ID: 915375773

View in Genome Browser
Species Human (GRCh38)
Location 1:155393905-155393927
Sequence TCCCTGGATTTCCCAGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915375773_915375779 29 Left 915375773 1:155393905-155393927 CCAGGTGCTGGGAAATCCAGGGA 0: 1
1: 0
2: 3
3: 46
4: 291
Right 915375779 1:155393957-155393979 CGGAGATTATAATCTAATGGAGG 0: 1
1: 0
2: 2
3: 41
4: 235
915375773_915375777 26 Left 915375773 1:155393905-155393927 CCAGGTGCTGGGAAATCCAGGGA 0: 1
1: 0
2: 3
3: 46
4: 291
Right 915375777 1:155393954-155393976 TGCCGGAGATTATAATCTAATGG 0: 1
1: 0
2: 0
3: 5
4: 78
915375773_915375775 9 Left 915375773 1:155393905-155393927 CCAGGTGCTGGGAAATCCAGGGA 0: 1
1: 0
2: 3
3: 46
4: 291
Right 915375775 1:155393937-155393959 AGACAATGATCCTGTACTGCCGG 0: 1
1: 0
2: 0
3: 6
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915375773 Original CRISPR TCCCTGGATTTCCCAGCACC TGG (reversed) Intronic
900123463 1:1059321-1059343 TCCCTGTAGGTCCCAGCCCCAGG - Intergenic
900878982 1:5366956-5366978 TCCCTGGATTTCTCAGCCCTTGG - Intergenic
901425693 1:9181368-9181390 TCCCTGGAGTTCCTTGCTCCTGG - Intergenic
903311277 1:22458480-22458502 TCCCTGGACTTCCCTGCTGCTGG + Intronic
904127242 1:28249723-28249745 CCACTGGATTTCCCAGAGCCAGG + Intergenic
904824120 1:33263793-33263815 TCCCTGAATTTCTCACCTCCGGG - Intronic
905240063 1:36575686-36575708 TCCCTGAGTTTCCCAGGACCTGG + Intergenic
905649458 1:39646766-39646788 TCCCTAGCTTTCCCAGGCCCTGG + Intergenic
906151904 1:43592441-43592463 TCCCTGCTCTTCCCAGCACAAGG + Exonic
906691442 1:47795428-47795450 TCCTTGTACTTGCCAGCACCAGG - Intronic
907925234 1:58949693-58949715 TCCCTGGGATTCTGAGCACCTGG + Intergenic
911392735 1:97267458-97267480 ACCTTGGATTTCCCAGCTTCTGG - Intronic
914460868 1:147883752-147883774 TCCCTGGAAATCCCAACAACAGG + Intergenic
915375773 1:155393905-155393927 TCCCTGGATTTCCCAGCACCTGG - Intronic
916074127 1:161190718-161190740 ACCCTGGATTTCCTAGCCCCAGG + Exonic
916117845 1:161502914-161502936 TCCCTTGATTTCCCAAGACTTGG + Intergenic
916285250 1:163099096-163099118 TCCCTGAATTTCCCATCCTCTGG - Intergenic
917931600 1:179826350-179826372 TCCCAGGATGTCCCAGCAAGCGG + Intergenic
918363659 1:183784290-183784312 TTCCTGTATTTCCCAGTATCAGG - Intronic
919814270 1:201427968-201427990 TCCCTGCAGGTCCCAGCACTGGG + Intronic
919835344 1:201569439-201569461 ACACTGGTTTACCCAGCACCAGG + Intergenic
919883153 1:201914213-201914235 TCCCCAGATAGCCCAGCACCTGG - Intronic
920741638 1:208586589-208586611 CCCCAGGCTTTCCCATCACCTGG + Intergenic
922494008 1:226041883-226041905 TCCCTGGGCTGCCGAGCACCTGG - Intergenic
1064167391 10:12998347-12998369 TTCCTGGATTTCCCAGTCACTGG + Exonic
1066076918 10:31888072-31888094 TCCCTGGTCTTCACAGCAGCTGG + Intronic
1066476454 10:35751762-35751784 TCCCTGCCTTTCCAAGCTCCAGG + Intergenic
1066653646 10:37680998-37681020 TCCCCGGCTTTCCCAGGCCCCGG + Intergenic
1067136063 10:43608281-43608303 TCACAGGATTTCTCACCACCTGG - Intronic
1067693715 10:48520545-48520567 TCCCCTCCTTTCCCAGCACCAGG - Intronic
1068186520 10:53593296-53593318 ACCTTGGATTTTCCAGTACCTGG + Intergenic
1068774715 10:60857379-60857401 TCCCTGGATGTCCCACCACAAGG - Intergenic
1068956583 10:62823928-62823950 TACCTGGATTGCCCTGCATCTGG - Intronic
1069960884 10:72078646-72078668 TCCCTGGCTACCCCAGCTCCAGG + Intronic
1071471118 10:85984611-85984633 TCCCAGCATATCCCAGCACCTGG + Intronic
1072563059 10:96594671-96594693 TCCCTGGAATCCCCAGCTTCTGG + Exonic
1073048211 10:100652407-100652429 TGCCTGGATGTCCCACCTCCTGG - Intergenic
1074569600 10:114612379-114612401 ACCTTGGATTTCCCAGCCTCAGG + Intronic
1075127963 10:119715868-119715890 CCCTTGGATTTCCCAGCTCCAGG + Intergenic
1075517052 10:123117842-123117864 TCCCTGGGGGTCCCAGCACCTGG + Intergenic
1076065948 10:127448027-127448049 ACCCAGGAGCTCCCAGCACCAGG - Intronic
1076190525 10:128480080-128480102 GGCCTGGATCTCCCAGCAGCAGG + Intergenic
1076245585 10:128945189-128945211 TCCCTGGGATCCCCAGCATCTGG + Intergenic
1076826521 10:132972288-132972310 TCCCTGGATCCCCCAGGTCCTGG + Intergenic
1078930568 11:15909345-15909367 TTCCTGCATTTCTCAGCTCCTGG - Intergenic
1079394421 11:20049674-20049696 GCCCTGGATTTCTCTGCAGCAGG + Intronic
1081145028 11:39552898-39552920 TCCCTGCTTTTCCCAGCATCTGG + Intergenic
1085789571 11:79485546-79485568 TCTCAGAATTTCTCAGCACCAGG + Intergenic
1086063615 11:82724663-82724685 TCCTTGGCTTTTCCAGCATCAGG + Intergenic
1087312895 11:96570538-96570560 TCCATGCCTTTCCCAGCTCCTGG + Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1088599460 11:111462162-111462184 TCCCAAGATTCCCCAGCCCCAGG + Intergenic
1090656573 11:128850412-128850434 TCCCTGCCTACCCCAGCACCAGG + Intronic
1090790181 11:130085747-130085769 CCCCTGGATCCCCCAGCCCCTGG + Intronic
1091078804 11:132646362-132646384 GCCCTGGATTGCTCAGCACTTGG + Intronic
1091381604 12:65735-65757 TCCCTGGATCTCCAAGCTGCTGG + Intergenic
1092073874 12:5656917-5656939 TGCCTTGATTTCCCAGGACAGGG + Intronic
1096069070 12:48764718-48764740 TCCCAGGACCTCTCAGCACCTGG + Intergenic
1096538851 12:52291865-52291887 TCCCAGTTTCTCCCAGCACCTGG - Intronic
1096578172 12:52567616-52567638 TCCCTGGCTTTCCCAACCCAAGG + Intronic
1097553371 12:61104508-61104530 TCCAAGGCTTCCCCAGCACCAGG - Intergenic
1097840507 12:64316962-64316984 TCCCTGAATTGCCCAGCTTCAGG - Intronic
1098518201 12:71403056-71403078 TCCAGGTCTTTCCCAGCACCAGG + Intronic
1098658727 12:73067367-73067389 ACCCTGGATTTTCCAGTACCTGG + Intergenic
1100198549 12:92274350-92274372 GGCCTGGGTTTCCCAGCAGCAGG - Intergenic
1100853664 12:98739433-98739455 GCGTTGGATTTGCCAGCACCTGG + Intronic
1102150568 12:110687142-110687164 ACCTTGGATTTCCCAGAACCTGG - Intronic
1104606489 12:130193266-130193288 TCCCTGTGTGTCCCCGCACCAGG + Intergenic
1104750703 12:131236258-131236280 TGCCTGGATTCCTCAGCACCTGG - Intergenic
1105494722 13:20920517-20920539 TCCCAGGCTTTTCCTGCACCTGG - Intergenic
1105706002 13:22967742-22967764 TGGCTGGATGTCCCAGCTCCCGG + Intergenic
1108510650 13:51152793-51152815 TCTGTGGATTTCCCAGGACTAGG - Intergenic
1109511883 13:63387500-63387522 TCCCTAAATTTCCCAGCCTCTGG - Intergenic
1110035068 13:70672818-70672840 ACCTTGGATTTTCCAGAACCTGG + Intergenic
1110324809 13:74201692-74201714 AGCCTGGATTTCCCAACTCCTGG - Intergenic
1113226893 13:108169038-108169060 ACCTTGGATTTTCCAGTACCTGG - Intergenic
1113388626 13:109874152-109874174 TTCCTGGTTTCCCCAACACCAGG + Intergenic
1115967900 14:38912465-38912487 GCCTTGGATTTTCCAGTACCTGG - Intergenic
1116937524 14:50757552-50757574 TCCCTGTACTTCCCAGGTCCCGG + Exonic
1117330893 14:54710844-54710866 TATCCGTATTTCCCAGCACCTGG + Intronic
1119891515 14:78186022-78186044 TCCCTGGATTTGGCAGAATCAGG + Intergenic
1119928396 14:78519542-78519564 TCTTTTGCTTTCCCAGCACCAGG - Intronic
1121541113 14:94727390-94727412 TCCCAGCATTTCCAAGCCCCTGG - Intergenic
1121760627 14:96441845-96441867 TCCCTGCACTTCCCACCTCCAGG + Intronic
1122142240 14:99669206-99669228 TCCGTGCCATTCCCAGCACCTGG - Intronic
1123046614 14:105520655-105520677 TCCCCAGTTTTCCCAGCCCCTGG - Intergenic
1125444544 15:39739178-39739200 TCTCTGGACGTCCCAGCAGCTGG - Intronic
1125508523 15:40281083-40281105 TCGCTGGGTTTCCCAACAACTGG - Intronic
1126743053 15:51797584-51797606 TCCCAGAGTTTCCCACCACCAGG - Intronic
1127455642 15:59153970-59153992 TCCCTGTTTTCCCCATCACCGGG + Intronic
1129669977 15:77602207-77602229 TCCCTGGAGGGCCCAGCACAGGG + Intergenic
1129709940 15:77815721-77815743 ACCCAGGTCTTCCCAGCACCTGG + Intronic
1131154213 15:90064983-90065005 TGACTGCATTTCCCAGCAGCTGG + Intronic
1131295310 15:91143046-91143068 TCCCTGGAACTCCCAGCCACTGG - Intronic
1131590111 15:93739965-93739987 ACCTTGGATTTTCCAGTACCTGG + Intergenic
1131844200 15:96471572-96471594 TCCCTCGCTTCCCCAGCTCCAGG + Intergenic
1133119463 16:3597275-3597297 TTCCTGGACTTTCCATCACCTGG + Intronic
1133346233 16:5072315-5072337 GCCCTGGAGTTCCACGCACCTGG - Intronic
1133432566 16:5750908-5750930 TTTCTGAATTTCCCAGTACCGGG - Intergenic
1133642675 16:7732783-7732805 TCCCTTGATTTCCCACCACTCGG - Intergenic
1134361211 16:13532813-13532835 TCCCTGAAGATTCCAGCACCTGG + Intergenic
1134506648 16:14813108-14813130 TCTCTGCATTCCCCAGCACTGGG + Intronic
1134573907 16:15315713-15315735 TCTCTGCATTCCCCAGCACTGGG - Intergenic
1134728510 16:16440604-16440626 TCTCTGCATTCCCCAGCACTGGG + Intergenic
1134916017 16:18071812-18071834 TGCCTTGTTTTCTCAGCACCCGG + Intergenic
1134938931 16:18271314-18271336 TCTCTGCATTCCCCAGCACTGGG - Intergenic
1135210388 16:20521107-20521129 TCCCTGGGTTCCCCAGAACACGG + Intergenic
1135413306 16:22250909-22250931 TCCCTTGACCTCCCAACACCAGG - Intronic
1136174546 16:28507913-28507935 GCCCTGGATTTCCCATCTTCAGG + Intronic
1138220369 16:55245191-55245213 TTCATGGATTTTCCAGGACCAGG - Intergenic
1138225501 16:55291109-55291131 CCTCTGGATTTGTCAGCACCTGG + Intergenic
1138952827 16:61934181-61934203 TGCCTGGAGTTCTCAGCAGCCGG - Intronic
1139718493 16:68833527-68833549 TTTCTGCATTTCCCAGCACATGG - Exonic
1140451921 16:75077759-75077781 TCCTTGTCTTTCCCAGCTCCTGG + Intronic
1141252658 16:82372409-82372431 TTCCTGGCTTCCCCAGCTCCAGG - Intergenic
1141444158 16:84047409-84047431 TCCCTGCCTTTCCCAGCATCCGG - Intergenic
1142238266 16:88933011-88933033 TCCCTCGAGCTCCCAGGACCTGG - Intronic
1142863601 17:2777582-2777604 CCTCTGGCTTTGCCAGCACCAGG + Intronic
1143514899 17:7414657-7414679 TCCCAGGTTTTCTCAGCACCGGG + Exonic
1146492416 17:33292369-33292391 TCCCAGGCTTTCCCGGCCCCTGG + Exonic
1146789515 17:35743418-35743440 TCCCAGGGTTTCCCACCACAGGG + Exonic
1147566391 17:41538927-41538949 TTCCTGGTATTCCCAGCTCCTGG - Intergenic
1148989810 17:51656015-51656037 TCCCTGGTTCTTCCACCACCTGG - Intronic
1149031856 17:52092554-52092576 GCCATGGATTTCCCAGCCCATGG - Intronic
1150434234 17:65141583-65141605 TCCTTGGTGCTCCCAGCACCTGG - Intronic
1150620018 17:66801227-66801249 TCCCTGAGTTTCTCAGCAGCAGG + Intronic
1151933645 17:77248264-77248286 TCCCTGGGGTGCCCAGCACCAGG - Intergenic
1152324028 17:79625165-79625187 TCCCTGTATTCCCCACCCCCGGG + Intergenic
1152830373 17:82493604-82493626 TCCCTGTACATCCCAGCACCAGG - Intergenic
1154181402 18:12142696-12142718 ACCTTGGATTTTTCAGCACCTGG + Intergenic
1154182502 18:12148888-12148910 ACCTTGGATTTTTCAGCACCTGG - Intergenic
1157700612 18:49759729-49759751 GGCCTGGATTTCCCAGCACAAGG - Intergenic
1159691741 18:71496504-71496526 CCTCTGGATTTCCCAGCTCCAGG + Intergenic
1160103420 18:75945793-75945815 TCCCTGGGTTTCACAGTGCCTGG - Intergenic
1160493161 18:79354753-79354775 TCCCCGGGTTTTCCAGCAGCTGG + Intronic
1161202811 19:3025296-3025318 GCCCTGGTCTTCCCAGCTCCAGG - Intronic
1161274482 19:3408011-3408033 GCCCTGGAATTCCCAGCTACTGG - Intronic
1161953735 19:7481687-7481709 TCCTTGGATTTTCCAGCTTCTGG - Intronic
1163141776 19:15354407-15354429 TCACAGGACTTCGCAGCACCTGG - Exonic
1163692609 19:18745637-18745659 TCCCTGGCTCTCCAAGCACTGGG - Intronic
1163784868 19:19269845-19269867 ACCGTGGGTTTCCCAGCTCCGGG + Intronic
1164750545 19:30651243-30651265 TGCCTGTATTTCCTAGAACCAGG + Intronic
1164965438 19:32479284-32479306 TCCCTGGCTTTCCAGGCACCAGG + Intronic
1165055586 19:33174358-33174380 GCCCTGGCTCTCCCAGCCCCTGG - Intronic
1165285637 19:34839353-34839375 GCCCAGGTCTTCCCAGCACCAGG + Intergenic
1166007868 19:39919542-39919564 TCCCAGGATCTCCCAGCTCAAGG - Intronic
1167158355 19:47752678-47752700 TCATTGGAGTTCCCAGCACAGGG - Intronic
1168029258 19:53666649-53666671 TCCCTGTATTGTCCAGTACCTGG - Intergenic
1168029594 19:53669133-53669155 TCCCTGTATTGTCCAGTACCTGG - Intergenic
1168378128 19:55898054-55898076 CCCCTCAACTTCCCAGCACCTGG + Intronic
925062442 2:903660-903682 TCCCTGGAGCTGCCAGCCCCTGG + Intergenic
925113775 2:1360252-1360274 TTCTTGGCTTTCCCAGCATCTGG + Intronic
925154381 2:1638635-1638657 TCCCTGGGTTTCCCAGCAGATGG - Intronic
925814205 2:7731773-7731795 TCCCTGACTCTCCCAACACCTGG - Intergenic
927109284 2:19852697-19852719 ACTTTGGATCTCCCAGCACCAGG - Intergenic
927405198 2:22758410-22758432 TCTCTGGATTTCCCTGAACTTGG + Intergenic
927530946 2:23799953-23799975 TCCTTGGATTTCCAAGATCCAGG - Intronic
928484786 2:31718593-31718615 ACCTTGGATTTTCCAGTACCTGG - Intergenic
929078446 2:38097736-38097758 TCCCAGCCTTCCCCAGCACCTGG + Intronic
929998579 2:46845807-46845829 TCCCAGGATTTCCCTACCCCGGG - Intronic
930777226 2:55185259-55185281 TCTCAGGAATTGCCAGCACCGGG + Intronic
933577117 2:84081810-84081832 TCCTTGCCTTTCCCAGCTCCTGG - Intergenic
934925079 2:98376550-98376572 TCCCTGCCTTTTCCAGCAACAGG - Intronic
935182124 2:100700779-100700801 TGCCTGGATTTCCCATTCCCAGG + Intergenic
936242842 2:110802717-110802739 TCCCTACCTTTCCCAGCCCCTGG - Intronic
936252225 2:110875714-110875736 TCCCTGAATCCCACAGCACCAGG - Intronic
937397147 2:121547038-121547060 GCCTTGGATTTTCCAGTACCTGG - Intronic
938886433 2:135654128-135654150 TTCCTCCATTTCCCAGCCCCTGG + Intronic
939998853 2:148947486-148947508 TCCCTGGTTCTCCCAGCAGTAGG + Intronic
940631202 2:156241650-156241672 TCCCTTGCCTTCCCAGCTCCTGG + Intergenic
942251017 2:174047866-174047888 AACCTGGAGTTCTCAGCACCAGG - Intergenic
942481507 2:176393240-176393262 TGCCTGCAGTTCCCAGCTCCTGG + Intergenic
946879818 2:224165351-224165373 TCCCTGCCTTTCCCAGCAGCTGG + Intergenic
946931773 2:224678107-224678129 TCCCTGGATTTGCCAGTGACAGG + Intergenic
947710472 2:232310979-232311001 TCCCTGGTTCTCCCAGCAAGTGG - Intronic
948106173 2:235415556-235415578 TCCCTCTTTTTCCCAGCCCCTGG + Intergenic
948730805 2:239962642-239962664 TCTCTGCATTTCTCAGCCCCGGG - Intronic
948764773 2:240213687-240213709 CCACTGGATTTCCCAGCACCTGG + Intergenic
948852251 2:240714174-240714196 TCCCTGGAGTCCCCAGCACCTGG - Exonic
1169116167 20:3067408-3067430 TCCCTGAAATTCTCAGCCCCTGG + Intergenic
1170624159 20:18018773-18018795 TGGCTGGATTTCCTAGCAACTGG + Intronic
1170641934 20:18162128-18162150 TCTCTGGATTTCTCTGCCCCTGG + Exonic
1170978062 20:21184966-21184988 TCACTGTATTTCCCAACTCCTGG - Intronic
1171282103 20:23909814-23909836 CACCTGGATTTTCCAGAACCTGG + Intergenic
1172101128 20:32484266-32484288 TGCCTGGCTTTCCCAGCCCGGGG - Intronic
1172230320 20:33331949-33331971 TCTCAGCATTGCCCAGCACCGGG - Intergenic
1173340466 20:42148517-42148539 TCCCTGTCTATCCCAGCACCTGG - Intronic
1173521460 20:43703293-43703315 TCCCAGGTCTTCCCAGGACCAGG - Intronic
1174038461 20:47682753-47682775 TCCCTGGATTTCCTGGCATACGG + Intronic
1174420242 20:50394673-50394695 TCCCTGGGGTTCCCAGCTTCAGG + Intergenic
1174421950 20:50405038-50405060 ACCCTTGTCTTCCCAGCACCTGG + Intergenic
1175453826 20:59094746-59094768 TCCCAGCATTTCCCACCTCCAGG + Intergenic
1176271373 20:64236658-64236680 TTCCTGGATTTCCCTGCTCATGG + Intronic
1176283606 20:64329098-64329120 TCCCTGGATCTCCAAGCTGCTGG - Intergenic
1176703806 21:10093605-10093627 TCCCTGGATTTCCTGGCCCCTGG + Intergenic
1177177114 21:17712182-17712204 TGCCTGGCTTTCCCAGCCCCTGG - Intergenic
1177807149 21:25885558-25885580 TGCCTGGATTACACAGCAGCAGG + Intronic
1178392311 21:32208867-32208889 TCCTTGCATTTCTCATCACCAGG + Intergenic
1178399107 21:32268151-32268173 TGTGTGGATTTCACAGCACCAGG + Intergenic
1178572993 21:33758203-33758225 TGCCTGGATTTCCCAGGCTCGGG + Intronic
1179330866 21:40399923-40399945 TCCCTGGATTTCCCAGTTCCAGG + Intronic
1179530090 21:42012466-42012488 TCCCTGGATTTCCCACCTCTTGG + Intergenic
1179591440 21:42412034-42412056 TCCCTTCTCTTCCCAGCACCGGG - Intronic
1180728588 22:17964259-17964281 TCCCTGCATTCCACAGCACCAGG + Intronic
1180960175 22:19758985-19759007 TCCCTGGCTGCCCCTGCACCTGG - Intronic
1182021407 22:27084678-27084700 CCTCTGTATTTCCCAACACCTGG + Intergenic
1182988044 22:34739653-34739675 TCCCTGGATTCCTCTGTACCAGG - Intergenic
1183475412 22:38033504-38033526 GTCCTGGAGTTCCCAGCAGCTGG - Intronic
1183621221 22:38973917-38973939 TCCCTGTGTTTCTCAGCACCTGG - Intronic
1183777891 22:39979648-39979670 TCCCTGGTATTCCCAGCATCTGG - Intergenic
1183970718 22:41475497-41475519 TGCCTCGTTTTCCCAGCACCTGG + Intronic
1183976704 22:41516448-41516470 TCCCTGGATTTCTGAGGACCAGG - Intronic
1184659760 22:45960410-45960432 CCCCAGAATTGCCCAGCACCTGG + Intronic
1184853344 22:47133440-47133462 TCCAAGGATTTGCCAGCCCCAGG + Intronic
949782766 3:7708743-7708765 TCCCTAGCTCTCCCAGCAGCCGG + Intronic
949863027 3:8523811-8523833 TCCCTGGCTTTCCAACCCCCTGG + Intronic
951197023 3:19835973-19835995 ACCTTGGATTTTCCAGAACCTGG - Intergenic
952337817 3:32420356-32420378 TCCCTACATTTCCCCTCACCCGG - Intronic
953774844 3:45807882-45807904 TCCCTTGTTTTCACAGCACGTGG - Intergenic
954028655 3:47802939-47802961 GCCCGGGATGCCCCAGCACCCGG - Exonic
954859780 3:53677584-53677606 TTTCTGGATTTCCCAGCAGGTGG + Intronic
956424157 3:69115624-69115646 TCCCTGGATTTTCAAGAACGAGG - Intronic
956773859 3:72549174-72549196 TCCCTGGGCTTCTCAGCCCCAGG - Intergenic
957606816 3:82410485-82410507 CCTCTGATTTTCCCAGCACCTGG + Intergenic
958005470 3:87804360-87804382 TCCCAGGCTGTCTCAGCACCTGG - Intergenic
958590713 3:96154903-96154925 GCCTTGGATTTTCCAGTACCTGG - Intergenic
958805625 3:98806632-98806654 TCACTGGAATCCCCAGCACATGG + Intronic
958966217 3:100561736-100561758 TCCCTGATTGTCCCTGCACCTGG - Intronic
960369627 3:116817791-116817813 GCCCTACATTTCCCTGCACCTGG - Intronic
960841527 3:121963673-121963695 ACCTTGGATTTTCCAGTACCTGG - Intergenic
961349654 3:126291792-126291814 TCCATGGATCTGGCAGCACCAGG + Intergenic
962171373 3:133104881-133104903 TTCCTGGATTTCCCAGGCACAGG + Intronic
964371790 3:156007991-156008013 TCCCCCCTTTTCCCAGCACCAGG - Intergenic
965529073 3:169752467-169752489 TGCCTGGCATTCCCAGCACCTGG + Intergenic
967201088 3:187073195-187073217 TGGCTGGAGTTCCCAGCATCTGG + Intronic
967503083 3:190222684-190222706 ACCCTGGATTTTCCAGGACCTGG + Intergenic
968226525 3:196975851-196975873 TCCCTGGGTTTACAAGCTCCTGG - Intergenic
968380848 4:94751-94773 ACCTTGGATTTTCCAGTACCTGG + Intergenic
969117091 4:4877455-4877477 TCCCTGATCTTCCCAGCACCAGG + Intergenic
969122911 4:4922964-4922986 GGCCTGGATTTCCCAGCAGTGGG + Intergenic
969210135 4:5681056-5681078 TCCCTGGATGACCCTCCACCTGG - Intronic
969298799 4:6285256-6285278 TCCCTGGATGTCCCCGTCCCTGG - Intronic
969658233 4:8510246-8510268 TCCCTGCCTTTTCCAGCTCCTGG + Intergenic
969978369 4:11127971-11127993 TCCCTGTTTTTCCCAGTACCTGG + Intergenic
970617842 4:17784242-17784264 TCCTAGGATTTTCCAGCACTGGG + Intergenic
971003801 4:22351741-22351763 ACCTTGGATTTTCCAGTACCTGG - Intronic
971105971 4:23524584-23524606 GCCTCAGATTTCCCAGCACCTGG - Intergenic
974184627 4:58430442-58430464 ACTTTGGATTTTCCAGCACCTGG + Intergenic
974199839 4:58623428-58623450 GCCTTGGATTTCCCAGTACTTGG - Intergenic
977649569 4:99454257-99454279 TCCTCGGATTTTCCAGTACCTGG + Intergenic
979116459 4:116830156-116830178 ACCTTGAATTTTCCAGCACCTGG - Intergenic
980376022 4:131949956-131949978 TCCCTGGATTTCCTGGCCCCTGG + Intergenic
981617867 4:146661505-146661527 GCCCTACATTTCCCAGCACCTGG + Intergenic
983908143 4:173205971-173205993 TCCGAGTCTTTCCCAGCACCAGG - Intronic
984470275 4:180161540-180161562 TCTATGAATTTCTCAGCACCTGG + Intergenic
984961271 4:185100527-185100549 TCCCTGGCTTCCCCGGCCCCTGG - Intergenic
985695163 5:1335959-1335981 TCGCTGGATGTTCCAGCACGTGG - Intronic
986143905 5:5058512-5058534 GTCCTGGATTTCCCAGTCCCCGG + Intergenic
986256069 5:6101845-6101867 TCCCTGGACCTCCCACCACATGG + Intergenic
990169321 5:53030258-53030280 TCCCTGGTCTTACCAGCACTAGG - Intronic
991194346 5:63915094-63915116 TCGCTGCTTCTCCCAGCACCTGG - Intergenic
992476704 5:77109646-77109668 TACCTGGCTTTGCCAGCAACAGG - Intergenic
994346703 5:98696375-98696397 ACCTTGGATTTTCCAGTACCTGG + Intergenic
995187787 5:109290030-109290052 GCCTTGGATTTTCCAGTACCTGG - Intergenic
995378791 5:111509539-111509561 TTCCTGGATTCCCCTGAACCTGG + Intronic
998288685 5:140890673-140890695 TCCCTGCATTTCCCAGAAGGAGG - Intronic
999808173 5:155103098-155103120 TCCCCTGATTTCCCAGGAACAGG - Intergenic
1001702395 5:173716565-173716587 TCCCTGGATTTTCCTTCCCCAGG + Intergenic
1001736346 5:174006822-174006844 TTCTTGGATTTCCCACCACAGGG + Intergenic
1002278159 5:178116221-178116243 TCCCTGGGCTTCCAAGCAACAGG + Intronic
1002441319 5:179265862-179265884 TCCCTGGGTTTCCCGGGGCCTGG + Intronic
1002601434 5:180356091-180356113 TCCCTGGACTTCTCAGTATCAGG + Intergenic
1002807263 6:589480-589502 TCCCTGGACTTCCCCTCAACCGG + Intronic
1003486390 6:6583646-6583668 TGCTTACATTTCCCAGCACCAGG - Intergenic
1006865152 6:37203401-37203423 TTCAAGGATTTCCCAGCTCCCGG - Intergenic
1008973945 6:57402170-57402192 ACCTTGGATTTTCCAGTACCTGG + Intronic
1009162830 6:60303675-60303697 ACCTTGGATTTTCCAGTACCTGG + Intergenic
1010123405 6:72405831-72405853 TGCCTGGATTTCCTAGATCCAGG - Intergenic
1012445243 6:99300730-99300752 TCCTTTGATTGCCCAGCACAGGG - Intronic
1012931412 6:105321380-105321402 TCCCAGAATTTCCCTGTACCTGG - Intronic
1013504138 6:110782281-110782303 TGATTGGATTTCCCAGAACCTGG - Intronic
1015298860 6:131630233-131630255 TGCCTGCATTTCCTAACACCTGG + Intronic
1016748165 6:147603561-147603583 TGGCTGCATCTCCCAGCACCAGG + Intronic
1017809559 6:157975072-157975094 TTCCTGTATCCCCCAGCACCTGG + Intergenic
1019581481 7:1765697-1765719 TTCCTGGCTTTTCCAGCTCCTGG - Intergenic
1020034769 7:4958314-4958336 TCACTGGAATTCCAAGCAACAGG + Intronic
1020285874 7:6680152-6680174 TACCTGGATTTCCTTGCAGCAGG + Intergenic
1022329147 7:29361051-29361073 TGCCAGGAATTCCCAGCCCCGGG - Intronic
1023967620 7:44971059-44971081 TTCATGGTTTTCCCATCACCAGG - Exonic
1024179839 7:46881080-46881102 TCCCTTTCTTTCCCAGCTCCAGG - Intergenic
1025250734 7:57349817-57349839 TCCCTGGGGTTCCCAGCTTCCGG - Intergenic
1026583036 7:71633773-71633795 GCCTTGGATTTGCCAGCAGCTGG - Intronic
1029595025 7:101533230-101533252 GCCGTGGAATTCCCAGCCCCGGG + Intronic
1029940957 7:104480157-104480179 ATCATGGATTTCACAGCACCAGG - Intronic
1034490185 7:151389019-151389041 ACCTTGGATTTCCCAGCCTCTGG + Intronic
1037966164 8:23135399-23135421 TCCCTGGATTTTAAAGGACCAGG - Intergenic
1039522605 8:38184123-38184145 TCCCTTTATTCCCCAGCCCCAGG - Intronic
1039883919 8:41644974-41644996 ACCTTGGGTTTCTCAGCACCTGG + Intergenic
1040032803 8:42841548-42841570 TGCCTGTAATTCCCAGCACTTGG - Intronic
1041368553 8:57134424-57134446 TCCCTGGCTTTCCAAGCATGTGG - Intergenic
1045652226 8:104352072-104352094 TCCATGAATTCCCCAGCAGCTGG - Intronic
1046803970 8:118459952-118459974 TCCTGGGATTTCTCATCACCCGG - Intronic
1047053288 8:121137445-121137467 TCCCTTGATTTCCCAGCCTCCGG + Intergenic
1047544506 8:125802812-125802834 TCCCTGTATGTCCCATCCCCTGG - Intergenic
1050157914 9:2687086-2687108 TCCGTGGCTTTCCCAGCCTCAGG - Intergenic
1050598530 9:7227759-7227781 TCCCTACATTTCCCAGCCCCTGG + Intergenic
1053177183 9:35935763-35935785 ACCATGGATTTCCCAGCTACTGG + Intergenic
1053196987 9:36127137-36127159 TCCCTCAATTTCCCCGCACAGGG - Intergenic
1053641069 9:40080624-40080646 TCCCTGGATTTCCTGGCTCCTGG + Intergenic
1053765068 9:41384844-41384866 TCCCTGGATTTCCTGGCTCCTGG - Intergenic
1054321811 9:63676920-63676942 TCCCTGGATTTCCTGGCCCCTGG + Intergenic
1054543683 9:66296006-66296028 TCCCTGGATTTCCTGGCTCCTGG - Intergenic
1055928498 9:81535603-81535625 TCTCTGCATTACCCAGCACTAGG - Intergenic
1056512107 9:87316029-87316051 CCCCTGCCTTTCCCAGCTCCTGG - Intergenic
1057875183 9:98748100-98748122 CATCTGCATTTCCCAGCACCAGG + Intronic
1060160059 9:121354068-121354090 TCCCTTGAATTCCCAGAACCTGG + Intronic
1060373429 9:123097093-123097115 TCTTTGGAGTGCCCAGCACCAGG + Intronic
1061099873 9:128484477-128484499 TCCCTGGATCTCTCAGCCCATGG - Intronic
1061226818 9:129285140-129285162 TCCCAGGAGTCGCCAGCACCTGG + Intergenic
1062686016 9:137813888-137813910 TCCCTGCACCTCCCAGCCCCCGG + Intronic
1202788843 9_KI270719v1_random:63700-63722 TCCCTGGATTTCCTGGCCCCTGG + Intergenic
1185677439 X:1860181-1860203 TTCCTGCCTTTCCCAGCTCCTGG + Intergenic
1185866806 X:3631454-3631476 TCCCTGCCTCTCCCAGCTCCTGG - Intronic
1185914576 X:4021866-4021888 TTCCTGCCTCTCCCAGCACCTGG - Intergenic
1185924120 X:4127597-4127619 TCCCTGCCTCTCCCAGCTCCTGG + Intergenic
1186192860 X:7083051-7083073 TTCCTGCCTTTCCCAGCTCCTGG - Intronic
1186455334 X:9706187-9706209 TCCGTGGATTTACCAGCAGATGG + Intronic
1190729830 X:53218336-53218358 GCCCTGGATTTCCCAGAATTTGG + Exonic
1191988831 X:67010299-67010321 GCCTTGGATTTTCCAGTACCTGG - Intergenic
1194593994 X:95835933-95835955 ACCTTGGATTTTCCAGTACCTGG + Intergenic
1194917480 X:99723186-99723208 TCCTGGGATTTTCCAGTACCTGG - Intergenic
1198535148 X:137577900-137577922 CCCCTGGCCTTCCCAACACCTGG - Intergenic
1199692769 X:150321179-150321201 TACCTGGATTTCTCAGCATAAGG - Intergenic
1200336354 X:155354584-155354606 TCCTTGGATTTTCCAGTACCTGG - Intergenic
1200350116 X:155486643-155486665 TCCTTGGATTTTCCAGTACCTGG + Intergenic
1200809041 Y:7463268-7463290 TCCTGGGACCTCCCAGCACCTGG + Intergenic
1201239523 Y:11945223-11945245 TTCCTGCCTCTCCCAGCACCTGG - Intergenic
1201639288 Y:16161563-16161585 TTCCTGCCTTTCCCAGCTCCTGG - Intergenic
1201663525 Y:16423764-16423786 TTCCTGCCTTTCCCAGCTCCTGG + Intergenic
1201757534 Y:17502508-17502530 TGCCTGCATTTCTCTGCACCAGG + Intergenic
1201844020 Y:18403474-18403496 TGCCTGCATTTCTCTGCACCAGG - Intergenic