ID: 915377301

View in Genome Browser
Species Human (GRCh38)
Location 1:155408144-155408166
Sequence GGCTGTATTCCAGACTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915377301_915377303 -9 Left 915377301 1:155408144-155408166 CCATGTGAGTCTGGAATACAGCC 0: 1
1: 0
2: 0
3: 9
4: 191
Right 915377303 1:155408158-155408180 AATACAGCCCCAGCCTCGGATGG 0: 1
1: 0
2: 0
3: 12
4: 127
915377301_915377308 5 Left 915377301 1:155408144-155408166 CCATGTGAGTCTGGAATACAGCC 0: 1
1: 0
2: 0
3: 9
4: 191
Right 915377308 1:155408172-155408194 CTCGGATGGTACCTTGATTCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
915377301_915377310 27 Left 915377301 1:155408144-155408166 CCATGTGAGTCTGGAATACAGCC 0: 1
1: 0
2: 0
3: 9
4: 191
Right 915377310 1:155408194-155408216 GCTTATGAAACTCAGAACAGAGG 0: 1
1: 0
2: 0
3: 9
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915377301 Original CRISPR GGCTGTATTCCAGACTCACA TGG (reversed) Intronic
902621374 1:17652838-17652860 GGGTGTAGCCCAGACCCACAGGG + Intronic
904998326 1:34648520-34648542 TGCTGTCTTTCAGAGTCACAGGG - Intergenic
906613791 1:47221459-47221481 TGCTGTGTTCAAGACTCACTGGG + Intronic
908627168 1:66058130-66058152 TGCTGGATTTCAGACTTACATGG - Intronic
908845882 1:68323685-68323707 AGCTGGATTCCAAGCTCACAGGG + Intergenic
909594576 1:77391770-77391792 GGATGTTTTCCAGAGCCACATGG + Intronic
910238755 1:85063409-85063431 AGTTCTATTCCAGCCTCACACGG - Intronic
911819906 1:102404714-102404736 GGCTGTCTTCCTGGCTTACAGGG - Intergenic
915377301 1:155408144-155408166 GGCTGTATTCCAGACTCACATGG - Intronic
918734269 1:188038380-188038402 AGCTGAATTTCAGACTCTCATGG + Intergenic
919087849 1:192942673-192942695 AGCTGTATTCCAGACTTTCCAGG + Intergenic
923519331 1:234723873-234723895 GGCTGTAATCAGCACTCACAGGG - Intergenic
1064605498 10:17034640-17034662 GGCTGCATTCCAGAATCATCTGG - Intronic
1067631520 10:47966580-47966602 GGCTGTAGGCCAGACTGGCAGGG + Intergenic
1067728534 10:48791859-48791881 GGCAGTAGTCCAGACAGACAGGG - Intronic
1069689327 10:70339501-70339523 TGCTTCATCCCAGACTCACATGG - Intronic
1070279404 10:75037821-75037843 AGCTGTAGGCCCGACTCACAGGG - Exonic
1071034923 10:81233437-81233459 TGCTGTTTTTCAGACTTACATGG + Intergenic
1071670879 10:87608395-87608417 GTCTGAATTGCAGACTGACAGGG + Intergenic
1074061241 10:109967844-109967866 GGCTGTACTTCAGAATCACCTGG - Intergenic
1075613721 10:123875401-123875423 GCCTGTATTTCAGACTCCTATGG - Intronic
1076299482 10:129414262-129414284 GCCTGTGTTCCAGGGTCACACGG - Intergenic
1077984962 11:7342434-7342456 TGCTGGATTTCAGACTCCCATGG - Intronic
1078482290 11:11687965-11687987 TGCTGTATTTCAGACTTGCATGG + Intergenic
1083853865 11:65382534-65382556 GGCTGTGTTTCTGACTCACACGG - Exonic
1085101957 11:73808477-73808499 GGTTCTATTCCATGCTCACATGG - Intronic
1089402582 11:118172955-118172977 GGCTGGATGCCACACTCACCTGG - Intronic
1090179735 11:124685788-124685810 TGTTGTATTTCAGACTTACATGG + Intronic
1090224427 11:125061581-125061603 AGCTGTGTTCCTGCCTCACAGGG - Intergenic
1093324686 12:17759608-17759630 TGCTGTATTTCAGACTTGCATGG - Intergenic
1093425076 12:19019443-19019465 GGCTGTTTTTCAGGATCACAGGG + Intergenic
1093682974 12:22024035-22024057 TGCTGGATTTCAGACTTACATGG + Intergenic
1094251656 12:28369308-28369330 TGCTGGGTTTCAGACTCACATGG - Intronic
1098715137 12:73821002-73821024 TGCTGGATTTCAGACTCGCATGG - Intergenic
1098795807 12:74887449-74887471 TGCTGGATTTCTGACTCACATGG - Intergenic
1102144099 12:110641604-110641626 TGCTGGATTCCAGCCTCATAAGG + Exonic
1102346939 12:112166666-112166688 GGCTTTATTCCATCATCACAAGG - Intronic
1103044995 12:117728728-117728750 GGCTGAGCTGCAGACTCACAGGG + Intronic
1109256165 13:60085458-60085480 GGCTGTATCCTAGAATCACCAGG + Intronic
1109824998 13:67707329-67707351 TGCTGTTTTCCAGAATCACAAGG - Intergenic
1109879386 13:68451199-68451221 TGCTGGATTTCGGACTCACATGG + Intergenic
1111221387 13:85208997-85209019 TGCTGGATTCCAGACTTGCATGG + Intergenic
1112379988 13:98879590-98879612 GGTTGTATTCCTGAATCACTTGG - Intronic
1113270696 13:108670262-108670284 GGCTGTATAACAGAATCACCTGG + Intronic
1114986811 14:28239382-28239404 TGCTGGATTTCAGACTCTCATGG + Intergenic
1115130301 14:30046398-30046420 TGCTGGATTCCAGACTTGCAAGG - Intronic
1116855163 14:49945765-49945787 GGCTGGATTCAGGACTCAGATGG + Intergenic
1117256840 14:53986408-53986430 TGCTGGATTTCAGACTTACATGG + Intergenic
1118112889 14:62742582-62742604 GGCTGTAGTTTAGACTCACCTGG - Intronic
1119854577 14:77889772-77889794 GCCTGGATTCCAGACCAACAGGG - Intronic
1121033710 14:90681799-90681821 GGCTCTATTCCAGAATCTAAGGG - Intronic
1121871811 14:97414944-97414966 GGCTGTCGTCCAGACACACGTGG + Intergenic
1122299951 14:100725830-100725852 GCACGTATTCCAGACTCACTGGG - Intronic
1124904085 15:33852222-33852244 GGCTGCAATCCAGTCTTACAAGG + Intronic
1126873158 15:53010943-53010965 GGCTGGATTTCAGACTTGCATGG - Intergenic
1128311488 15:66633883-66633905 AGCTCCATTCCAGGCTCACAGGG - Intronic
1129923784 15:79343955-79343977 CTCTGAATTCCAGACTCATATGG - Intronic
1136347204 16:29683808-29683830 GGCTGCACACCAGAATCACAGGG - Intronic
1136540389 16:30924942-30924964 GGCTGGATTCTAGAATCCCAAGG + Intronic
1139096649 16:63712429-63712451 GGCTGCATTACAGACCCATATGG + Intergenic
1139321199 16:66115782-66115804 GGCTGTATTTTAGAATCACTGGG - Intergenic
1143704655 17:8687897-8687919 GGGTTTATTCCAGAATCACAAGG - Intergenic
1144108203 17:12005981-12006003 GGCTGCAGATCAGACTCACATGG + Intergenic
1145061800 17:19738528-19738550 GGGTGTATCCCAGAACCACAGGG + Intronic
1151963054 17:77417464-77417486 GCCTCTGTTCCAGAGTCACAAGG - Intronic
1153409915 18:4782132-4782154 AGCTATTTTCCAGACACACAAGG + Intergenic
1153454945 18:5270899-5270921 TGCTGGATTTCAGACTCGCATGG - Intergenic
1155632059 18:27905768-27905790 TGCTGTATTTCAGACTTGCATGG - Intergenic
1156344221 18:36241371-36241393 TGCTGGATTTCAGACTTACAAGG - Intronic
1156942229 18:42782139-42782161 AGCTGTCTTCCAGACTCTTAAGG - Intronic
1158222135 18:55160760-55160782 GGCTGGATTTCAGACTTGCATGG + Intergenic
1158765843 18:60448568-60448590 GTCTGGGTTTCAGACTCACATGG - Intergenic
1158952809 18:62511058-62511080 GGCAGTCTTCCAGACCCCCAGGG - Intergenic
1161193587 19:2973530-2973552 TGCTTTATCCAAGACTCACAGGG - Intergenic
1163015132 19:14450297-14450319 CCCTGTATTCCACGCTCACAGGG + Exonic
1163018162 19:14469514-14469536 GGCTGGGGTCCAGGCTCACATGG - Exonic
1163867689 19:19788040-19788062 GGCTGTTTTCCAGTCTGAGATGG - Intronic
1163952334 19:20601138-20601160 GGCTGTGTTCCAGTCTGAGATGG - Intronic
1164107452 19:22121227-22121249 GGCTGTGTTCCAGTCTGAGATGG - Intergenic
1164473190 19:28552858-28552880 GGCTGTGTCACAGTCTCACAGGG - Intergenic
1165102841 19:33449057-33449079 GGCTGCAGTCCACTCTCACAGGG + Intronic
1166460273 19:42981948-42981970 GGATATCTTCCAGGCTCACAAGG + Intronic
925291122 2:2749410-2749432 GGCTGGAGAGCAGACTCACAGGG - Intergenic
927253855 2:21022372-21022394 GGCTGTATTCCATTATCACGAGG + Intronic
928406926 2:31022064-31022086 GGCAGTATTTCAGAACCACAGGG - Intronic
932993586 2:76819472-76819494 GTCTATATTCCAGACCCAAATGG - Intronic
933344432 2:81065634-81065656 TGCTGGATTTCAGACTTACATGG - Intergenic
935044623 2:99469350-99469372 GACTGTCTTACAGAGTCACATGG - Intronic
935057315 2:99578883-99578905 TGCTGAATCCCAGACTCTCAGGG - Intronic
935390626 2:102548769-102548791 GACTGTAATCCAAACTCACAAGG + Intergenic
936393264 2:112095973-112095995 GGCTGTTTTCCAGGAGCACAGGG - Intronic
936771863 2:115923205-115923227 TGCTGTTTTCCAGGATCACAGGG + Intergenic
936998694 2:118441619-118441641 GGCTGGATTATAGAGTCACAGGG + Intergenic
937151229 2:119687286-119687308 GATTCTATTCCAGGCTCACACGG - Intergenic
938525082 2:132122085-132122107 TGCTGGATTCCAGACTTGCATGG - Intergenic
939150176 2:138463062-138463084 TGCTGGATTTCAGACTCGCATGG - Intergenic
941038876 2:160598362-160598384 GGCTGAATACAAGACTCAAAAGG - Intergenic
941332222 2:164192852-164192874 GGCTGATTTGCAGACTCTCATGG - Intergenic
942549283 2:177097768-177097790 GGCTGTATTTTAGATTAACAAGG + Intergenic
942910739 2:181241473-181241495 GGCTGTTTTCCATCCTCAGATGG + Intergenic
943365120 2:186961433-186961455 TGCTGTATTCTAGAACCACAGGG - Intergenic
944125183 2:196284320-196284342 GGCTCTATTTCAGAGTCAAATGG + Intronic
946864877 2:224034002-224034024 GTTTGTATTCCAGACTCAAAGGG - Intronic
948581741 2:238991716-238991738 GGCTGCAATCCAGCCCCACAAGG - Intergenic
948663632 2:239521425-239521447 TGGTGGATTCCAGAATCACAGGG - Intergenic
1169118259 20:3081178-3081200 GGCTCTCTTCCACACTCCCAGGG - Intergenic
1169911495 20:10651143-10651165 GGCTGTATATCAGAATCACCTGG - Intronic
1172760098 20:37315635-37315657 GGCAGAATTCCAGACTCCCTGGG - Intronic
1173491552 20:43486873-43486895 TGCTGGATTTCAGACTCTCATGG - Intergenic
1175942987 20:62546432-62546454 GGCTGGAATCCAGAATCAGATGG + Intergenic
1177478212 21:21651498-21651520 TGCTGGATTTCAGACTTACATGG + Intergenic
1179235235 21:39539962-39539984 AGCTGGATTTCAGACTCGCATGG - Intergenic
1179494788 21:41764665-41764687 GGTTGCATTGCAGTCTCACAAGG - Intronic
1179678117 21:42998666-42998688 TGCTGGATTTCAGACTTACATGG - Intronic
949768398 3:7552138-7552160 GGCTGGATTTCAGACTTACATGG - Intronic
950294885 3:11820892-11820914 GGCTGCATGCCTGAATCACAGGG - Intronic
950326045 3:12110760-12110782 TGCTGTATTTCAGACTTGCATGG + Intronic
950387840 3:12673943-12673965 GGCTATATCCCAGACACTCAAGG + Intergenic
950448912 3:13054769-13054791 GGCTGTTTGCCAGTGTCACACGG + Intronic
952046837 3:29331727-29331749 GGTTTTTTTCCAGATTCACAGGG + Intronic
952450728 3:33430274-33430296 GGCTGTATCCTACACCCACAAGG - Intronic
955725521 3:61928256-61928278 TGCTGTATTTCACACTTACAAGG - Intronic
956558999 3:70552549-70552571 TGCTGGATTTCAGACTTACATGG - Intergenic
958050226 3:88335364-88335386 TGCTGGATTTCAGACTTACATGG - Intergenic
958577782 3:95974457-95974479 TGCTGGATTTCAGACTCAAATGG + Intergenic
959317108 3:104822405-104822427 TGCTGGATTCCAGACTTTCATGG + Intergenic
960773849 3:121226389-121226411 GTCTGTATTCCACACTCTAATGG - Intronic
960843014 3:121979109-121979131 GGCTGGATTTCAGACTTGCATGG + Intergenic
961163458 3:124748769-124748791 GGCTCTGTCCCAGACACACATGG - Intergenic
964562182 3:158010084-158010106 GGCTGGATTTCAGACTTGCATGG - Intergenic
965198554 3:165628899-165628921 TGCTGTATTTCAGACTTGCATGG - Intergenic
966103095 3:176299542-176299564 TGCTGCCTTCCAGTCTCACAAGG - Intergenic
970774140 4:19652741-19652763 GACTATATTCCAGACACAAAAGG + Intergenic
971089542 4:23324844-23324866 CACTGTTTTCCAGAATCACAGGG - Intergenic
971570386 4:28204451-28204473 CGCTGGATTTCAGACTTACATGG - Intergenic
971983068 4:33780226-33780248 GACAGCATTCCAGACACACATGG - Intergenic
972833550 4:42841889-42841911 GGCTGAAATCCTAACTCACAAGG + Intergenic
973015675 4:45134501-45134523 TGCTGGATTCCAGACTTGCATGG - Intergenic
974477925 4:62406877-62406899 GACTGTATTTCAAACTCGCACGG + Intergenic
974555067 4:63435916-63435938 GGCTGTATTCCAGGTAGACACGG + Intergenic
974921944 4:68252639-68252661 GGGTGTATTTCAGATTCATATGG + Intergenic
975166655 4:71186210-71186232 GGCTGTTTTCCTAACTCCCAAGG + Intergenic
981118550 4:141021002-141021024 GGCTCAATTCCAAACACACATGG + Intronic
981507238 4:145515825-145515847 GGCTGTATATTAGAATCACATGG + Intronic
981898524 4:149834239-149834261 GGTTTTATTCCAAAATCACATGG + Intergenic
981977438 4:150747897-150747919 TCCTATATTTCAGACTCACAGGG + Intronic
982136488 4:152278434-152278456 GCCTGCTTTCCAGGCTCACATGG - Intergenic
983431718 4:167659458-167659480 TGCTGTATTTCAGACTTGCATGG - Intergenic
984699744 4:182811221-182811243 TGCTGGATTTCAGACTCATATGG - Intergenic
984720095 4:182963332-182963354 GTCTGTTTCCCAGTCTCACAGGG + Intergenic
985520377 5:371406-371428 GGCTGAAATCCTGACTCAGATGG - Intronic
985785410 5:1890645-1890667 GGCCTCATTCCAGCCTCACAAGG - Intergenic
985951647 5:3225991-3226013 GGCTCTATTGCAGAATCAAAAGG - Intergenic
986491571 5:8296520-8296542 GGCTGTATTCCCTAAGCACAGGG - Intergenic
988681703 5:33489926-33489948 GGCTATTTTCCAGGATCACAGGG - Intergenic
991206949 5:64060305-64060327 TGCTGGATTTCAGACTTACATGG + Intergenic
993178551 5:84519141-84519163 GCCTGGATTCCAGAGTCCCATGG + Intergenic
997198027 5:131992544-131992566 TCCTGTCTTCCAGACCCACAAGG + Intronic
1003502173 6:6711914-6711936 GGCTGTTGTCCAGAGGCACAGGG + Intergenic
1006887801 6:37396988-37397010 GGCTAATATCCAGACTCACATGG - Intergenic
1008223325 6:48879943-48879965 TGCTGTGTTCCAGAGTCAGATGG + Intergenic
1008434408 6:51458078-51458100 GGCTTAATTCCAAACTCAGATGG + Intergenic
1010515772 6:76771282-76771304 GGCTGAATGCCAGAGTCACTTGG + Intergenic
1010549332 6:77201610-77201632 TGCTGGATTTCAGACTTACATGG + Intergenic
1011355215 6:86466623-86466645 GGCTGTATCCCAGCTCCACAGGG + Intergenic
1017615172 6:156239726-156239748 GACTGAATTCCGTACTCACATGG - Intergenic
1018864068 6:167734125-167734147 GGCTGAATGCCAGCCTCTCAGGG - Intergenic
1021111158 7:16696278-16696300 GCCTATATTCCATACTCTCAGGG + Intronic
1023406965 7:39843548-39843570 TGCTGTATTTCAGACTTTCATGG + Intergenic
1028899590 7:96082101-96082123 GGCGGTATTTCCGACTCAGAGGG - Intronic
1031589731 7:123574927-123574949 GGCTGTATTTAAGACACATAGGG + Intronic
1036633145 8:10529540-10529562 CTCGGTATTCCAGAATCACAGGG + Exonic
1037107610 8:15128609-15128631 TACTGTATTCCAGGATCACAGGG - Intronic
1039702264 8:39974240-39974262 GTATGTATTCCATACACACATGG - Intronic
1039787659 8:40847973-40847995 GGCTGTTTCTCAGACCCACAGGG + Intronic
1040721382 8:50329024-50329046 TGCTGGATTTCAGACTCACATGG - Intronic
1041351323 8:56950689-56950711 TGCTGGATTTCAGACTCATATGG - Intergenic
1042051213 8:64710121-64710143 GGATAGATTCCAGAATCACAGGG - Intronic
1045469519 8:102499394-102499416 GGCTGGATTCCAGAATCCCATGG + Intergenic
1046929113 8:119825238-119825260 TGCTGTATTTCAGACTTGCATGG + Intronic
1047158110 8:122344892-122344914 GGCTGACTTCCAGCCTCACCTGG + Intergenic
1047251449 8:123184392-123184414 GGCTGGATTCAAGAGCCACAAGG - Intronic
1048303170 8:133266129-133266151 GTCAGTATCCCAGAGTCACACGG + Intronic
1049790506 8:144470201-144470223 GGCTGCCTGCCAGCCTCACAGGG + Intronic
1050313130 9:4373313-4373335 GGCTGTATTTCAGAATCACCTGG + Intergenic
1055722811 9:79194342-79194364 GGCTGGTATCCTGACTCACAGGG + Intergenic
1056119903 9:83477400-83477422 GGCTGCATTTCAGAGTCACCTGG + Intronic
1059392322 9:114007056-114007078 AGGTCTAGTCCAGACTCACAGGG + Intronic
1061219470 9:129241963-129241985 GGGTGTGTCCCAGACTCACCAGG + Intergenic
1061996826 9:134190428-134190450 GGCTGTATTTCATAGGCACATGG + Intergenic
1062275425 9:135728206-135728228 GGCTGAAGTCCAGTGTCACAAGG - Intronic
1187002709 X:15199307-15199329 TGCTGGATTTCAGACTCGCATGG - Intergenic
1187199731 X:17123500-17123522 TGCTGGATTCAAGAGTCACATGG - Intronic
1192856468 X:75017791-75017813 TTCTGGATTTCAGACTCACATGG - Intergenic
1196313427 X:114196161-114196183 GGCTGGATTTCAGACTTGCATGG - Intergenic
1196809372 X:119616532-119616554 AGCTCTCTTCCTGACTCACATGG - Intronic
1197173415 X:123459370-123459392 TTCTGTGTACCAGACTCACAGGG + Intronic
1197572490 X:128166257-128166279 GTCTGTCTTCCAGTCTCCCAGGG + Intergenic
1198283174 X:135162904-135162926 GCTTGGATTCCAGTCTCACAAGG + Intronic
1198608764 X:138373588-138373610 TGCTGGATTTCAGACTTACATGG + Intergenic
1198798554 X:140425837-140425859 GTCTGTAGTCCACACCCACAAGG - Intergenic