:147360562-147360584 TACTGTGACCTTGAGCAAGTTGG - Intronic
999062940 5:148654568-148654590 CTGGGTGACCTTGGACAAGTTGG + Intronic
999996964 5:157101590-157101612 CTGTGTGATCTTGGGCAAAGTGG - Intronic
1000494315 5:161960515-161960537 CTGAGTGACCTTGAATAAATTGG - Intergenic
1000562101 5:162802191-162802213 CTGTGTGAACATGAACAAGAGGG - Intergenic
1001107481 5:168867506-168867528 GTGTGTGACTTTGAAGAAGTAGG + Intronic
1001604488 5:172950218-172950240 CTGTGTGACCTTGGGCCCCTGGG + Intronic
1002062049 5:176630792-176630814 CCGTGGGACCTTGAGCTACTCGG + Exonic
1002082398 5:176745166-176745188 CTGTATGACCTTGGGCACATTGG + Intergenic
1004442193 6:15664027-15664049 GTGTCTTACCTTGAGCAAATTGG - Intergenic
1004859750 6:19790746-19790768 CTGTGTGACCTTGAGAGAGCTGG - Intergenic
1005418914 6:25629333-25629355 CGGTGTGACCTTGAGCTAGTTGG - Intergenic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1006192370 6:32217446-32217468 CTGTGTGACTTTGGGCAAGCTGG + Intronic
1006454283 6:34123086-34123108 CTGTGTGACCTTGGGTAACGTGG - Intronic
1007184677 6:39959114-39959136 CTGTGTGTTCTTGAGCATGCTGG + Intergenic
1008522374 6:52374487-52374509 CACTGTGACCTTGAGCACCTGGG + Intronic
1008656394 6:53618406-53618428 CCTTCTGACCTTGAGCCAGTGGG + Intergenic
1010244113 6:73647070-73647092 ATGTGTTACTTTGAGCAATTTGG + Intronic
1010924235 6:81724072-81724094 ATGTGGGGCCTTGAGAAAGTTGG - Intronic
1012259819 6:97074702-97074724 CTTTGTGTACTAGAGCAAGTAGG + Intronic
1013656007 6:112247268-112247290 CTGTTTGACTTTGGGCAAATTGG - Intronic
1014663612 6:124206366-124206388 CTGTGTTCCCTTAAGCAAGTAGG - Intronic
1015542457 6:134328986-134329008 TGATGTAACCTTGAGCAAGTCGG - Intergenic
1015992587 6:138962198-138962220 CTTTGTGTCCTTTAGCAAGTAGG + Intronic
1016033134 6:139358034-139358056 GGGTGTGACCTTGAGCAAGGTGG + Intergenic
1016325231 6:142893181-142893203 CTGGGTGACGTTGGGCAAGGTGG + Intronic
1017267766 6:152470137-152470159 CTGAGTGAACTTGATGAAGTAGG + Intronic
1018515569 6:164576353-164576375 CTGTGTGGCCCTGAGCAATCAGG + Intergenic
1018925690 6:168205398-168205420 CTGTATGACCTTGGGGAACTTGG + Intergenic
1019578728 7:1749776-1749798 CTATGTGACCTTGGGCAGGTTGG - Intergenic
1019852811 7:3576337-3576359 CTGTGTGACTCTGAGCTAGGTGG + Intronic
1020485189 7:8712757-8712779 ATGTGTGACCATGAGCAAGGAGG - Intronic
1021670790 7:23033002-23033024 CTGTGTGACCTTGATCAAGTTGG - Intergenic
1022055629 7:26731019-26731041 TTGTGTGACCGTGAGCAAATTGG - Intronic
1022324787 7:29321455-29321477 CTGGGTGACCTTGGGCAAGTGGG - Intronic
1022460520 7:30601070-30601092 CTGTATGACTTTGGGCCAGTTGG + Exonic
1022514746 7:30968491-30968513 CGGGGTGACTTTGGGCAAGTCGG + Intronic
1024365502 7:48515930-48515952 CTCTGTGGCCTGGAGAAAGTCGG - Intronic
1024920930 7:54553965-54553987 CTGTGTGACGTTGGGAAGGTGGG - Intronic
1026603980 7:71800283-71800305 CTGTGTGACCCTGGGAATGTTGG - Intronic
1027807971 7:82853776-82853798 TGTTGTGCCCTTGAGCAAGTTGG + Intronic
1031157889 7:118132461-118132483 CTCTGTAACCTTGAGCAGTTTGG + Intergenic
1034183535 7:149156968-149156990 CTATGTGACCTCGGGCAAGTTGG - Intronic
1035295503 7:157864919-157864941 CTGTGAGCCCTTGTGCAGGTTGG - Intronic
1036766652 8:11553757-11553779 CTGGGTGTCCTTTTGCAAGTAGG + Intronic
1037457356 8:19076841-19076863 CTCTTTGACCTTGGGCAGGTAGG + Intronic
1037611488 8:20480013-20480035 CCGTGTGACCTTGGACAAGTTGG + Intergenic
1037928521 8:22864061-22864083 CTGTGTGCCCAGGAGCAAGGCGG - Intronic
1037931287 8:22881816-22881838 TTGTGTGGCCGTGAGCAGGTGGG + Intronic
1037987419 8:23298769-23298791 CTCTGGGTCCTTGAGAAAGTAGG + Intronic
1038651582 8:29408600-29408622 CTGTTTGACACTGAGGAAGTTGG + Intergenic
1038907374 8:31920668-31920690 CTGTATGACCTTGAGGATGTTGG + Intronic
1039816942 8:41102479-41102501 CTGACTGGCCTTGAGCAAGAAGG - Intergenic
1041037472 8:53809133-53809155 CTGTGTGACCTCGGGCATGTTGG + Intronic
1042534980 8:69849827-69849849 CTGTGTGAATTTGGGCACGTTGG - Intergenic
1043614709 8:82111504-82111526 CTGTGTGTACTAGATCAAGTGGG - Intergenic
1044237908 8:89853353-89853375 CTGTGTGACACTCTGCAAGTTGG - Intergenic
1044390612 8:91646094-91646116 CTGTGTGTGCCTGAGCAAGTAGG - Intergenic
1044537171 8:93370522-93370544 CTGTGTGGCCTTGGGCAAGTTGG - Intergenic
1045835182 8:106512184-106512206 CTGTGTGACCTTGGGCAATTGGG - Intronic
1045842009 8:106591611-106591633 CTGTGTGACCTTTGGAATGTTGG - Intronic
1047670500 8:127141262-127141284 CTGAGTGTCCTTGGGCAAGTTGG + Intergenic
1047993002 8:130306084-130306106 CTATGAGACCTTCAGCAAGAAGG + Intronic
1048344218 8:133565022-133565044 CTGTGTGGCCTTAGGCAAGGGGG + Intronic
1048961972 8:139587570-139587592 CTGACTGCCCTTGAGCAAGAGGG + Intergenic
1051228572 9:14929185-14929207 TTGTGTGACCTTGGAGAAGTGGG + Intergenic
1051522723 9:18008180-18008202 CTGTGTGACCCTCAGAAAATAGG + Intergenic
1052560645 9:30079041-30079063 CTCTGTGACCTTGGGCAAGTGGG + Intergenic
1052812702 9:33075664-33075686 TTATGTGACCTTGGACAAGTAGG + Intronic
1052816593 9:33106845-33106867 CTGTGTGATGCTGGGCAAGTTGG - Intronic
1054835327 9:69670956-69670978 CTGTGTGATGCTGACCAAGTGGG + Intronic
1057176751 9:93005898-93005920 CTGTGTGATGGTGAGCAAATTGG - Intronic
1057217257 9:93235974-93235996 CTGTGTGCCCCTGAGGAAGTGGG + Intronic
1057402960 9:94740786-94740808 CTGTGTAACCTTAAGCAAGCTGG + Intronic
1057820525 9:98326917-98326939 CTCTATGACCCTGAGCAAGTAGG - Intronic
1057872824 9:98731105-98731127 CTGTGTGACCTCAACAAAGTTGG + Intergenic
1059298688 9:113295694-113295716 CTGGGTGGCCTTGAACAAGGTGG + Intergenic
1059532245 9:115046255-115046277 CTGTGTTACCTTGGACAATTTGG - Intronic
1059723821 9:116986718-116986740 CTTTGTGACCTTCAGCAAGCAGG - Intronic
1060075490 9:120587109-120587131 CTGTGTGACTTTGGGAAAATCGG - Intergenic
1060267739 9:122122087-122122109 CTGTGTGATCTTGGGCAAGTGGG - Intergenic
1060652474 9:125340425-125340447 CTGTGTAACTTTGAGGAAGAGGG + Intronic
1061369497 9:130190472-130190494 TTGTGTGACATTGGACAAGTCGG - Intronic
1061406127 9:130393950-130393972 CTGTGTGGCCGTGAGCGAGGCGG + Intronic
1061640560 9:131951531-131951553 CTGTGAGAACTTGAGCATCTAGG - Intronic
1061780590 9:132993993-132994015 CTGTGTGACTTTGGGCAAGTAGG - Intergenic
1061874175 9:133535667-133535689 CTGTGTGGCTTTGAGCAGGTTGG + Intronic
1185999302 X:4989924-4989946 CTGTGTGACCTTGAGGACCCAGG - Intergenic
1186430607 X:9501217-9501239 TGGTGTGACCGAGAGCAAGTTGG + Intronic
1187125269 X:16448630-16448652 CTGTGTGACCTTGGGCAAGGTGG + Intergenic
1187397098 X:18928189-18928211 CTGTGGGTCCTTGAGGGAGTGGG + Intronic
1187526967 X:20063174-20063196 CTGTGTGATCTTGGGCAAACTGG - Intronic
1192100315 X:68257445-68257467 CTGTGTGACCTTGAACAAGTAGG + Intronic
1192562931 X:72139390-72139412 CTGGGTGACCCTGAGCATCTGGG - Exonic
1192845567 X:74903702-74903724 CTGTGTGACTTTGAGCGAGCAGG + Intronic
1193770511 X:85582100-85582122 CTGTGTGATCCTGGGCAAGTTGG - Intergenic
1195244443 X:102982901-102982923 CTTTGTGGCCTTGGGCAAGTAGG + Intergenic
1196235194 X:113271867-113271889 CTGTATGACTTTGGGCCAGTTGG + Intergenic
1196891573 X:120295689-120295711 CTGTGTAACCTTGAACAAACTGG + Intronic
1197595271 X:128456535-128456557 CTGTATGACTTTGAGCAACATGG - Intergenic
1198194089 X:134342606-134342628 CTGTGTGACCTTGAGCAAGTTGG + Intergenic
1198720903 X:139618986-139619008 ATCTGTGACCTTGAGTAAATTGG - Intronic
1198965159 X:142220425-142220447 CTCTGTGATCTTGGGCAAGTCGG + Intergenic
1199665161 X:150090669-150090691 GTATGTGACCTTGAGGAAGCTGG + Intergenic
1200229226 X:154435884-154435906 TTGTGTGACCCTGTGCCAGTGGG + Exonic
1201227521 Y:11832744-11832766 CAATGTGACCTTGAGCATGAAGG + Intergenic
1201901664 Y:19049948-19049970 CTGTGTGATCTAGAGCAATCAGG + Intergenic