ID: 915367069

View in Genome Browser
Species Human (GRCh38)
Location 1:155322648-155322670
Sequence CAGGGAAAATTGATGGAGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 451}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915367063_915367069 16 Left 915367063 1:155322609-155322631 CCAACACAAGAATAACTGATTCT 0: 1
1: 0
2: 0
3: 16
4: 204
Right 915367069 1:155322648-155322670 CAGGGAAAATTGATGGAGGATGG 0: 1
1: 0
2: 3
3: 34
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915367069 Original CRISPR CAGGGAAAATTGATGGAGGA TGG Exonic
902655661 1:17866239-17866261 AAGGGGAAAATGATGGGGGAGGG - Intergenic
904011091 1:27391159-27391181 CAGGGAACATGGGAGGAGGAGGG - Intergenic
904460616 1:30677531-30677553 CAGGAAAATTTCCTGGAGGAAGG + Intergenic
904485731 1:30823620-30823642 CAGGGAAGCTTTGTGGAGGAGGG - Intergenic
905898309 1:41563439-41563461 CAGGAAAAAGTCAGGGAGGAGGG - Intronic
906232250 1:44173753-44173775 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
907005870 1:50912256-50912278 CAGGTAAATCTGATGTAGGAAGG - Intronic
907099057 1:51811176-51811198 CAGGGAAAGGTAAAGGAGGAAGG - Intronic
907150464 1:52281427-52281449 CTTGGAAAAATGATTGAGGACGG - Intronic
908129024 1:61056289-61056311 GAGGGAATAATGATGGGGGAGGG - Intronic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908535681 1:65074854-65074876 GAGGAAAAATTGATGAAGTAGGG + Intergenic
909688994 1:78384490-78384512 CAGTGCAAACTCATGGAGGAAGG + Intronic
909836199 1:80258655-80258677 CAGGGAAAATTGAAAGATCATGG + Intergenic
911320645 1:96409955-96409977 AATGGAAAATTGAGGGAAGAAGG + Intergenic
912172252 1:107114830-107114852 CATGGAAAGTAGATGGAGGTGGG + Intergenic
912226799 1:107743094-107743116 CAGGGAAAACTGATAGGAGATGG + Intronic
912737283 1:112161093-112161115 CAGGGAGAAATGATAGAGAAGGG - Intergenic
913294094 1:117302048-117302070 CAAGGATAATTGCTGGGGGAGGG - Intergenic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915367069 1:155322648-155322670 CAGGGAAAATTGATGGAGGATGG + Exonic
915469974 1:156120012-156120034 CATGTGAAACTGATGGAGGAAGG + Intronic
915482939 1:156199581-156199603 GAGGGACAATTTCTGGAGGAGGG + Intronic
916058549 1:161083993-161084015 CAGGGGATACTGATGGAGAAAGG - Intronic
917606796 1:176639541-176639563 CAGGGAAAATGGAAGAAAGACGG - Intronic
918144260 1:181741990-181742012 AAGAGAAAATGGATGGAGAAGGG - Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
922955452 1:229595508-229595530 CAGCTAAAACTGATGGATGAAGG - Intronic
924584787 1:245352685-245352707 CAAGGAAAAGTGATAGAGGCAGG + Intronic
1063731880 10:8707106-8707128 CAGGGAAAATTGTTGCAGTATGG + Intergenic
1063775324 10:9256814-9256836 CAGAGGAAATTGATGGAGTACGG + Intergenic
1063931167 10:11029614-11029636 CAGGGAACTTTGCTGGAGGCAGG + Intronic
1064397182 10:14991397-14991419 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1064400074 10:15013855-15013877 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1064587339 10:16852065-16852087 GAGGGAAAGATGATGGAGGGAGG - Intronic
1064974196 10:21096619-21096641 CTGGGAAAACTGAGGCAGGAGGG - Intronic
1065483079 10:26213758-26213780 TAGGGAGAATTTATGGAGGGAGG + Intergenic
1065788480 10:29238113-29238135 CATGGAAAAGTGATGCAGGTAGG - Intergenic
1068486624 10:57667161-57667183 CAGGGAAAACTCATGGAGACAGG - Intergenic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072463260 10:95639771-95639793 GGGGGAAAACTGATGGAGAAGGG - Intronic
1072465047 10:95655977-95655999 CAGGGGATAATGATGGGGGAAGG + Intronic
1072997343 10:100257113-100257135 AAGTGAAAATTGATGGAGCAAGG - Intronic
1073643444 10:105276042-105276064 CAAGGAAAATACATGGAGCATGG - Intergenic
1074612285 10:115033847-115033869 CAGAGAAAATTCGAGGAGGAGGG - Intergenic
1075609069 10:123836849-123836871 AAGGGAAAATTGGTGGGGGGTGG - Intronic
1077876100 11:6307673-6307695 AAGGGAAATTGGATGGAAGATGG + Intergenic
1078244903 11:9565162-9565184 CAGGGAGATTTGATGAAGGCAGG - Intergenic
1079321688 11:19456706-19456728 CAGGTAAAATTGTTAGAGGTGGG + Intronic
1079321781 11:19457469-19457491 CTGGGAAGAGGGATGGAGGAGGG + Intronic
1079367102 11:19819026-19819048 AAGTAAAAATGGATGGAGGAAGG - Intronic
1080159623 11:29157858-29157880 CAGGGATTATGGATGGGGGAGGG + Intergenic
1080416236 11:32072438-32072460 CAGGAAGAATTGTGGGAGGAAGG + Intronic
1081125939 11:39321222-39321244 CAGGTTAAGTTGATGCAGGAAGG - Intergenic
1081366578 11:42242673-42242695 CATTGAAAATGGATTGAGGAAGG + Intergenic
1082105638 11:48218251-48218273 CAGGGAATATTTAGGAAGGAGGG + Intergenic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084261075 11:67979051-67979073 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1084344868 11:68540041-68540063 GAGGGAAAATGGAAGGAGGGAGG + Intronic
1084807556 11:71589488-71589510 GAAGGACAAGTGATGGAGGAAGG + Intronic
1084844654 11:71889495-71889517 GAAGGACAAGTGATGGAGGAAGG + Intronic
1084847506 11:71911954-71911976 GAAGGACAATTGATGGAGGAAGG + Intronic
1085660892 11:78365642-78365664 CAGGGAAAATTCTGGGAGGTAGG + Intronic
1086355232 11:85990693-85990715 CAGGGAAGATTGGTGCAAGATGG - Intronic
1086855926 11:91865774-91865796 CAGGGAAAGTGAAGGGAGGAGGG + Intergenic
1086922612 11:92604678-92604700 CAGGGCAAAGTGATACAGGATGG - Intronic
1087577762 11:100010871-100010893 CAGGGAGGATTAATGGAGGAGGG - Intronic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087693463 11:101348593-101348615 CTGAGAAAGTTGAGGGAGGAAGG + Intergenic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1087917785 11:103830887-103830909 CATTGAAAATGAATGGAGGAAGG + Intergenic
1088258699 11:107925246-107925268 GAGGGAAAAGAGATGAAGGAAGG + Intronic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089569241 11:119392137-119392159 CAGGGAAAAGGGTGGGAGGAAGG - Intergenic
1089622854 11:119731704-119731726 CAGGGAAGGTTGCTGGGGGAGGG + Intergenic
1089634838 11:119805431-119805453 CAGGGACAGTTGATGGGGGAAGG - Intergenic
1089725272 11:120472380-120472402 TAGGGAAAATTGAGGGGGGTGGG + Intronic
1090827868 11:130400570-130400592 CAGGAAAGATGGATGGGGGAAGG + Intergenic
1091021514 11:132104334-132104356 GGGGGAAAATGGAGGGAGGAAGG - Intronic
1091386062 12:95570-95592 CAGGGAAAAAACATGGAGGTAGG - Intronic
1091767894 12:3133786-3133808 CTGTGAAAATGGATGGATGACGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092432336 12:8419619-8419641 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1092602758 12:10084274-10084296 CATGGAACAGTGAGGGAGGAAGG - Intronic
1093411824 12:18877126-18877148 CAGGGCATAGGGATGGAGGAAGG + Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1096355548 12:50938105-50938127 GAGGGCATATTGATGGCGGAGGG - Intergenic
1096508967 12:52116573-52116595 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1096802300 12:54118959-54118981 AAGGGAGAATTGATAAAGGAGGG + Intergenic
1097520506 12:60663317-60663339 GAGGCAATTTTGATGGAGGATGG + Intergenic
1098169401 12:67731492-67731514 CATGGCAAAATGGTGGAGGAGGG - Intergenic
1099163836 12:79276912-79276934 GAAGGAAAAATGATGAAGGAAGG + Intronic
1099389166 12:82057714-82057736 GAGTTAAAAATGATGGAGGAGGG + Intergenic
1099646687 12:85366623-85366645 AAAGGAAAATGGATGGAGTATGG - Intergenic
1100012778 12:89973244-89973266 CAGGGAAAATGGAGGTGGGATGG + Intergenic
1100089894 12:90955554-90955576 CATGGAAAATTACTGGAGAAAGG + Intergenic
1100596720 12:96078334-96078356 CTGGAAAATGTGATGGAGGAGGG + Intergenic
1101635628 12:106538774-106538796 CAGGGGCAATTGATTGAGAAGGG + Intronic
1101785977 12:107884011-107884033 CAGGGATAACGGAAGGAGGAAGG - Intergenic
1102219203 12:111182981-111183003 CCGGGCAGATTGAAGGAGGAAGG - Intronic
1104243948 12:127018766-127018788 CAGAGAAAGTGGATGGAGGGAGG - Intergenic
1106283532 13:28298576-28298598 AGGGGAAAATTGATGGTGGGGGG + Intergenic
1106626957 13:31430571-31430593 GTGGGAAAAGTGAAGGAGGAGGG - Intergenic
1108032517 13:46250031-46250053 CACGGAATAATGAGGGAGGAAGG - Intronic
1108129101 13:47277679-47277701 GAGTAAAAATTGATAGAGGAGGG + Intergenic
1108335415 13:49436249-49436271 CTGGGAAAATTGATCCAGAATGG - Intronic
1108439710 13:50438447-50438469 CAGAGAAAATGTGTGGAGGAGGG + Intronic
1109002502 13:56824164-56824186 CAGGTATAAAAGATGGAGGAAGG - Intergenic
1109698889 13:65998890-65998912 CAGGAAAAATTGATGTGGCAGGG - Intergenic
1110844586 13:80179821-80179843 CAGGGGAGAATGGTGGAGGAAGG - Intergenic
1113507372 13:110826500-110826522 CAGGGTCAATTGATGGTGGATGG + Intergenic
1113507387 13:110826608-110826630 CAGGGTCAATTGATAGTGGATGG + Intergenic
1113586163 13:111467623-111467645 CAGGGGACATTGCTGGGGGAGGG + Intergenic
1113691343 13:112313038-112313060 CAGGGAAAATTTCTTCAGGATGG + Intergenic
1114225572 14:20735069-20735091 CAGGGGCTATTGATGGAGGCAGG - Intronic
1114227027 14:20748084-20748106 CAGGGGCTATTGATGGAGGCAGG - Exonic
1114528968 14:23383379-23383401 AAGAGTAAAATGATGGAGGAGGG - Intronic
1116040890 14:39685362-39685384 CATGGAGAACTGATGGGGGATGG - Intergenic
1116152863 14:41164473-41164495 CAGGGAAAATTTATAAATGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116962415 14:50979787-50979809 AAGTGAAAATTGATGGTGGCAGG - Intronic
1117038837 14:51751966-51751988 GAAGGACAAGTGATGGAGGAAGG + Intergenic
1117203459 14:53416436-53416458 CTGGGAAAATTGATTCAGAATGG - Intergenic
1117487678 14:56214254-56214276 GAGGGAAGGTTGATGGGGGAGGG + Intronic
1118049702 14:62013628-62013650 CAGGTAAAGTTGAAGGAGGTGGG - Intronic
1119004923 14:70915959-70915981 AAGGGATAAATCATGGAGGAAGG + Intronic
1120611285 14:86645249-86645271 ATGGGAAAATTGATGGAGAAAGG - Intergenic
1120680084 14:87470832-87470854 CAAGGAAAAATGTTGGGGGAAGG - Intergenic
1120894732 14:89519289-89519311 GAGAGAAAATTCTTGGAGGAGGG + Intronic
1121095948 14:91218094-91218116 CAGGGAAGAGAGATGGGGGAGGG + Intronic
1121254048 14:92518626-92518648 CAGGGAGAAAGGATGGGGGAAGG + Intronic
1121435706 14:93917846-93917868 AAGGGAAAAGTGATGGGGCAGGG - Intergenic
1121928780 14:97953057-97953079 CATGGAAATTTGATGGACAATGG + Intronic
1122059345 14:99126193-99126215 CATGGAAAATCCATGGAGGATGG + Intergenic
1122627979 14:103093979-103094001 CAGGGAAAATCCAAGGAGAACGG - Intergenic
1123818010 15:23999167-23999189 CTGGAAATATTGCTGGAGGAGGG + Intergenic
1124646311 15:31439822-31439844 CAGGAATATTTGATAGAGGAGGG - Intergenic
1126525887 15:49653880-49653902 AAGGAAAAATAGATGGAAGATGG + Exonic
1126725610 15:51628606-51628628 TAGGGAAACAGGATGGAGGAAGG - Intergenic
1127210290 15:56767421-56767443 CAGGAAAAATTGATGCATAATGG + Intronic
1127588878 15:60402854-60402876 CAGGAAAACAGGATGGAGGAAGG - Intronic
1128299983 15:66560577-66560599 CTGGGAATTTTGAAGGAGGAAGG - Intronic
1129803674 15:78436941-78436963 CAGGGAAAATGGACAGAGGGAGG + Intergenic
1131925905 15:97383476-97383498 GAGGGAAAATGAATGAAGGAAGG + Intergenic
1132030908 15:98437954-98437976 GATGGAAGATGGATGGAGGATGG + Exonic
1132327689 15:100985456-100985478 CAGGGGAAATTGAGGCAGAAAGG + Intronic
1132401026 15:101505552-101505574 CAGAGAAAAATGATGGATCAAGG + Intronic
1133155079 16:3868658-3868680 CAGGGAGGCTTGTTGGAGGAAGG - Intronic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1135544781 16:23358261-23358283 CAGGGAAAATAGCTGGCTGATGG + Intronic
1136071317 16:27789148-27789170 GATGGATAATTGATGGATGATGG + Exonic
1136453406 16:30367543-30367565 CAGGGAAGCTTCCTGGAGGAGGG + Intronic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140404321 16:74698109-74698131 GAGGGAGAATTGATTGAGGCTGG + Intronic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140637478 16:76932278-76932300 CAGGGAAAATTGGTGATGGCAGG - Intergenic
1141059445 16:80852480-80852502 CAGGGAAAGTTCAGGAAGGAGGG - Intergenic
1141244868 16:82296487-82296509 CAGGGGAAAGTGTGGGAGGAGGG - Intergenic
1141280034 16:82623103-82623125 CAGGGAGACTTGTTGTAGGACGG + Intergenic
1142685288 17:1574150-1574172 CTGGGAAAATCGGTAGAGGAGGG + Intronic
1143837988 17:9708178-9708200 CAGGGGTAATTGATGAAGGGTGG + Intronic
1146988606 17:37246227-37246249 CAGAGAAAATACATGGAGGTGGG - Intronic
1147866278 17:43554714-43554736 AAGGGAAAACTGATGGAGGGGGG + Intronic
1148247127 17:46039954-46039976 CTGGGCAAATTAAAGGAGGATGG - Intronic
1149363983 17:55922325-55922347 CAGGGAGATTTCCTGGAGGAGGG + Intergenic
1149985728 17:61345491-61345513 CATGGAAAAATGAAGGAGGGAGG + Intronic
1150211634 17:63445323-63445345 CGGTGAAATTTGATGGAGGCAGG - Intronic
1150443716 17:65212286-65212308 CAGGGAAAGTTGAAGAATGAGGG + Intronic
1151345701 17:73500124-73500146 GAGGGAGGATGGATGGAGGATGG - Intronic
1151345717 17:73500188-73500210 GAGGGAGGATGGATGGAGGATGG - Intronic
1151345788 17:73500456-73500478 GAGGGAGGATGGATGGAGGATGG - Intronic
1151345881 17:73500862-73500884 GAGGGAGGATGGATGGAGGATGG - Intronic
1151345890 17:73500893-73500915 GAGGGAGGATGGATGGAGGATGG - Intronic
1152103438 17:78315767-78315789 CAGGGAAAATGGAAGGCGGGCGG + Intergenic
1152358954 17:79821353-79821375 AAGGGAAAAATGATGTAGGAGGG - Intergenic
1153631699 18:7076702-7076724 CTGGGAAAATTGAATGTGGATGG + Intronic
1154970971 18:21409320-21409342 CAAGGCAAATTTATAGAGGAAGG + Intronic
1155913867 18:31536838-31536860 CAGGGAATAATGTTGAAGGAAGG - Intronic
1157110481 18:44816068-44816090 CAGGGACAATAGATGAAAGAAGG + Intronic
1158365603 18:56731222-56731244 CATGGAAGATTGTTAGAGGAAGG + Intronic
1158368284 18:56766616-56766638 CAGGGAAAATTGCTGCAGCCTGG - Intronic
1159020010 18:63135685-63135707 CAGGGACAATTGACGGAGGAAGG - Intronic
1161733214 19:5974933-5974955 GATGGCAAATGGATGGAGGAGGG + Intronic
1161927146 19:7309451-7309473 CAGGGAAAATTGGGGGGAGAAGG + Intergenic
1162062943 19:8107735-8107757 AAGGAAGAATGGATGGAGGATGG + Intronic
1163894815 19:20049452-20049474 CAGGAAAAACTAGTGGAGGATGG + Intergenic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166880816 19:45929017-45929039 CAGGGGCAAGTGATGGAGAATGG - Intergenic
925575633 2:5357189-5357211 CATGGAAAATAGAGGGAGGGGGG + Intergenic
925600115 2:5599702-5599724 CAGATAAAATTTATGGAAGATGG + Intergenic
925665701 2:6252977-6252999 CAGGGAAACGGGATGGAGGGAGG - Intergenic
926527378 2:13997959-13997981 AAGGGAAAATGGAGGGAGAAAGG + Intergenic
926748473 2:16179785-16179807 CAGGGAAGGTTCCTGGAGGAGGG + Intergenic
926760560 2:16275248-16275270 CAGGGGAATTTTGTGGAGGACGG - Intergenic
927100961 2:19787459-19787481 CAAAGGAAATTCATGGAGGAAGG - Intergenic
927677009 2:25113736-25113758 CAGTGGAAATTCATGGAGTATGG + Intronic
928029620 2:27767390-27767412 CAGGTAAAATTGTTTGTGGATGG + Intergenic
929906142 2:46048395-46048417 CATGGGAAATTGATGGGGGCTGG - Intronic
931299258 2:60960456-60960478 CTTGGATAATTGATGGAGAAAGG - Exonic
931650354 2:64462867-64462889 CAGGGAAAATCGATGGAGCTAGG + Intergenic
931685422 2:64788183-64788205 CAGTGCAAATTCCTGGAGGAGGG - Intergenic
932109037 2:68977214-68977236 CTGGAAAAATTGATGAAGAAGGG - Intronic
932349985 2:71023882-71023904 GAAGGACAAGTGATGGAGGAAGG + Intergenic
933299231 2:80523891-80523913 TAGGGGAAATTGGTTGAGGAAGG + Intronic
935016908 2:99191492-99191514 CTGGGAAATTAGATAGAGGATGG - Intronic
935110673 2:100091776-100091798 ATGGGCAAACTGATGGAGGAAGG - Intronic
935514990 2:104024930-104024952 AAGGGAAACTTGCTGGAGAATGG + Intergenic
936112521 2:109676597-109676619 CTGGGAAACTTGCTGAAGGAGGG + Intergenic
936124298 2:109773386-109773408 ATGGGCAAACTGATGGAGGAAGG + Intergenic
936220391 2:110598078-110598100 ATGGGCAAACTGATGGAGGAAGG - Intergenic
936626897 2:114158061-114158083 CATGGAATATTTATGGATGAAGG - Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937627913 2:124064536-124064558 GAGTGAAAATTGATGGATGCAGG - Intronic
937639386 2:124194166-124194188 CAGAGAAAATAAATGGGGGAGGG - Intronic
938555496 2:132419660-132419682 AAGGGAATATTTATGGAGGAAGG - Intronic
940874448 2:158885653-158885675 GAAGGACAAGTGATGGAGGAAGG + Intergenic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
942745930 2:179233116-179233138 CAGGGAAAATTTAGGAAGAAAGG + Intronic
944374191 2:199021733-199021755 CAGGGCAAAATTTTGGAGGAAGG - Intergenic
944614156 2:201442995-201443017 TAGGGATAATTAATGGAGCAAGG - Intronic
944617400 2:201475854-201475876 AAGTGAAAATTGAGGGAGGAAGG + Intronic
945064150 2:205934290-205934312 GAGGGAAAATTCATAGAGGGAGG + Intergenic
945182524 2:207106603-207106625 CAGGGGAACTTCATGGAGAAAGG - Intronic
945653298 2:212591842-212591864 CAGGGTACCTTGAGGGAGGAGGG - Intergenic
945702019 2:213183458-213183480 GAGGGAAAATTGAGGTAGAATGG + Intergenic
945923064 2:215776139-215776161 CAGGGCAGATTAAAGGAGGAAGG + Intergenic
946919637 2:224565388-224565410 CAGGCACAAGAGATGGAGGAGGG + Intronic
947929224 2:233949451-233949473 CAGGGGAAATTATTTGAGGAGGG + Intronic
947935763 2:234002115-234002137 CAGGGAAGATTTATGGAGGAAGG + Intronic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
948870244 2:240794159-240794181 CAGGGAAGCCTGACGGAGGAAGG - Intronic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169684665 20:8257739-8257761 CAGTGAAAATTCATGAAGGTTGG - Intronic
1169945695 20:10985685-10985707 CAGGGAAAAGAAATAGAGGACGG - Intergenic
1170137805 20:13094482-13094504 CAGGGAAAAATGAAGGGGAAGGG - Intronic
1171111996 20:22492648-22492670 CCAGTAAAATTGAGGGAGGATGG - Intergenic
1171113609 20:22505355-22505377 CTGGGAAAGATGATGGAGAATGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171854035 20:30328762-30328784 AAGGGAGAATTGATAAAGGAGGG + Intergenic
1172303127 20:33863541-33863563 CAGAGAAAATTGGTGGAGTGGGG - Intergenic
1172837946 20:37885029-37885051 AAGGGAAAAAGCATGGAGGAAGG - Intergenic
1172948559 20:38706891-38706913 CAGGGAAAGGTGAGGGAGAAGGG - Intergenic
1173047987 20:39530987-39531009 AAGGGAAAAAGGATGGAGGGAGG - Intergenic
1173471829 20:43329973-43329995 CAAGAAAAATGGATGGAGCAAGG + Intergenic
1173827865 20:46058726-46058748 CTGGGACAAGTGAGGGAGGAGGG + Intronic
1173988193 20:47279113-47279135 CATGGAAAATAGTTGGGGGAAGG - Intronic
1174643317 20:52063975-52063997 CAGGCAAGAATCATGGAGGATGG + Intronic
1175521879 20:59607039-59607061 CTTGGGAACTTGATGGAGGAAGG + Intronic
1177955104 21:27588486-27588508 CAAGGAAAAAAGATGGAAGAAGG + Intergenic
1178047302 21:28709833-28709855 CAGAGAATATGCATGGAGGATGG + Intergenic
1178926627 21:36780676-36780698 CAGGGTAAATTGCTGGAAGTGGG + Intronic
1179031125 21:37720490-37720512 CAGGGGACCTTGAAGGAGGAGGG + Intronic
1179157807 21:38865097-38865119 CAGTGAAAGTTGATTGAGGTGGG - Intergenic
1181537045 22:23551782-23551804 ATGGGAGAATGGATGGAGGATGG - Intergenic
1181537073 22:23551929-23551951 AATGGAAGATGGATGGAGGATGG - Intergenic
1181975064 22:26723054-26723076 AAGGGGAAATGGATGGAGGAGGG - Intergenic
1182385168 22:29932868-29932890 CAGGGAAAAAATATGGAGAAAGG - Intronic
1182458430 22:30467691-30467713 CAGGGAAAGTTGTGGGAGGTAGG + Intronic
1182647320 22:31820821-31820843 CAGGGAACCCTGATGAAGGAGGG - Intronic
1182656746 22:31896751-31896773 GAGAGAAATGTGATGGAGGAGGG - Intronic
1183071201 22:35397627-35397649 AAAGGAAGATTGAGGGAGGAAGG + Intergenic
1183467670 22:37987819-37987841 CAGGGAAACTGGAGGTAGGAGGG - Intronic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184093731 22:42305570-42305592 CAGGACAAATGGATGGATGAAGG + Intronic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
949508399 3:4747423-4747445 CCTGGAAAATTGGTGGAGTAAGG - Intronic
949884603 3:8683239-8683261 GAAGGACAAGTGATGGAGGAAGG + Intronic
950880872 3:16321783-16321805 CAGGGAAAATTCAGAGAGGATGG - Intronic
951050132 3:18084753-18084775 CAGGGTAAAATGTTGGAGGGAGG + Intronic
951232812 3:20199437-20199459 CAGGGAAAATTATTAAAGGAAGG + Intergenic
952013420 3:28929324-28929346 CAGGGAATACTAATGGTGGAAGG + Intergenic
953289618 3:41648708-41648730 TAGGGAATGTTGAGGGAGGAGGG + Intronic
953779431 3:45853643-45853665 AAGGGATAATTGATGGAGCTTGG - Intronic
954936516 3:54331926-54331948 CAGGGTAGATTGAGGGAGGGAGG - Intronic
954984403 3:54776818-54776840 CAGGGATAGTCTATGGAGGAAGG - Intronic
955244807 3:57214890-57214912 AAGGGAATATAGATGAAGGAGGG + Intronic
955274763 3:57536626-57536648 TAGGGAGAAATGATGGATGAAGG - Intronic
957186780 3:76951786-76951808 CAGGGAGAATTTTTGGAGCATGG - Intronic
959351185 3:105266318-105266340 CAGGAAAAAATTATGGAGAATGG + Intergenic
959430140 3:106244029-106244051 CAGGGAAAAAGGATGGGGAATGG - Intergenic
959952998 3:112202178-112202200 CAGAAAAAAATGATGGATGAGGG + Intronic
959970245 3:112400923-112400945 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
961275152 3:125720558-125720580 GAAGGACAAGTGATGGAGGAAGG + Intergenic
961278069 3:125743181-125743203 GAAGGACAAGTGATGGAGGAAGG + Intergenic
961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG + Intergenic
961678638 3:128583949-128583971 CAGGGAAAAAGGATGTAGCAAGG - Intergenic
961876342 3:130026475-130026497 GAAGGACAAGTGATGGAGGAAGG - Intergenic
963263558 3:143216725-143216747 AAGGGAGAAATGATGAAGGAAGG - Intergenic
963405879 3:144863347-144863369 CAGTGAGAATTGATTGAGGTAGG - Intergenic
963512706 3:146268837-146268859 AAGTAAAAATTGATGGAGGGAGG - Intergenic
963684740 3:148419565-148419587 CAGCGAAAATTTTTGGAGGGTGG - Intergenic
964553259 3:157908689-157908711 CAGGAAAAATTGGAGGTGGAGGG + Intergenic
966846160 3:184131694-184131716 CATGGAAAATTGATCGAAGTTGG - Intergenic
967234255 3:187368849-187368871 AAGGGAAAATTTATGGAATAGGG - Intronic
968301008 3:197614628-197614650 AAGAGAAAATAGGTGGAGGAAGG + Intergenic
968444667 4:645056-645078 CAAGGAAAATTGTTGGTGGAAGG - Intronic
968448048 4:662335-662357 CAGGGCAGAAGGATGGAGGAGGG + Intronic
968817195 4:2828270-2828292 CAGGGAAAATGGAAGGATCAAGG - Intronic
968881974 4:3305615-3305637 GAGGGAAAATGGAGGCAGGAAGG + Intronic
968988612 4:3893681-3893703 GAAGGACAAGTGATGGAGGAAGG - Intergenic
969019594 4:4130924-4130946 GAAGGACAAGTGATGGAGGAAGG - Intergenic
969024297 4:4161324-4161346 GAAGGACAAGTGATGGAGGAAGG - Intergenic
969025205 4:4167270-4167292 GAAGGACAACTGATGGAGGAAGG - Intergenic
969108974 4:4829462-4829484 CAGGGAAAATGCAGGGAAGAGGG - Intergenic
969339169 4:6529625-6529647 CAGGGAAGAGGGATGGGGGATGG - Intronic
969729520 4:8945840-8945862 GAAGGACAAGTGATGGAGGAAGG + Intergenic
969789106 4:9479780-9479802 GAAGGACAAGTGATGGAGGAAGG + Intergenic
969793844 4:9510548-9510570 GAAGGACAAGTGATGGAGGAAGG + Intergenic
970607243 4:17692189-17692211 GAGGGAGAAGTGAAGGAGGAGGG + Intronic
972842451 4:42947307-42947329 CAGGGAAAACTTAGGGACGAGGG + Intronic
973139541 4:46749404-46749426 TTGGGAAAATAGATGGAGGATGG - Intronic
973276822 4:48319071-48319093 CAGGGAAAATTAATAGATTAAGG - Intergenic
973961176 4:56111358-56111380 TAGGAAAAAGGGATGGAGGAGGG + Intergenic
975340879 4:73238598-73238620 CAGAGAGAAATGATGGAGTAAGG - Intronic
975621402 4:76300229-76300251 GAGGGAAATATGAGGGAGGAAGG - Intronic
976268819 4:83209979-83210001 CAGTGAATATTGATGGAGTGAGG - Intergenic
976554467 4:86433771-86433793 AAGGGAGCATTGAAGGAGGAAGG + Intronic
976898679 4:90144257-90144279 CAGGGAAACTTGATTGTGGAAGG + Intronic
978957989 4:114638520-114638542 CAAGGAAAACAGATGGAGGGAGG - Intronic
979211855 4:118114240-118114262 TAGGGAAAACTGAAGGATGAAGG - Intronic
979522106 4:121679440-121679462 AAGGAACAATTGAGGGAGGAAGG - Intronic
980182727 4:129421912-129421934 CAGCGAAATCTGATGGATGAAGG + Intergenic
980269271 4:130563416-130563438 CAGGAAAAATTGAAGGAAAATGG - Intergenic
981616885 4:146651806-146651828 AGGGGAAAATGGAAGGAGGAAGG - Intergenic
982863066 4:160478487-160478509 CATGGAAAATTGACGTAGCAAGG + Intergenic
983281010 4:165680862-165680884 CAGGGGATAGTGATGAAGGACGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985200139 4:187476166-187476188 CAGGGGAAATTGAGGGTGCAGGG + Intergenic
986241216 5:5961575-5961597 CAAGGCAAATTCATGGAGGTGGG + Intergenic
986858219 5:11896985-11897007 CATGGAAGGTTGATGCAGGAAGG - Intronic
987162151 5:15155616-15155638 CAGGAAGAATTCCTGGAGGAAGG + Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988586052 5:32508526-32508548 CAGGAAAAATTTGTGAAGGAGGG + Intergenic
989069647 5:37497233-37497255 AAGGGAAAAGGGAGGGAGGAGGG - Intronic
989069658 5:37497260-37497282 GAGGGAAAAGGGAGGGAGGAAGG - Intronic
989195963 5:38716601-38716623 CAGGGAGAATTGAGGGATGCTGG + Intergenic
990496770 5:56355970-56355992 CTGGGAAGATTCATGGAAGAGGG - Intergenic
990537290 5:56735271-56735293 CATGGAATATTCATGGAGTATGG + Intergenic
991563375 5:67978901-67978923 CTGGGTAAATTGGAGGAGGAGGG - Intergenic
992962563 5:81971164-81971186 CAGGGCAAAGGGCTGGAGGAAGG - Intergenic
993132496 5:83916715-83916737 CATGTAAAATTGATGGAAAATGG + Intergenic
994030526 5:95136530-95136552 CAGGGAAAATTCAAGGGGGAGGG + Intronic
994104847 5:95936077-95936099 CAGGGTACATTGATGAAGTATGG + Intronic
994425582 5:99581237-99581259 CAGGGGAAATTGATAGAAGAAGG - Intergenic
994435759 5:99731004-99731026 CAGGGGAAATTGATAGAAGAAGG + Intergenic
995377503 5:111492684-111492706 CAGGGAAAATTGTTCCTGGAGGG - Exonic
995671949 5:114615068-114615090 AAGAGAAAACTGATGGGGGAGGG + Intergenic
997415490 5:133724974-133724996 CAAGGTAATTTGATGGAGAAAGG - Intergenic
997447350 5:133951416-133951438 CAGGGAGCATGGATGGAGGCAGG - Intergenic
997580775 5:135015472-135015494 CCGGGAAAATGGAGGGAAGAAGG + Intergenic
997893186 5:137693449-137693471 TAGGGAAAATTGATAGAGGTTGG - Intronic
999019770 5:148152332-148152354 CAGGAAAATATGATGGAGGTGGG + Intergenic
999521990 5:152360094-152360116 TAGGGAAAATTGAGGGAGCAGGG + Intergenic
1000137799 5:158369569-158369591 TAAGAAAAAGTGATGGAGGAAGG - Intergenic
1000259926 5:159578018-159578040 AAAGGAAAATTGCTGGTGGAGGG + Intergenic
1000465822 5:161575045-161575067 AAAGGCAATTTGATGGAGGAAGG + Intronic
1000688032 5:164277501-164277523 AAGAGAAAATTGATGGATGCAGG - Intergenic
1000857893 5:166422278-166422300 CAGGTCAAATTGCTGTAGGATGG + Intergenic
1000912996 5:167044935-167044957 CAGAGAAAATGGAGGGAGCAAGG + Intergenic
1002099925 5:176852443-176852465 CAGGGAAAACTGGGGAAGGAAGG - Intronic
1002828699 6:798525-798547 CAGGAAAAATGAATGGAGAAAGG - Intergenic
1003381443 6:5628257-5628279 CAGGGAAAATTTCTGAAGGAAGG + Intronic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1004961225 6:20790961-20790983 AAAGTAAAATTGGTGGAGGAGGG + Intronic
1006113383 6:31762262-31762284 AAGGGCAAAGTGCTGGAGGAAGG - Intronic
1006518467 6:34557427-34557449 CAGAGAAGGTTGAGGGAGGATGG + Intergenic
1008288837 6:49687616-49687638 TGGGGAAAATTCATAGAGGAGGG + Intergenic
1009668664 6:66716364-66716386 CAAGAAAATTTGATGGAGAACGG + Intergenic
1009725217 6:67529666-67529688 AAGGGAGAAATGATGTAGGAGGG - Intergenic
1010919951 6:81668947-81668969 CAGGGACATTTTCTGGAGGAAGG - Intronic
1012056924 6:94424934-94424956 AAAGGAAAATGGAAGGAGGAAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1013478983 6:110536072-110536094 CAGGGAAAATGGTTGGATCAGGG + Intergenic
1013858212 6:114601588-114601610 CAAGGTAAATTGAGGGAGGCAGG + Intergenic
1014211067 6:118708771-118708793 TAGGGAAAAGGGAGGGAGGAAGG - Intronic
1014777812 6:125530565-125530587 CCAGGAAAATTGATGAAAGAGGG - Intergenic
1015746145 6:136511903-136511925 CAAGGAAAAATGATGGTAGAAGG + Intronic
1016928193 6:149374798-149374820 CAGGGGAAATTGATTGACCACGG + Intronic
1019485046 7:1285563-1285585 CAGGGACAACTGGGGGAGGAGGG - Intergenic
1019575914 7:1737584-1737606 CAGGGAACGTTGAAGGTGGAGGG - Intronic
1019952238 7:4383071-4383093 CAGGGAAAACTAATGCGGGAGGG - Intergenic
1020306974 7:6842939-6842961 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1020311459 7:6871795-6871817 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1020704640 7:11528952-11528974 CAGGGAATATTGCTGTAGAAAGG - Intronic
1020720404 7:11737399-11737421 CAGGCAGAATGGATGGAGTAAGG + Intronic
1021642860 7:22756911-22756933 GAGGTAAAATTGATGAGGGATGG + Intergenic
1022361609 7:29665046-29665068 AAGAGAAAAATAATGGAGGAAGG + Intergenic
1023313026 7:38907133-38907155 TAGGGAAAAATAATGCAGGAAGG + Intronic
1024851981 7:53729568-53729590 CAGGGCAAATGGTGGGAGGAGGG - Intergenic
1025280086 7:57620551-57620573 AAAGGAAAAGTGAAGGAGGATGG - Intergenic
1025304647 7:57844950-57844972 AAAGGAAAAGTGAAGGAGGATGG + Intergenic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1026830423 7:73607058-73607080 GGGGGGAAAGTGATGGAGGATGG - Intronic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1029078133 7:97951887-97951909 GAGGGACAAGTGATGGAAGAAGG - Intergenic
1029897456 7:103999174-103999196 CAGGAAAAAATGAAGGAGCATGG - Intergenic
1031079409 7:117243629-117243651 GAAGGAAAATGGAAGGAGGAAGG + Intergenic
1031431918 7:121682324-121682346 CAGTGCAAACTGATTGAGGAAGG + Intergenic
1032598758 7:133270542-133270564 AAGGGAAATTTTATGGAAGAAGG + Intronic
1032738160 7:134711865-134711887 CAGGCAAGGTTGGTGGAGGAGGG + Intergenic
1033018753 7:137699781-137699803 CAGGTGAAATTGAAGGGGGAAGG - Intronic
1034408921 7:150927316-150927338 CAAAGAAAATTGATAGATGATGG + Intergenic
1034866409 7:154646113-154646135 TAGGGAAATTTGATGAAGGGTGG - Intronic
1035517795 8:251268-251290 CAGGGAATAGTGGTGGAGGAGGG + Intergenic
1036239877 8:7072620-7072642 GAAGGACAAGTGATGGAGGAAGG + Intergenic
1036262004 8:7248547-7248569 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1036304587 8:7591011-7591033 GAAGGACAAGTGATGGAGGAAGG + Intergenic
1036314043 8:7707086-7707108 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1036355438 8:8039003-8039025 GAAGGACAAGTGATGGAGGAAGG + Intergenic
1036820136 8:11933614-11933636 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1036833304 8:12038539-12038561 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1036855150 8:12285104-12285126 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1036903465 8:12688957-12688979 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1036905954 8:12708624-12708646 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1037170693 8:15887886-15887908 CAGAGAAAATGGAGGGAGGGAGG + Intergenic
1037529894 8:19762863-19762885 CAGGGAAAATAGCCTGAGGAAGG + Intergenic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1038427590 8:27474301-27474323 CTGGGGAAATTGATGCAGGCAGG - Intronic
1038669792 8:29573608-29573630 CAGGGAAAATCTTTGGAGGAAGG - Intergenic
1040669246 8:49668132-49668154 CAAGGAAATTTCATGGAGAAAGG - Intergenic
1041990288 8:63980239-63980261 AAGGGAAAAAAGATGGGGGATGG - Intergenic
1042478218 8:69274233-69274255 GAGTGAAAAATGGTGGAGGAGGG + Intergenic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043920647 8:85979649-85979671 TAGAGAAAATTGATGGTTGAAGG + Intergenic
1043950310 8:86301597-86301619 CATGGCAAATTAGTGGAGGAAGG + Intronic
1046645461 8:116781219-116781241 CAGTGAGAAATAATGGAGGATGG - Intronic
1046893765 8:119450809-119450831 CAGGGAGAATACATGGAGCAAGG - Intergenic
1046912754 8:119646849-119646871 CAGGGAAATTAGGTGGAGAAGGG - Intronic
1047869144 8:129063086-129063108 TATGGAAACTTCATGGAGGAAGG - Intergenic
1047891267 8:129313782-129313804 CAGGGAAAAATGATCTAAGAGGG - Intergenic
1048161411 8:132025014-132025036 CAGGCAAACTTTCTGGAGGAGGG - Intronic
1049813534 8:144587111-144587133 CAGGGAACAATCATGGTGGAAGG - Intronic
1049814411 8:144591505-144591527 CAGGGAACAATCATGGTGGAAGG - Intronic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1052346158 9:27411908-27411930 TAGGGGAAATTGTGGGAGGAAGG + Intronic
1052502984 9:29316826-29316848 CAGGGACAAGAGATGGAGCAGGG + Intergenic
1052629338 9:31017621-31017643 AAGGGATGATTGGTGGAGGAGGG + Intergenic
1053317462 9:37064116-37064138 GAGGGAAAAGGGAGGGAGGAAGG - Intergenic
1053791840 9:41692043-41692065 AAGGGAGAATTGATAAAGGAGGG + Intergenic
1054153313 9:61622722-61622744 AAGGGAGAATTGATAAAGGAGGG - Intergenic
1054180245 9:61904062-61904084 AAGGGAGAATTGATAAAGGAGGG + Intergenic
1054473110 9:65553926-65553948 AAGGGAGAATTGATAAAGGAGGG - Intergenic
1054657347 9:67677080-67677102 AAGGGAGAATTGATAAAGGAGGG - Intergenic
1054726198 9:68653137-68653159 CATGGAAACTTGGTGGGGGAGGG + Intergenic
1056372513 9:85971464-85971486 TAGGGAACAGTTATGGAGGAGGG - Intronic
1057147907 9:92770769-92770791 CAGGGAACAGTGAGGAAGGAGGG - Intergenic
1057940984 9:99284109-99284131 CATGGAACAGTGAGGGAGGAAGG - Intergenic
1058422904 9:104850082-104850104 CACGGCAAAATGATGGATGATGG + Intronic
1059152921 9:111965517-111965539 AAGGGAATATTTATGGTGGATGG - Intergenic
1059208964 9:112493423-112493445 CTGGGAAAATGGATGGAAGGTGG - Intronic
1059603595 9:115808782-115808804 CAAGGAAAATGGATGGAGGTGGG + Intergenic
1061244746 9:129395700-129395722 GATGGAGAATGGATGGAGGATGG + Intergenic
1186370951 X:8946875-8946897 GGGGGAAACTTGATGGAGGGTGG - Intergenic
1186798226 X:13066993-13067015 GAGGGAAACTTCCTGGAGGAAGG + Intergenic
1187017896 X:15348643-15348665 CAGGGAAAAGGGATGGCAGAAGG - Intronic
1189659897 X:43285962-43285984 CAGGGAAAGTGCATGGAGGCTGG - Intergenic
1189719386 X:43899740-43899762 CAGGGAACAGTAATGGAGGCTGG + Intergenic
1190000828 X:46685002-46685024 CAGAGACAAGTGATGGAGGGTGG - Intronic
1190219563 X:48502651-48502673 CAGGGTAAATTGCTGGAAGTGGG + Intergenic
1190466216 X:50727047-50727069 CAGGGCATAGTGATGCAGGAGGG - Intronic
1192476234 X:71445506-71445528 CAGGGCAATTCAATGGAGGAAGG - Intronic
1192634321 X:72803621-72803643 TGGGGAAAATTAGTGGAGGAGGG - Intronic
1192647389 X:72917180-72917202 TGGGGAAAATTAGTGGAGGAGGG + Intronic
1194123496 X:89987865-89987887 GAGGGAAAATTGATGGCAGCAGG - Intergenic
1194555810 X:95357316-95357338 CAAGGAGAGTTCATGGAGGAAGG - Intergenic
1194884878 X:99301715-99301737 CAGGGTTATGTGATGGAGGATGG + Intergenic
1194890731 X:99374975-99374997 CAGGGATACTTGATGGAGTGAGG + Intergenic
1195172986 X:102286756-102286778 CATTGAAAATGGATGGAGGAAGG - Intergenic
1195185880 X:102400339-102400361 CATTGAAAATGGATGGAGGAAGG + Intronic
1195343417 X:103926302-103926324 GTGGGAAAATGGATGGAGCAGGG + Intronic
1195476860 X:105297053-105297075 CAGGGAAAAGGGATGGAGATTGG + Intronic
1196069628 X:111506379-111506401 AAGGGACCATTGATGGATGAAGG - Intergenic
1196113579 X:111973210-111973232 CAGTGGAAATAGATGTAGGAGGG - Intronic
1197706593 X:129638880-129638902 CAGGGAGGATTCATGGGGGAGGG + Intergenic
1198296621 X:135293474-135293496 CAGGGTGAATTGATGGTGGTGGG - Intronic
1198324002 X:135548982-135549004 CATGGAATTTTGATGGTGGATGG + Intronic
1198670467 X:139074867-139074889 AAGGGAAAATTCCTGAAGGAAGG - Intronic
1198890336 X:141387828-141387850 CAGGGGGAGTTGAAGGAGGAGGG - Intergenic
1200301788 X:154983840-154983862 CAGAGACAAATGAGGGAGGAAGG - Intronic
1200351932 X:155506168-155506190 CATGAAAAATTAATGGAAGAGGG + Intronic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1200476381 Y:3645482-3645504 GAGGGAAAATTGATGGCAGCAGG - Intergenic
1202109623 Y:21406342-21406364 CTGGGAAAATCCCTGGAGGAAGG + Intergenic