ID: 915377308

View in Genome Browser
Species Human (GRCh38)
Location 1:155408172-155408194
Sequence CTCGGATGGTACCTTGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915377300_915377308 12 Left 915377300 1:155408137-155408159 CCTACATCCATGTGAGTCTGGAA 0: 1
1: 0
2: 4
3: 35
4: 279
Right 915377308 1:155408172-155408194 CTCGGATGGTACCTTGATTCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
915377301_915377308 5 Left 915377301 1:155408144-155408166 CCATGTGAGTCTGGAATACAGCC 0: 1
1: 0
2: 0
3: 9
4: 191
Right 915377308 1:155408172-155408194 CTCGGATGGTACCTTGATTCTGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915377308 Original CRISPR CTCGGATGGTACCTTGATTC TGG Intronic
906947171 1:50304850-50304872 CTGGGATGGTATCTAGAATCAGG - Intergenic
908016578 1:59845099-59845121 ATCTGCTGGTACCTTGATTTTGG - Intronic
909959311 1:81819300-81819322 CTTGGCTGGAACCTTGGTTCTGG - Intronic
915377308 1:155408172-155408194 CTCGGATGGTACCTTGATTCTGG + Intronic
917767126 1:178233038-178233060 CTCTGATGATACTTTGCTTCAGG + Intronic
919001566 1:191838353-191838375 ATCTGATGGTGCCTTGATTTTGG + Intergenic
924698934 1:246430298-246430320 CTCTGATGTTATCTTGATGCTGG - Intronic
1064369761 10:14741135-14741157 CTCACCTGGTACCCTGATTCTGG - Intronic
1065731411 10:28712886-28712908 ATCTGATGGTGCCTTGATTTTGG + Intergenic
1071356061 10:84797411-84797433 CTGGGAGTGCACCTTGATTCTGG + Intergenic
1071692697 10:87838830-87838852 ATCAGCTGGCACCTTGATTCGGG + Intronic
1078005671 11:7530603-7530625 CTCTGCTGGTGCCTTGATCCTGG + Intronic
1079966539 11:26987090-26987112 ATCTGCTGGTACCTTGATTTTGG + Intergenic
1080154048 11:29087631-29087653 CTCGGGTGGTATCCTGCTTCTGG - Intergenic
1081738225 11:45420079-45420101 CTGGAATGGTGCCATGATTCTGG - Intergenic
1081848268 11:46256830-46256852 ATCTGCTGGTACCTTGATTTTGG + Intergenic
1084775814 11:71374354-71374376 CTCTGATGGTGGCCTGATTCTGG - Intergenic
1087086534 11:94224903-94224925 CTTGCCTGGTACCTTGATTTTGG - Intergenic
1088772980 11:113054152-113054174 CTCGGCTGGTAGCCTGAATCTGG - Intronic
1091009693 11:131988041-131988063 ATCGGATGGTGCCTTGATATTGG - Intronic
1098363536 12:69678768-69678790 CTCTGATTCTACCTTCATTCCGG + Exonic
1100206065 12:92351031-92351053 ATCTGCTGGTTCCTTGATTCCGG + Intergenic
1100790582 12:98125934-98125956 CTTGGATGGCACCTTGAATTTGG - Intergenic
1101691719 12:107088585-107088607 ATCTGCTGGTGCCTTGATTCTGG + Intronic
1102542278 12:113630067-113630089 CACTGATGATACCTTGATTCTGG - Intergenic
1108014628 13:46061630-46061652 CTCTGCTGGTACCTTGATTTTGG + Intronic
1111258495 13:85704227-85704249 ATTTGATGGTACCTTGATCCTGG + Intergenic
1116805782 14:49492889-49492911 TTGGGATGGTACCTTAATTCAGG - Intergenic
1117058066 14:51933100-51933122 CTCTGCTGGCACCTTGATTTTGG + Intronic
1117518460 14:56526182-56526204 CTCTGCTGGCACCTTGATTTTGG + Intronic
1118692695 14:68354969-68354991 CTCGGATAGTACCCTAATACTGG - Intronic
1120916453 14:89714879-89714901 ATCTGCTGGTACCTTGATCCTGG - Intergenic
1124618134 15:31257202-31257224 TTCTGCTGGTACCTTGATTTTGG + Intergenic
1125742115 15:41972512-41972534 CTCGGATGGGACCCTGCTCCGGG + Exonic
1129995834 15:80004269-80004291 CTTGGCTGGTACCTGGATGCAGG - Intergenic
1131720756 15:95166074-95166096 ATCTGCTGGTACCTTGATTTTGG - Intergenic
1132349396 15:101129596-101129618 CTCTGATGGCACCTTGATCTTGG + Intergenic
1151889048 17:76941450-76941472 CTTGGCTGGTTCCTTCATTCTGG + Intronic
1153450468 18:5221828-5221850 CTCTGATGGCACCTTGATCTTGG - Intergenic
1158765052 18:60440802-60440824 CACTGATGGCATCTTGATTCTGG - Intergenic
1161627515 19:5335882-5335904 CGCAGAGGGTGCCTTGATTCCGG + Intronic
1162882671 19:13671688-13671710 CTTGGATGGTACCTAGATGTGGG + Intergenic
1167725171 19:51207046-51207068 CTCAGAAGATACCTTGATTCTGG + Intergenic
935656730 2:105429598-105429620 CCCTGCTGATACCTTGATTCTGG + Intronic
935950331 2:108323103-108323125 GTCTGTTGGTACCTTGATTTTGG - Intergenic
936009242 2:108914801-108914823 CTGGGGAGGTACCTTGATTTGGG - Intronic
936895500 2:117423102-117423124 CCCAGATGGTACCTTGATCTTGG - Intergenic
938091872 2:128439798-128439820 CTCAGAGGGCACCTTGATTTTGG + Intergenic
945524748 2:210874389-210874411 ATCTGATGGTACCTTGATCTTGG - Intergenic
948217202 2:236240562-236240584 CTCGGATGGCACCCTGCTTTGGG - Intronic
1170874473 20:20237294-20237316 CTCGTAAGGTACCCTGAGTCTGG - Intronic
1174615217 20:51830206-51830228 CTTGGATGGTACCTGTAGTCTGG - Intergenic
1174954357 20:55080254-55080276 CTCTGCTGATACCTTGATTTTGG + Intergenic
959873467 3:111354641-111354663 CCCGGCTGATACCTTGATTTTGG + Intronic
961353949 3:126322282-126322304 CACCGATGGCACCTTCATTCTGG - Intergenic
961495302 3:127287302-127287324 GTTTGATGGTACCTTGATTTGGG + Intergenic
962323370 3:134409608-134409630 CTCGGTTGGTTCATTTATTCTGG - Intergenic
967446617 3:189574358-189574380 GATGGATGGTACCTTTATTCTGG + Intergenic
969079337 4:4606425-4606447 CTCTGCTGACACCTTGATTCTGG - Intergenic
972840152 4:42921259-42921281 ATCTGCTGGTACCTTGATCCTGG + Intronic
988786463 5:34569941-34569963 CTCTGATGGTGCCTTGATCTTGG - Intergenic
990604335 5:57393950-57393972 CTCTGCTGATACCTTGATTTTGG + Intergenic
992164355 5:74034529-74034551 CTGGGATGGTACCTTGACACTGG + Intergenic
996976022 5:129435752-129435774 CTCTGATGAAACCTTGATTTTGG - Intergenic
997091498 5:130864122-130864144 CTTGGATGGCCCCTTTATTCTGG - Intergenic
1010470169 6:76217800-76217822 ATCTGCTGGTACCTTGATCCTGG - Intergenic
1013374976 6:109505898-109505920 ATTTGCTGGTACCTTGATTCTGG - Intronic
1016019440 6:139220226-139220248 ATCTGCTGGTACCTTGATACTGG + Intergenic
1021705463 7:23363473-23363495 CTGGGATGATCCCTTGAATCTGG - Intronic
1031836323 7:126685332-126685354 CTGGGGTGGTACCATGCTTCAGG + Intronic
1050158256 9:2690769-2690791 CTCTGCTGATACCTTGATTCTGG - Intergenic
1052806350 9:33017371-33017393 TTCAGCTGGTACCTTGATCCTGG - Intronic
1053040399 9:34865707-34865729 CTGGGCTGATACCTTGATTTTGG - Intergenic
1059524806 9:114980727-114980749 CTTTGCTGGTACCTTGATTTTGG + Intergenic
1059894897 9:118852072-118852094 CCCTGCTGGTACCTTGATTTCGG - Intergenic
1189793151 X:44622670-44622692 CTCTGCTGATACCTTGATTTTGG - Intergenic
1189815572 X:44821543-44821565 ATCTGCTGGTACCTTGATTTTGG - Intergenic
1195900483 X:109792441-109792463 CCCGGCTGGCACCTTGATTTTGG - Intergenic
1195995407 X:110726448-110726470 ATCTGATGGTACCTTGATCTTGG + Intronic
1198670262 X:139072385-139072407 CTCTGATGGCACCTTGATCTTGG + Intronic