ID: 915393232

View in Genome Browser
Species Human (GRCh38)
Location 1:155562743-155562765
Sequence TGTCAAGCCGGCGCCGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 44}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915393224_915393232 -3 Left 915393224 1:155562723-155562745 CCTCACTACCCCTCAGGCCCTGT 0: 1
1: 0
2: 2
3: 39
4: 431
Right 915393232 1:155562743-155562765 TGTCAAGCCGGCGCCGGCGCAGG 0: 1
1: 0
2: 1
3: 3
4: 44
915393216_915393232 21 Left 915393216 1:155562699-155562721 CCACAGGAACCCCCTCGTCCAGT 0: 1
1: 0
2: 1
3: 10
4: 132
Right 915393232 1:155562743-155562765 TGTCAAGCCGGCGCCGGCGCAGG 0: 1
1: 0
2: 1
3: 3
4: 44
915393219_915393232 10 Left 915393219 1:155562710-155562732 CCCTCGTCCAGTCCCTCACTACC 0: 1
1: 0
2: 1
3: 17
4: 261
Right 915393232 1:155562743-155562765 TGTCAAGCCGGCGCCGGCGCAGG 0: 1
1: 0
2: 1
3: 3
4: 44
915393223_915393232 -2 Left 915393223 1:155562722-155562744 CCCTCACTACCCCTCAGGCCCTG 0: 1
1: 1
2: 2
3: 55
4: 477
Right 915393232 1:155562743-155562765 TGTCAAGCCGGCGCCGGCGCAGG 0: 1
1: 0
2: 1
3: 3
4: 44
915393220_915393232 9 Left 915393220 1:155562711-155562733 CCTCGTCCAGTCCCTCACTACCC 0: 1
1: 0
2: 1
3: 28
4: 255
Right 915393232 1:155562743-155562765 TGTCAAGCCGGCGCCGGCGCAGG 0: 1
1: 0
2: 1
3: 3
4: 44
915393218_915393232 11 Left 915393218 1:155562709-155562731 CCCCTCGTCCAGTCCCTCACTAC 0: 1
1: 0
2: 0
3: 14
4: 169
Right 915393232 1:155562743-155562765 TGTCAAGCCGGCGCCGGCGCAGG 0: 1
1: 0
2: 1
3: 3
4: 44
915393215_915393232 22 Left 915393215 1:155562698-155562720 CCCACAGGAACCCCCTCGTCCAG 0: 1
1: 0
2: 0
3: 7
4: 133
Right 915393232 1:155562743-155562765 TGTCAAGCCGGCGCCGGCGCAGG 0: 1
1: 0
2: 1
3: 3
4: 44
915393221_915393232 3 Left 915393221 1:155562717-155562739 CCAGTCCCTCACTACCCCTCAGG 0: 1
1: 0
2: 2
3: 28
4: 278
Right 915393232 1:155562743-155562765 TGTCAAGCCGGCGCCGGCGCAGG 0: 1
1: 0
2: 1
3: 3
4: 44
915393217_915393232 12 Left 915393217 1:155562708-155562730 CCCCCTCGTCCAGTCCCTCACTA 0: 1
1: 0
2: 0
3: 23
4: 251
Right 915393232 1:155562743-155562765 TGTCAAGCCGGCGCCGGCGCAGG 0: 1
1: 0
2: 1
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915393232 Original CRISPR TGTCAAGCCGGCGCCGGCGC AGG Intronic
900227382 1:1539655-1539677 TGTCGAGCCGGCGCCGGTTGTGG + Intronic
900604330 1:3517076-3517098 TGGGAAGGCGGGGCCGGCGCAGG - Intronic
901014988 1:6223793-6223815 TGTGAAGGCGGCGTCGGCGCGGG - Exonic
906044534 1:42817434-42817456 GGGCAAGCCGGTGCCGGGGCGGG + Intronic
908354957 1:63319849-63319871 TATTAGGCCGGCGCGGGCGCGGG + Intergenic
915393232 1:155562743-155562765 TGTCAAGCCGGCGCCGGCGCAGG + Intronic
915409370 1:155688623-155688645 TGTCAAGCCGGCTCCAGCGCAGG + Exonic
920231034 1:204469673-204469695 TGTCATGCCGGAGCCGGGACAGG + Exonic
922295996 1:224250277-224250299 TGTCCAGGCGGCCCGGGCGCAGG + Exonic
1065811708 10:29449134-29449156 TGTGAAGCCGGAGGCGGCGCTGG + Intergenic
1065960078 10:30727011-30727033 TGTGAAGCCGGAGGCGGCGCTGG - Intergenic
1066370456 10:34814990-34815012 TTTCATGCCGCCGCCGCCGCGGG + Exonic
1076817066 10:132920259-132920281 GGCCACCCCGGCGCCGGCGCAGG - Intronic
1081700054 11:45147032-45147054 GGTCCGGACGGCGCCGGCGCGGG + Intronic
1087252955 11:95924049-95924071 AGTCAGGCCAGCGCCGGCCCGGG + Exonic
1091286771 11:134412303-134412325 GGTCCCGCCGGCGCTGGCGCGGG - Intergenic
1094155551 12:27333465-27333487 TGCCATGCCGACGCCGACGCGGG - Intronic
1096134473 12:49188363-49188385 TGTCAGGGCGGCGCAGGGGCGGG - Intronic
1104568223 12:129903733-129903755 TGGCTAGCGGGCGCTGGCGCAGG + Intergenic
1113806131 13:113110721-113110743 TGGCGCGCCGGCGCCGGTGCAGG - Exonic
1122551901 14:102555031-102555053 TGGCAAGCCTGGGCTGGCGCTGG - Intergenic
1123001954 14:105300624-105300646 CGTCATGCCGGCGACCGCGCGGG + Exonic
1131144012 15:90000348-90000370 TGTCCGGCCTGCGCCGGAGCTGG + Intergenic
1131495268 15:92904288-92904310 AGGCCGGCCGGCGCCGGCGCGGG + Intronic
1133086592 16:3368868-3368890 TGTCCAGCCGGTTCCAGCGCTGG + Intronic
1145907548 17:28524623-28524645 TGCCCAGCCGGCCCCGGCCCTGG + Exonic
1146277323 17:31523996-31524018 GGTCAAGCAGGCAGCGGCGCTGG + Exonic
1154266471 18:12883531-12883553 GGTCCAGCTGGCGCCCGCGCAGG - Intronic
1158602113 18:58864069-58864091 TGCCCGGCCGGCGCCGGCGGGGG - Intronic
1160653411 19:246523-246545 CGGCGCGCCGGCGCCGGCGCAGG + Intergenic
1164855237 19:31516039-31516061 TGTCAACACGGCCCCGGAGCTGG - Intergenic
929218210 2:39437438-39437460 TGCCAGGCCGGGGCCGGCGGCGG + Intergenic
945594875 2:211778622-211778644 TGTCCAGCCGGTTCCAGCGCCGG - Intronic
1175569945 20:60010841-60010863 TGTCGAGCCGGAGCCTGCCCAGG + Intronic
961612750 3:128153561-128153583 CGGCAAGACGGCGCTGGCGCGGG + Exonic
984024137 4:174522583-174522605 TGTCAAGCCAGCGCCCGCCGGGG + Exonic
997965454 5:138352777-138352799 GGTCAGGCCGGCCCCGGCGATGG + Exonic
1002277511 5:178113588-178113610 CGCCAATCCGGCTCCGGCGCCGG + Exonic
1003942605 6:11044129-11044151 GGCCGAGCGGGCGCCGGCGCGGG - Intronic
1019523674 7:1471396-1471418 AGTCAAGCCGCCGCCAGAGCAGG - Intronic
1021716966 7:23469682-23469704 TGTCAAGAAAGCCCCGGCGCTGG - Intronic
1022207524 7:28179572-28179594 TCTCCAGCGGGCGCCGCCGCAGG + Intronic
1034978046 7:155459204-155459226 TGTGAAGCTGACGCCGGCCCGGG + Intronic
1043463806 8:80486342-80486364 TGCGAAGCCGGCGGCGGCGTCGG + Exonic
1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG + Exonic
1049100941 8:140578512-140578534 TTTCGAGCCGGCGCAGGCACTGG + Intronic
1052866354 9:33466796-33466818 TGTCCAGCAGGCGGCGGTGCTGG - Intronic
1053288486 9:36864827-36864849 TGACAGCCCGGCTCCGGCGCCGG - Intronic
1198051749 X:132957849-132957871 GGGCAAGCGGGCGCGGGCGCCGG - Intronic