ID: 915369836

View in Genome Browser
Species Human (GRCh38)
Location 1:155339526-155339548
Sequence CAAAATGCTGATAATCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 307}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915369836_915369839 -2 Left 915369836 1:155339526-155339548 CCACAATGATTATCAGCATTTTG 0: 1
1: 0
2: 4
3: 41
4: 307
Right 915369839 1:155339547-155339569 TGTGCTCCCAGGATGACAATGGG 0: 1
1: 0
2: 0
3: 6
4: 140
915369836_915369840 1 Left 915369836 1:155339526-155339548 CCACAATGATTATCAGCATTTTG 0: 1
1: 0
2: 4
3: 41
4: 307
Right 915369840 1:155339550-155339572 GCTCCCAGGATGACAATGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 171
915369836_915369838 -3 Left 915369836 1:155339526-155339548 CCACAATGATTATCAGCATTTTG 0: 1
1: 0
2: 4
3: 41
4: 307
Right 915369838 1:155339546-155339568 TTGTGCTCCCAGGATGACAATGG 0: 1
1: 0
2: 0
3: 6
4: 170
915369836_915369841 2 Left 915369836 1:155339526-155339548 CCACAATGATTATCAGCATTTTG 0: 1
1: 0
2: 4
3: 41
4: 307
Right 915369841 1:155339551-155339573 CTCCCAGGATGACAATGGGAGGG 0: 1
1: 0
2: 0
3: 25
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915369836 Original CRISPR CAAAATGCTGATAATCATTG TGG (reversed) Intronic
908603324 1:65765024-65765046 CTAAATCCTGATAAGAATTGAGG + Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909197108 1:72641379-72641401 CACAATTATGAAAATCATTGAGG + Intergenic
909915577 1:81314051-81314073 CAAAATGCTGATTATCTGTCAGG + Intronic
910229703 1:84973586-84973608 GAATATGCTGAAAATCAATGGGG - Intronic
910395283 1:86787128-86787150 CAGAAAGCTTATAATCATGGTGG - Intergenic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911797879 1:102097184-102097206 GAAAAGGCTGATGATCATTCTGG - Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
915087982 1:153401275-153401297 CAAAATTCTGATAAACATTAAGG - Intergenic
915369836 1:155339526-155339548 CAAAATGCTGATAATCATTGTGG - Intronic
917285396 1:173417215-173417237 CGCAAAGCTGATAATCAGTGGGG - Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
919717401 1:200793136-200793158 CAAACTGCTGATCATTGTTGGGG - Intronic
921653778 1:217709761-217709783 CAAAATGCTGAAAATCAACATGG - Intronic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
923583334 1:235240103-235240125 CAAAATCTTGATAATCTTAGAGG - Intronic
923662760 1:235972672-235972694 CAAAATGCTGATCGTTGTTGTGG - Intergenic
1063061621 10:2561286-2561308 GAAAATGCTAAAAATCAATGAGG - Intergenic
1065085098 10:22165993-22166015 CAAAATGATAAAAATCCTTGTGG + Intergenic
1065110063 10:22431965-22431987 AAAAATGTTGATAATTGTTGAGG - Intronic
1065166188 10:22980175-22980197 AAAAATGCTGATAATAATTTAGG - Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1069117328 10:64523895-64523917 CACAATGCTGAAAATCACTGTGG + Intergenic
1070255486 10:74810093-74810115 CAAAATGTTGATAATGTTTGCGG + Intergenic
1071088112 10:81887800-81887822 CAAGATGGTGATTATCTTTGGGG + Intronic
1071409954 10:85379400-85379422 CAAGATACTGATAATCCTTTTGG - Intergenic
1071768183 10:88692839-88692861 CCATATGCTAATAATTATTGAGG - Intergenic
1072089491 10:92113502-92113524 CAATATGCTTATGATCTTTGTGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073152200 10:101319735-101319757 CAAAATGCTGATAAGCCTGTGGG + Intergenic
1073929503 10:108558023-108558045 CTAAATGCTGATGAGCATTTTGG + Intergenic
1075546261 10:123357294-123357316 CAAAATGCTCAAAACCATTAAGG - Intergenic
1078262024 11:9718738-9718760 CAAAATGCAAATGATCATTACGG - Intronic
1079461355 11:20681360-20681382 CAAAATGCAGATAAGCTTTCTGG + Intronic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1079916075 11:26370328-26370350 CAGGAAGCTTATAATCATTGTGG - Intronic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080913212 11:36626771-36626793 AGAAATGCTGATGCTCATTGAGG - Intronic
1082177372 11:49076695-49076717 CAAAATGCTAATGATGATGGTGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1085779965 11:79399144-79399166 AAAAATGCTGGGAATCATTTGGG - Intronic
1086688346 11:89759143-89759165 CAAAATGCTAATGATGATGGTGG + Intergenic
1086717514 11:90080802-90080824 CAAAATGCTAATGATGATGGTGG - Intergenic
1086913695 11:92502752-92502774 CAAAAGGATGCTAACCATTGAGG + Intronic
1087029525 11:93688963-93688985 CAAAAAGCTTATAGTCATTCTGG + Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088604813 11:111518504-111518526 CCAAATGGTGATAATCATAATGG - Intronic
1092925962 12:13272498-13272520 CATAATGCTGAAAATAATTCTGG - Intergenic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094584453 12:31764937-31764959 CTCAATGCTGCTAATCATTAGGG + Intergenic
1094738176 12:33259101-33259123 CAAAATGCTGTTAGTGAATGTGG + Intergenic
1095269582 12:40201784-40201806 CAAAATTCTGATAATTATTCTGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095877346 12:47096017-47096039 GAAAATGCTTACAATAATTGAGG + Intronic
1096327294 12:50675590-50675612 TAAAATACAGATAATCATTAGGG - Intronic
1097566892 12:61281453-61281475 CAAAATTCATATAAACATTGAGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1101852121 12:108411751-108411773 CAAAATGAAGATAATAATAGTGG + Intergenic
1103859119 12:123997824-123997846 CCAAGTGCTGATACTCATTCCGG - Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105338235 13:19495030-19495052 AAAAATGCTGTTACACATTGAGG - Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1108634370 13:52317925-52317947 AAAAATGCTGTTATACATTGAGG - Intergenic
1108709007 13:53015275-53015297 CTAGTTGCTGATAAGCATTGTGG + Intergenic
1108736005 13:53283843-53283865 CTAAATGCTGATAATTTTGGGGG + Intergenic
1109487254 13:63042444-63042466 AAAAATGCTGATAGTCTTTATGG + Intergenic
1109530103 13:63631671-63631693 GAAAATGCTAATAAACAGTGTGG + Intergenic
1109594887 13:64538373-64538395 CAAAATGCTGATATTAAAGGTGG - Intergenic
1110477642 13:75936005-75936027 CAACATGCTAATAAGCATAGTGG + Intergenic
1110694105 13:78467192-78467214 CAAAATACTAATATTCCTTGTGG + Intergenic
1110822759 13:79935673-79935695 GAAAATGCTGATAATCATAATGG - Intergenic
1113233538 13:108242135-108242157 CAAAATGCTGCTGATGATCGAGG - Intergenic
1113465682 13:110511411-110511433 GAAAATGCTGATGATCAGGGAGG - Intronic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1114997942 14:28381366-28381388 CTAAATGCTGAAAAACAATGTGG - Intergenic
1115080031 14:29439042-29439064 TAAAATGCTGCTAGTCTTTGTGG - Intergenic
1115208052 14:30934403-30934425 CAACATGCTGATATTAAATGAGG + Intronic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117000954 14:51370744-51370766 CAAGAAGCTTACAATCATTGTGG + Intergenic
1117888276 14:60388617-60388639 CAAGAAGCTTATAGTCATTGTGG - Intergenic
1118177353 14:63454923-63454945 CAAAATAGAGACAATCATTGAGG + Intronic
1118487339 14:66226306-66226328 CAAAGTGCTCATAAATATTGGGG - Intergenic
1119412042 14:74438538-74438560 CAAATTGCTAATAATTATTGAGG + Intergenic
1120560219 14:85982788-85982810 GCAAATGCTGATAATTACTGTGG - Intergenic
1120643032 14:87038389-87038411 CAAAGACCTGATAATCACTGTGG - Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120790678 14:88578547-88578569 CAAAATTCTGATAATAACTAAGG - Intronic
1121468519 14:94132281-94132303 CAAAAAGCTCATAATTATTTAGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1124173680 15:27402386-27402408 TAAAATGCTGATATCCATAGAGG - Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127369841 15:58329586-58329608 CAAAAAAATGATAATCTTTGAGG + Intronic
1127718851 15:61680060-61680082 CAGATTGCTGATATTCATAGAGG - Intergenic
1130021611 15:80236090-80236112 CAAAAGGCTGAGCATCACTGGGG - Intergenic
1130694226 15:86113952-86113974 GAAAATACTGATAATTACTGTGG + Intergenic
1131368319 15:91858408-91858430 CAAAATGTTAATAATTATTAAGG + Intronic
1133092746 16:3417314-3417336 CAAAATGCTGATAAGTGTGGTGG + Intronic
1135346904 16:21696486-21696508 TAACATGGTGATAATCAGTGAGG + Intronic
1135744850 16:25008149-25008171 CAAAATGGTGATAGGGATTGTGG - Intronic
1137651148 16:50121644-50121666 CAAAATGATTATAATCAGGGTGG - Intergenic
1138735344 16:59244455-59244477 AAAAGGGCTTATAATCATTGGGG + Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1140348535 16:74238913-74238935 CAAATTGCTGATATTCCTTCGGG - Intergenic
1142017961 16:87761592-87761614 CAGAAAGCTGAAAATCACTGTGG - Intronic
1143287896 17:5804744-5804766 CATAATGCTGATTATCGTTTTGG + Intronic
1143678590 17:8458003-8458025 CAAAATGCTAACAATAAATGGGG - Intronic
1146099326 17:29963997-29964019 CAAGAAGCTTATAATCATGGTGG - Intronic
1148241166 17:46000225-46000247 CAGATTGCTGCAAATCATTGGGG + Intronic
1148281500 17:46351490-46351512 CAAAATGCTTATAACTGTTGAGG + Intronic
1148303725 17:46569429-46569451 CAAAATGCTTATAACTGTTGAGG + Intronic
1149216291 17:54358184-54358206 CAAAATGCTGATAAGCATTATGG - Intergenic
1149308571 17:55372602-55372624 CAAAATACTGATAATGAATATGG + Intergenic
1149523222 17:57334267-57334289 CAAAATGCTGATAAAATCTGAGG + Intronic
1151075149 17:71263285-71263307 CCAAATGCTTCTAATCATAGTGG + Intergenic
1151085650 17:71377570-71377592 CAATTTGCTGAGAATTATTGAGG + Intergenic
1151755177 17:76071070-76071092 CTAAATGCTGACTATAATTGGGG + Intronic
1153342715 18:3992074-3992096 AAAAATGCTGTTACTCTTTGTGG + Intronic
1155103354 18:22636358-22636380 CAAAATTCTAATAATGGTTGTGG + Intergenic
1155118237 18:22791826-22791848 AAAAATGCTCAGAATCCTTGAGG - Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156278240 18:35605722-35605744 CAAAATGTTGATAATTACTGAGG - Intronic
1158748879 18:60235469-60235491 AAAAATGCTGAAAAGCATTTTGG - Intergenic
1164103464 19:22080497-22080519 CAAAAAGCTTACAATCATGGTGG - Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
927077379 2:19593010-19593032 CACAGTGCTGATAATCTTTCAGG - Intergenic
928591913 2:32825978-32826000 GAAAATGCTAATAAACATTTTGG - Intergenic
929664439 2:43822805-43822827 CACACTGCTGAAAATCATGGTGG + Exonic
929686778 2:44041969-44041991 CCAAATGTTGATAATGATTGAGG - Intergenic
930221599 2:48751884-48751906 GAAAATGCTAATAATAATTATGG - Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
931045656 2:58349754-58349776 CAAAATGTTGATAATGTTGGGGG - Intergenic
931142271 2:59475147-59475169 CAAAATGATGATTCTCATTAGGG - Intergenic
932128849 2:69169317-69169339 CAAAATTCTGATAATAAGTTTGG + Intronic
933209593 2:79551717-79551739 CAAAAAGCTTACAATCATGGTGG + Intronic
935434980 2:103020837-103020859 CAAAACTCTTATAAACATTGTGG + Intergenic
935792355 2:106604712-106604734 TAAAATACTGAGAATCATTTCGG + Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
940094294 2:149956617-149956639 CAAATTGCTGATGATGACTGAGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
941035593 2:160565469-160565491 AAAAATGCTCAAAATCACTGGGG + Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
944317916 2:198303179-198303201 GAAAATGAGGATAAACATTGTGG - Intronic
945368021 2:208980062-208980084 CAGAAAGCTTATATTCATTGTGG - Intergenic
945477735 2:210305369-210305391 AAAAATGCTTTGAATCATTGGGG + Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
947282485 2:228470747-228470769 AAAAATGGTGACGATCATTGTGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1169847742 20:10013913-10013935 CAAAATGCTTAAAATCTTAGAGG - Intronic
1169892958 20:10473507-10473529 ATAAATATTGATAATCATTGTGG + Intronic
1170244423 20:14204859-14204881 AAAAATGATAATAATAATTGAGG - Intronic
1171070292 20:22061947-22061969 CAAACTGCTGTTAGTCTTTGGGG + Intergenic
1171226452 20:23445576-23445598 CAGAATGTTCATAATCATTGGGG + Intergenic
1173105337 20:40128263-40128285 TACAATCATGATAATCATTGAGG - Intergenic
1173422150 20:42910882-42910904 CAAAAAACTTATAATCATGGTGG + Intronic
1173724482 20:45287819-45287841 CACTATGCAGATAATAATTGAGG - Intergenic
1174944122 20:54966113-54966135 CAAGATACTGAAAATCATTGAGG - Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177902418 21:26933293-26933315 CCAAAAGGTGATAATCTTTGTGG - Intronic
1177946826 21:27480819-27480841 CAAAATGATCAGAAACATTGGGG - Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1181663306 22:24370284-24370306 AAAAGTCATGATAATCATTGAGG + Intronic
1181879769 22:25968894-25968916 CAAATGGCTGATAGTCATGGTGG + Intronic
1181992010 22:26844267-26844289 CGAAATGCCCATGATCATTGTGG - Intergenic
949409708 3:3750063-3750085 CAAAATGCTGACCATAATGGAGG + Intronic
950328277 3:12134260-12134282 TAAAATGTTGATGATTATTGTGG + Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
953122476 3:40058691-40058713 CAAAATGGTGATTATCTCTGGGG - Intronic
953684961 3:45070288-45070310 TAAAGTGCTGATAATTGTTGAGG + Intergenic
955074108 3:55596858-55596880 TAAAATCCTCATAATCATTATGG - Intronic
955554142 3:60118001-60118023 CAAAATGCTGATGATCCAAGCGG + Intronic
955838967 3:63091121-63091143 TAAAATAGTGATAATCATAGGGG - Intergenic
956607638 3:71089112-71089134 CCAAATGGTGAGAATCTTTGGGG - Intronic
956727884 3:72171429-72171451 CAAGGTGCTGATGCTCATTGTGG + Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959225365 3:103575304-103575326 AAAAATGGTGATAGTCATTTAGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959260350 3:104071607-104071629 CAAAATGCTGATAAAAATCCAGG + Intergenic
959644677 3:108684401-108684423 CAAAATGAAGATACTCATTCAGG - Intronic
959919859 3:111858727-111858749 CAAACTACTTATGATCATTGTGG - Intronic
960830192 3:121838058-121838080 TAAACTGATGATAATAATTGTGG + Intronic
962546896 3:136445937-136445959 TAAAATGCAGATTATCATTTGGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963378636 3:144502192-144502214 TAAAATGCAAATTATCATTGTGG + Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
966759136 3:183400738-183400760 AAAAATTCTGATTCTCATTGAGG - Intronic
969086660 4:4661826-4661848 CACAATGCTGCTATCCATTGTGG - Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970356613 4:15260029-15260051 CAAATTGCTGTTAAACATTCAGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971910159 4:32785217-32785239 AAAAAGGCAGAAAATCATTGGGG + Intergenic
972118003 4:35662698-35662720 CACATGGCTCATAATCATTGTGG - Intergenic
972155194 4:36152592-36152614 CAACCTGCTGATTATCATTTTGG - Intronic
972872366 4:43315205-43315227 CAAAGAGATAATAATCATTGTGG - Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974096277 4:57367962-57367984 AAAAATGTTGATAATTTTTGAGG + Intergenic
974295243 4:59989677-59989699 TTAAACGCTGATAATAATTGGGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975112205 4:70640788-70640810 CAACATGCTGCTAAACAGTGGGG - Intronic
976871860 4:89803829-89803851 CAGAAAGCTTATAATCATGGTGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978182848 4:105822041-105822063 GAAAATCCTGATAATCTTTTTGG - Intronic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
980294407 4:130892080-130892102 CAAGAAGCTTACAATCATTGTGG - Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981821088 4:148888350-148888372 CAGAAAGCTTATAATCATGGTGG + Intergenic
983147674 4:164237882-164237904 CAAAATGCTAAAAAAAATTGGGG + Intronic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984454619 4:179948752-179948774 CAAAATTATGCTAATGATTGTGG + Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
987192302 5:15490718-15490740 CTAAATGCTGACACTTATTGGGG + Intergenic
987615805 5:20273019-20273041 CTATATGCTGATAATCATTTAGG + Intronic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988100681 5:26673168-26673190 TAAAATGCTTATACACATTGAGG + Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989127375 5:38069698-38069720 GAAAATACTGATAAGCAATGAGG - Intergenic
989472972 5:41842257-41842279 GATACTGCTAATAATCATTGGGG - Intronic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990629962 5:57657958-57657980 CAAAATGGTAAAAATTATTGTGG + Intergenic
990924563 5:61005686-61005708 AAAAATGCTCATCATCATTGAGG - Intronic
991042214 5:62188014-62188036 CAAAAATCTGAGAAACATTGAGG - Intergenic
991329179 5:65474130-65474152 CATTATGCTGATAACCATTTTGG - Intronic
991538214 5:67696721-67696743 CAAAATTCTAAGAAACATTGAGG - Intergenic
991989464 5:72323231-72323253 CAAAATATTGATAATGATTGAGG + Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993082660 5:83320749-83320771 AAAAATGCTAATAATCATCTGGG - Intronic
993604581 5:89972813-89972835 CAAAATGCTCTTATTTATTGGGG + Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994945193 5:106378880-106378902 CAGAAAGCTGAAAATCATGGTGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995359878 5:111283523-111283545 CAAGCTGCTGATAGCCATTGTGG + Intronic
995625397 5:114070620-114070642 GAGAATACTGATAATCACTGAGG - Intergenic
995657140 5:114439468-114439490 CAAAATGCTGGTCATAATGGTGG + Intronic
995770199 5:115661211-115661233 CAAAACGCTCAGAATGATTGGGG + Intergenic
996268665 5:121576015-121576037 CAACATGCTTGTATTCATTGTGG - Intergenic
997821319 5:137068619-137068641 ACAAATGCTGATAATTGTTGTGG - Intronic
998073131 5:139214499-139214521 CAATATTTTTATAATCATTGGGG + Intronic
999917290 5:156276924-156276946 CAAAATGATGAGCATCCTTGTGG + Intronic
1000363221 5:160467339-160467361 CAAAATGGAGATAATAATTCGGG + Intergenic
1000479085 5:161748633-161748655 AAAAAAGCTGGGAATCATTGAGG + Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000904493 5:166947903-166947925 CAAAATTCTGATAACAAATGAGG - Intergenic
1003460317 6:6322525-6322547 CAAAGTGATGGTATTCATTGAGG - Intergenic
1006565424 6:34952356-34952378 CAGGATGCTGTTAATAATTGTGG + Intronic
1007309342 6:40933191-40933213 CAAAATGCTCCAACTCATTGTGG + Intergenic
1008374173 6:50772508-50772530 CTAAATGATGCTAAGCATTGTGG - Intronic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009841286 6:69078313-69078335 CAAGATGGTGATGATCAGTGGGG - Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010631936 6:78208534-78208556 CAAAAAACTTATAATCATGGTGG + Intergenic
1012015689 6:93847182-93847204 CAAAATGCTGATAGAAATTAAGG + Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1013810677 6:114041290-114041312 CAATGTGCTTATAGTCATTGGGG + Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014048235 6:116919853-116919875 CATAAAGCAGATAATCATTTTGG - Intronic
1014585677 6:123194901-123194923 CAAAATGAAGAAAATAATTGTGG + Intergenic
1014696541 6:124628400-124628422 CATAATGAAGACAATCATTGTGG - Intronic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015657169 6:135532010-135532032 CAAAATGCTGGTACTCTTGGAGG + Intergenic
1015925955 6:138310886-138310908 CTAAATGCTGATGATAAATGAGG - Intronic
1016958141 6:149646967-149646989 CAAGATGCTGACAAATATTGAGG - Intronic
1017431682 6:154377674-154377696 CAAATTGCAGATAATCATTGTGG - Intronic
1017502614 6:155039440-155039462 CAAAATGCTGATGGCCATGGTGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020562935 7:9754190-9754212 CAAAATACTTACAATCATGGTGG + Intergenic
1020571206 7:9864771-9864793 CAAAATGATGATTAATATTGAGG - Intergenic
1021207470 7:17801732-17801754 TCAAATGCTGATACTCATTTAGG - Intronic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024954444 7:54901903-54901925 CAAGTGGCTGATAATCTTTGTGG + Intergenic
1026281206 7:68923221-68923243 AAAAATGGGGATAATTATTGAGG + Intergenic
1028661048 7:93275502-93275524 AAAAATGCTAATAATCATCTGGG - Intronic
1029508344 7:100976611-100976633 AAAAATGCAAATATTCATTGAGG + Intronic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031561393 7:123243042-123243064 CAAAGTCCTGAGAATCATTGAGG + Intergenic
1031808669 7:126338768-126338790 GAAAATGCTAAGAATCATTTTGG - Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1036577115 8:10038382-10038404 CAAAATGCTAAAATTCATTGAGG + Intergenic
1037033099 8:14133625-14133647 CAAAATGGTAAAAATCTTTGAGG - Intronic
1037183847 8:16038130-16038152 TAAAATGCTGTTTATCATTTAGG - Intergenic
1038593729 8:28866362-28866384 CAAAATGGTGACATTTATTGCGG - Intronic
1038834156 8:31100049-31100071 AAGAATGATGATACTCATTGAGG + Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1038891530 8:31730211-31730233 CAAGATTCTGATAATTGTTGAGG + Intronic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1040774004 8:51016695-51016717 AAAAATGCTAATAATCATGTGGG + Intergenic
1042994824 8:74684980-74685002 CTGAAAGCTGACAATCATTGGGG - Intronic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046571603 8:115973137-115973159 AAAAGTGCTGATAATCATATAGG + Intergenic
1046842659 8:118877290-118877312 CAAAATGAAGATAATGAATGAGG + Intergenic
1047527288 8:125644414-125644436 CAAAATGACGATAATAATTCTGG - Intergenic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1051363890 9:16306454-16306476 GAAACTGCTGAAAATCAATGAGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052254189 9:26434478-26434500 TAAATTGCTTATGATCATTGAGG - Intergenic
1052259879 9:26502124-26502146 CAAAATGCTTCTCATCACTGAGG + Intergenic
1052534409 9:29728955-29728977 AAAAATGCTCATCATCACTGGGG + Intergenic
1053194153 9:36102571-36102593 CAAAAGGCTGATAGTCTCTGGGG - Intronic
1054737868 9:68773829-68773851 CAATTTGCAAATAATCATTGAGG - Intronic
1054827583 9:69588684-69588706 CATAATCGTGATCATCATTGTGG - Intronic
1054833057 9:69647428-69647450 CAAAATGCTGATAAACTCTTAGG - Intronic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1057605925 9:96497473-96497495 CAAAATGCCCAAAATCAATGTGG + Intronic
1058072279 9:100613549-100613571 CAAAACGCTAGTAATTATTGAGG - Intergenic
1059292645 9:113240745-113240767 CAAAATGCTGAATTTTATTGAGG + Intronic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059859679 9:118445576-118445598 TAAAATTTTGATAGTCATTGTGG - Intergenic
1060033570 9:120235864-120235886 CAACATGATGATAATGATGGTGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186275830 X:7937313-7937335 CAAAAGGCTCATTATCATTCTGG + Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191600757 X:63002581-63002603 CAAAAAGCTTACAATCATGGTGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192800147 X:74457866-74457888 CAAAATGCTGAACAGCATTAGGG - Intronic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193445507 X:81596938-81596960 CCAAATCCTTCTAATCATTGAGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194341460 X:92711577-92711599 CAGAAAGCTTATAATCATGGTGG + Intergenic
1194483621 X:94458146-94458168 CAAGATGCTGCTACTCTTTGGGG + Intergenic
1195282189 X:103347464-103347486 CATAATGGTGATAATGAATGAGG + Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1198273508 X:135078667-135078689 AAAAATGAGGATAATAATTGAGG - Intergenic
1198274836 X:135090474-135090496 CAAGAAGCTTACAATCATTGTGG - Intergenic
1199264195 X:145811122-145811144 CAAAATGCTGATGATTATTTTGG - Intergenic
1199388998 X:147257723-147257745 CAAAATGCTGATAAGAAGTTGGG + Intergenic
1199472433 X:148209835-148209857 CAAAATACTGATAGTTATTATGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic